ID: 925082325

View in Genome Browser
Species Human (GRCh38)
Location 2:1080081-1080103
Sequence CCCCCTCGCCACCGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925082325_925082339 18 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082339 2:1080122-1080144 TGTGGCTGGGGGACAAGCGATGG 0: 1
1: 0
2: 0
3: 20
4: 290
925082325_925082335 5 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082335 2:1080109-1080131 TCCTGGGCAATGGTGTGGCTGGG 0: 1
1: 0
2: 1
3: 33
4: 555
925082325_925082334 4 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082334 2:1080108-1080130 GTCCTGGGCAATGGTGTGGCTGG 0: 1
1: 0
2: 1
3: 31
4: 224
925082325_925082333 0 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082333 2:1080104-1080126 ACTTGTCCTGGGCAATGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 137
925082325_925082337 6 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082337 2:1080110-1080132 CCTGGGCAATGGTGTGGCTGGGG 0: 1
1: 0
2: 3
3: 64
4: 641
925082325_925082332 -5 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082332 2:1080099-1080121 GGGGGACTTGTCCTGGGCAATGG 0: 1
1: 0
2: 2
3: 14
4: 192
925082325_925082338 7 Left 925082325 2:1080081-1080103 CCCCCAGGGCGGTGGCGAGGGGG 0: 1
1: 0
2: 1
3: 39
4: 254
Right 925082338 2:1080111-1080133 CTGGGCAATGGTGTGGCTGGGGG 0: 1
1: 0
2: 2
3: 34
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925082325 Original CRISPR CCCCCTCGCCACCGCCCTGG GGG (reversed) Intronic