ID: 925084575

View in Genome Browser
Species Human (GRCh38)
Location 2:1097910-1097932
Sequence CCTCACAAGCAGAATGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925084571_925084575 3 Left 925084571 2:1097884-1097906 CCCTCGTTTCTTCATGGAGCTCC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230
925084565_925084575 30 Left 925084565 2:1097857-1097879 CCTTTCACCACCTGGGAGAAGGT 0: 1
1: 0
2: 1
3: 21
4: 166
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230
925084567_925084575 23 Left 925084567 2:1097864-1097886 CCACCTGGGAGAAGGTGGACCCC 0: 1
1: 0
2: 1
3: 14
4: 218
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230
925084568_925084575 20 Left 925084568 2:1097867-1097889 CCTGGGAGAAGGTGGACCCCTCG 0: 1
1: 0
2: 1
3: 13
4: 136
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230
925084572_925084575 2 Left 925084572 2:1097885-1097907 CCTCGTTTCTTCATGGAGCTCCG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230
925084570_925084575 4 Left 925084570 2:1097883-1097905 CCCCTCGTTTCTTCATGGAGCTC 0: 1
1: 0
2: 1
3: 12
4: 142
Right 925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG 0: 1
1: 1
2: 2
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925084575 Original CRISPR CCTCACAAGCAGAATGCAGA CGG Intronic
900822240 1:4898683-4898705 CCCCACAAGCAGAGAGCAAATGG - Intergenic
903083978 1:20838469-20838491 CCTCACAATCAGATTGAATATGG - Intronic
903681075 1:25097513-25097535 CTTAACAAGCAGATTGGAGATGG + Intergenic
906322606 1:44826542-44826564 GCACACCAGCAGGATGCAGACGG + Exonic
908269925 1:62412519-62412541 ACACACAAGCTGACTGCAGATGG + Intergenic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
910910511 1:92229195-92229217 CATCACCAACAGGATGCAGAAGG - Intronic
912153983 1:106893245-106893267 ATTCACAAGCAGAATTAAGAAGG + Intergenic
913091663 1:115480297-115480319 CCTCACAGGCAGCCTCCAGAAGG - Intergenic
917202918 1:172536147-172536169 CCTCACATGTAAAATGCAAAAGG - Intronic
917829989 1:178872345-178872367 GCTCACAAGAAGAATGGAGCAGG + Intronic
918247402 1:182671984-182672006 CCTCATTGGCAGGATGCAGAAGG + Intronic
919003130 1:191860431-191860453 GTTCTCAAGCAGAAAGCAGAAGG - Intergenic
920803011 1:209207192-209207214 CCTGACAAGGAGGAAGCAGAGGG + Intergenic
921481600 1:215670348-215670370 TATCACAAGAAGAATGCAAATGG + Intronic
921703438 1:218292364-218292386 GCCCACAAGCATAATGCTGACGG - Intronic
922859986 1:228808192-228808214 CCTCACAAGCAACATCCAGGTGG - Intergenic
923573728 1:235140088-235140110 CCTCTCAAGAAGAATCCAGGTGG - Intronic
924897187 1:248352823-248352845 CCTCACAAGGGGAAGACAGAAGG + Intergenic
1066235636 10:33481599-33481621 ACTCACACCCAGAAAGCAGAAGG - Intergenic
1066447068 10:35492966-35492988 CCTCAAGAGAAGACTGCAGAGGG - Intronic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067468032 10:46515878-46515900 CTCCCCAAGCAGGATGCAGAGGG + Intergenic
1068138383 10:52973778-52973800 CCACACAAGCAGAATGAAAGTGG + Intergenic
1070935523 10:80291620-80291642 CCTCCCATGCAGCATGGAGAAGG + Intergenic
1072008368 10:91280082-91280104 GCTCACAAGCAGAATTTAAAAGG + Exonic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1075326350 10:121535050-121535072 CCTCACAAGAGGAAGACAGAAGG + Intronic
1075332024 10:121580867-121580889 CCTCCAAAGCAGCATTCAGAGGG + Intronic
1075484660 10:122812520-122812542 CTTCACAAGTAGAGTGTAGAGGG + Intergenic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1077167333 11:1149728-1149750 CCACACACACAGAAAGCAGATGG - Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083289831 11:61683627-61683649 CATCCCAAGCAGAAGGCAAAGGG - Intronic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1087150309 11:94853989-94854011 TCTCACATGCAGACTGCAGCTGG - Exonic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1089267405 11:117274794-117274816 CCTCCCAAGTAGAACACAGATGG + Intronic
1089400040 11:118159194-118159216 CCTAAAAAGAAGACTGCAGAGGG + Intergenic
1089442439 11:118528714-118528736 CCTCTCAGGCAGCAGGCAGATGG - Exonic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1090698038 11:129268452-129268474 CCTCCCAAGGATAATGTAGAAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092803865 12:12200584-12200606 CATCAGGAGCAGTATGCAGAGGG - Intronic
1092963852 12:13622699-13622721 CATCCCACGCAGAAGGCAGAAGG + Intronic
1094208266 12:27863308-27863330 CCTCTCAAGCCCAATTCAGAGGG - Intergenic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1097718163 12:62989505-62989527 CCTCAATAGCAGATTTCAGATGG + Intergenic
1099443598 12:82727307-82727329 CCCAACAAGCAGAATACAAATGG - Intronic
1099495347 12:83339829-83339851 CACCACAAGCAGATTGAAGAAGG + Intergenic
1102755665 12:115338034-115338056 CCTCCCCATCAGAATGCAGCAGG + Intergenic
1104234359 12:126918640-126918662 CCATAGAGGCAGAATGCAGATGG - Intergenic
1104428350 12:128696260-128696282 CCTTCCAAACAGAATGGAGAAGG + Intronic
1105636215 13:22217995-22218017 ACACAGCAGCAGAATGCAGAGGG + Intergenic
1105954662 13:25269075-25269097 CCTCAGAAGCAGTTTCCAGAGGG - Intronic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1110557457 13:76876625-76876647 CCCAAAAAGCAGAATGGAGAAGG + Intergenic
1111621009 13:90725943-90725965 CCTTAGAAAAAGAATGCAGAGGG + Intergenic
1112883295 13:104135804-104135826 CCACACAAGCAGGAAGCAGAAGG - Intergenic
1113589914 13:111491224-111491246 CCTCAGAAGCTGACGGCAGAAGG + Intergenic
1114175248 14:20312735-20312757 CCTAACAAGCAGAAAAGAGATGG + Intronic
1117991584 14:61439246-61439268 CTTCACCATCGGAATGCAGAGGG - Intronic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1118847311 14:69557438-69557460 CCACACAAACAGAATACACAAGG - Intergenic
1119313048 14:73667009-73667031 CCTCACCATCAGTATGCTGATGG + Intronic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1120750419 14:88192330-88192352 CGTCACAAACACAATGCAGCCGG + Exonic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121674360 14:95740535-95740557 CTTCCAAAGCAGAGTGCAGAAGG - Intergenic
1121772722 14:96563396-96563418 CCTCACATACAGAATACAGTAGG + Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122394661 14:101415091-101415113 CCTCACAATCTCATTGCAGATGG - Intergenic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1124137559 15:27048366-27048388 CCTCACAAGCAGACTAGATATGG + Intronic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1128751177 15:70150664-70150686 TCTTACAAGCAGATTTCAGAGGG + Intergenic
1130070925 15:80646286-80646308 CCTCTGAAGCAGAATGCATGAGG - Intergenic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131337896 15:91567523-91567545 CCTCATAGCCAGAAAGCAGAAGG - Intergenic
1133441546 16:5824943-5824965 CCTCACAGTAAGAATCCAGATGG - Intergenic
1134652451 16:15920800-15920822 CCCCAGAAGAAGAATGGAGATGG - Intergenic
1136358222 16:29760581-29760603 CCTCACAAGTAGAATGCATCAGG + Intergenic
1137031573 16:35528902-35528924 TGTCTCATGCAGAATGCAGATGG + Intergenic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1138888668 16:61113928-61113950 ACACACAAACATAATGCAGAAGG - Intergenic
1139056742 16:63194917-63194939 CCCCACCAGCAGGAAGCAGAAGG + Intergenic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1141492427 16:84383140-84383162 CCTCAGTAGCAGAAAGCAGTAGG - Intronic
1143773587 17:9183359-9183381 TCGCACAAGCAGAATGCAGGGGG + Intronic
1144837668 17:18165524-18165546 CCTCATAAGAGGAAAGCAGAAGG - Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1148208033 17:45791745-45791767 CCCCAGAAGCAGGGTGCAGAAGG + Intronic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1152683097 17:81679897-81679919 CCCCACAAGCAAAGTGCAGCAGG + Intergenic
1156147784 18:34206981-34207003 GCTCAAAAGTAGAATGGAGATGG - Intronic
1156268513 18:35509940-35509962 GCTCACAAGAAGAATGAAGCTGG + Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1160042743 18:75360537-75360559 CATCACAAGAAGGAGGCAGAAGG - Intergenic
1161338158 19:3725758-3725780 CCTGAAAAGCAAAAAGCAGAAGG - Intronic
1163260188 19:16184976-16184998 CCCCAGTAGCAGACTGCAGACGG - Intergenic
1164681083 19:30134133-30134155 CATGAGAAGCAGAATTCAGATGG - Intergenic
1165677139 19:37736252-37736274 ACTCCCAAGCAGAATGTTGAAGG + Intronic
1168515053 19:57003927-57003949 GCTCACCAGCAGAATTCAGATGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925900029 2:8502632-8502654 TCCCACAAGATGAATGCAGAGGG - Intergenic
926093551 2:10065720-10065742 CCTGCCAAGGAGATTGCAGAAGG - Intronic
926537151 2:14127518-14127540 ACTTACAAGCAGAAGGCAAAGGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
928697217 2:33861528-33861550 CCTCACAACCAGAAAGAAGTAGG - Intergenic
930685796 2:54306753-54306775 TCTCAGAAGCAGCATGCAAAGGG - Intergenic
932091967 2:68813905-68813927 TCTCACAAGCATATTGCAGATGG - Intronic
932615177 2:73227034-73227056 CCTCAGCAGGAGAATGCAGCAGG - Exonic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935581078 2:104756330-104756352 CCTCACAAGTAAAATGCAGACGG - Intergenic
937838456 2:126498139-126498161 CCTCAGCAGCAGAATGCAGTTGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940582666 2:155601171-155601193 CCTCAGAAGCAGTTTCCAGATGG + Intergenic
940718755 2:157258497-157258519 CCTAACAAGCAGAAGACAGACGG + Exonic
942078808 2:172381525-172381547 ACTCACAGGCAAGATGCAGATGG - Intergenic
943753361 2:191533074-191533096 CCTCACACCCAGAATGAAGGCGG + Intergenic
944371172 2:198985438-198985460 CCTCACTAGGGCAATGCAGAGGG - Intergenic
944970545 2:204987895-204987917 GCTGACAAGCAGAATCCAAAGGG + Intronic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
1169294857 20:4386286-4386308 GCTCAACAGCAGAATGAAGAGGG + Intergenic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1173349414 20:42231353-42231375 GCTCACAGCCAGAATGCAGCAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174884012 20:54311816-54311838 CCTCACATTCAGGAGGCAGAAGG + Intergenic
1177005685 21:15669483-15669505 TCTCACAAACAGATTGCAGTTGG - Intergenic
1178246791 21:30960713-30960735 CCTTACAAGAAAGATGCAGAGGG + Intergenic
1178500520 21:33122158-33122180 CCCCACAAGAAGAATTTAGAGGG + Intergenic
1179487680 21:41721403-41721425 CCTCTCAACAAGAATGCAGCTGG - Intergenic
1180911951 22:19456800-19456822 ACTCAAAAGCAGCATGCAGCAGG + Intronic
1181978873 22:26752262-26752284 CCTCGGACACAGAATGCAGAGGG - Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949446023 3:4134581-4134603 ATTCAAAAGCAGAAGGCAGAAGG + Intronic
950322694 3:12071160-12071182 CATCACCAACAGGATGCAGAAGG + Intronic
951566908 3:24020118-24020140 CCTCAGAAGCAGTTTCCAGAGGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952184373 3:30953089-30953111 CTTGACAAACAGAATACAGAAGG - Intergenic
953805391 3:46063558-46063580 CCTCAGAAGCACAAGGCAGGTGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955759081 3:62258881-62258903 CCCCACAAACATAATGCAGAAGG + Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
956772382 3:72537476-72537498 TCAGACAAACAGAATGCAGATGG - Intergenic
961201086 3:125046088-125046110 CCACAGAGGCAGAAAGCAGAAGG + Intronic
961312362 3:126011326-126011348 GCTCAATAGCAGAATGGAGAGGG + Intronic
962467783 3:135676272-135676294 CCTCAATAGCAGAATGGATATGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963482186 3:145890080-145890102 CCCCACAAGCTGAGTACAGAAGG + Intergenic
963616479 3:147544939-147544961 TTTCATAAGAAGAATGCAGATGG + Intergenic
964721454 3:159770741-159770763 CCTGGAAAGCAGGATGCAGATGG - Intronic
966254125 3:177898708-177898730 CCTCAGAAGCAGTTTCCAGAGGG - Intergenic
966632395 3:182092721-182092743 CCAAAGAAGCAAAATGCAGAAGG - Intergenic
967336027 3:188345666-188345688 CCCCACAAGAATAAGGCAGAAGG - Intronic
967977307 3:195042661-195042683 CCCCAAAATCAGAATGCAGCGGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969403848 4:6975738-6975760 GCTCAATAGCAGAATGGAGATGG + Intronic
969868041 4:10087895-10087917 CCCCAGAAGCAGAAAGCAAATGG + Exonic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
970772434 4:19630120-19630142 CCACAGAAGCAAAATGCACAGGG - Intergenic
971381323 4:26100997-26101019 CCTCCCAAGTAGAAGGCATAAGG + Intergenic
979665583 4:123307306-123307328 CATCACATTCAAAATGCAGATGG - Intronic
982159948 4:152558484-152558506 CCTCTCAAGCAGAAAGAACATGG - Intergenic
982161964 4:152579339-152579361 TCTCCCAAGCAGATTGCACAAGG - Intergenic
982382329 4:154762293-154762315 CCTCACAATCAGAATGCAGAGGG + Intergenic
984933167 4:184866587-184866609 CATCGCAAGCAGAACACAGAAGG - Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986498001 5:8366217-8366239 CCTCCCAAGCTGAATGCTCAGGG - Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988468401 5:31513191-31513213 CCTCACACGCAGGATGCAGAGGG - Intronic
988694860 5:33611090-33611112 CCTCAAAAGCATAATGTTGAGGG + Intronic
990180024 5:53150622-53150644 CCTATCAAGCAGAATGGATATGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992712995 5:79479416-79479438 CCTCACAAGAGGGATGCAGAGGG + Intronic
992801461 5:80299860-80299882 CATCACCAACAGGATGCAGAAGG - Intergenic
996030594 5:118700058-118700080 CCCTACAGGCAGAAAGCAGATGG - Intergenic
996237561 5:121150663-121150685 CCTCACCAGAGGAATGCTGATGG + Intergenic
997442045 5:133915580-133915602 CCTCACAAGTAACAGGCAGAGGG + Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999718447 5:154380714-154380736 CCTTAAAAGCCCAATGCAGAGGG + Intronic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001260802 5:170226945-170226967 CCACAGAATCAGAAAGCAGATGG + Intergenic
1001993268 5:176134440-176134462 CCTCACAAGGAGAAGCCAGGGGG + Intergenic
1002070762 5:176677782-176677804 CCTTACAAGCAGAGACCAGATGG + Intergenic
1003186790 6:3839169-3839191 CCACTCAAGCAGAAGGCAAAAGG + Intergenic
1003633045 6:7805757-7805779 CCTCACAAAGAGAATTCTGAGGG + Intronic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1011526950 6:88276064-88276086 CATCACAGACAGGATGCAGAAGG - Intergenic
1012983009 6:105849825-105849847 CCTCACATGTTGAATGCAAAAGG - Intergenic
1013537922 6:111080451-111080473 CTTCAAAAGCAGGATGCAAATGG - Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1016069452 6:139722347-139722369 CCTCATAACCATAATGAAGACGG - Intergenic
1017003880 6:150015460-150015482 CATCAGAAGAAGAATGCAAATGG - Intergenic
1017058687 6:150460408-150460430 CCTCACAGGCAGCATGCTCACGG + Intergenic
1017313663 6:153003027-153003049 CCTCACTATCAGAAAACAGAGGG - Intergenic
1018337586 6:162810669-162810691 GCTCAACAGCAGAATGCAGTAGG + Intronic
1020453192 7:8343444-8343466 CATAACAAGAAGAAAGCAGATGG + Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1022568042 7:31423094-31423116 ACTCACAATCTGCATGCAGAGGG - Intergenic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1023984358 7:45086248-45086270 CCTCAAACGCAGCGTGCAGAGGG - Intronic
1024941706 7:54769448-54769470 CCTTTCAAGCAGAATTCTGAGGG - Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1034947637 7:155273641-155273663 TCCCACGAGCAGAAGGCAGAAGG + Intergenic
1037038149 8:14194936-14194958 CCTCACGTGCAGAATTCAGAGGG + Intronic
1038272235 8:26084596-26084618 CCCCAGGAGCAGAGTGCAGAGGG + Intergenic
1039251252 8:35666550-35666572 CATAACAACCAGAATGCAAAGGG + Intronic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039938125 8:42065927-42065949 CCTCCCAAGTAGCTTGCAGAGGG + Intergenic
1043167993 8:76928195-76928217 CCTCTCAAGCAGTATGTACAGGG - Intergenic
1045357381 8:101401912-101401934 CCTCAGAGACAGAATGCAGAGGG - Intergenic
1045519651 8:102892696-102892718 CCTCAGAGGCAGCTTGCAGAAGG + Intronic
1046174166 8:110553158-110553180 TCCCATAAGCAGAATGCAGTAGG - Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1049028256 8:140012631-140012653 CCTGACCAGCAGGATGCAGGAGG - Intronic
1050066311 9:1763473-1763495 CAGCAAAAGCAGACTGCAGAAGG + Intergenic
1050808846 9:9718767-9718789 CCTCAGAAGCAGTTTCCAGAGGG - Intronic
1051111035 9:13637004-13637026 CATCAGAAGCAGACTTCAGAGGG + Intergenic
1052844742 9:33325322-33325344 CATCACAACCAGAAGGCAGTAGG + Intronic
1052884324 9:33629043-33629065 CATCACAAGCAGGTTGCTGACGG + Intergenic
1053265336 9:36708939-36708961 ACACACCTGCAGAATGCAGATGG - Intergenic
1054456980 9:65437023-65437045 CTTCACAAACAGATTGGAGATGG + Intergenic
1055426635 9:76203482-76203504 CAAAACAAGCAGAAGGCAGAAGG + Intronic
1057125469 9:92612810-92612832 CCTCCCAGGCTGAATGCACAGGG + Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1058138391 9:101333096-101333118 CCTCACTAACAGACTGGAGAAGG + Intergenic
1058561019 9:106229231-106229253 CCTTGGAAGTAGAATGCAGAAGG + Intergenic
1058813550 9:108663837-108663859 CTTAACAAGCTGAATGCTGAAGG + Intergenic
1061302175 9:129711749-129711771 CCTCACTAGCAGAGTGCCGTGGG - Intronic
1062371250 9:136240026-136240048 CCTCTAAAGCAGAATGCAAATGG + Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1186781994 X:12922053-12922075 CCTGACAACCCGAAGGCAGAAGG + Exonic
1187582065 X:20617638-20617660 CCTCACTGGCAGAAATCAGAAGG + Intergenic
1188754957 X:33951162-33951184 TCTCAAAAGAAGAATGCAAAGGG + Intergenic
1188817930 X:34738503-34738525 CTATCCAAGCAGAATGCAGAAGG + Intergenic
1189206601 X:39244956-39244978 CCTCTCAATCATAATGGAGAGGG + Intergenic
1189942531 X:46139767-46139789 CTTAACAATTAGAATGCAGAAGG - Intergenic
1194691258 X:96988378-96988400 CCTCAGAAGCAGAATCCAGCAGG + Intronic
1195676578 X:107511553-107511575 CCTCACAGGAAGGAAGCAGATGG + Intergenic
1197341478 X:125272128-125272150 CCTCAAAAGTTGAAAGCAGAGGG - Intergenic
1197388024 X:125825129-125825151 TCTGACAAGCAAAATGCTGAGGG - Intergenic
1198127682 X:133662404-133662426 CCTCTCATGGAGAACGCAGAGGG - Intronic
1201720588 Y:17092848-17092870 CCTGACAAGCGGATTTCAGATGG - Intergenic