ID: 925084775

View in Genome Browser
Species Human (GRCh38)
Location 2:1099506-1099528
Sequence AGGGCACTCTACCTGCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925084775_925084778 -9 Left 925084775 2:1099506-1099528 CCAGTATGCAGGTAGAGTGCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 925084778 2:1099520-1099542 GAGTGCCCTGAAGAGGCTGGAGG 0: 1
1: 0
2: 2
3: 31
4: 302
925084775_925084784 4 Left 925084775 2:1099506-1099528 CCAGTATGCAGGTAGAGTGCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 925084784 2:1099533-1099555 AGGCTGGAGGTCCCAGGCTGGGG 0: 1
1: 0
2: 6
3: 85
4: 719
925084775_925084782 2 Left 925084775 2:1099506-1099528 CCAGTATGCAGGTAGAGTGCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 925084782 2:1099531-1099553 AGAGGCTGGAGGTCCCAGGCTGG 0: 1
1: 1
2: 4
3: 59
4: 568
925084775_925084781 -2 Left 925084775 2:1099506-1099528 CCAGTATGCAGGTAGAGTGCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 925084781 2:1099527-1099549 CTGAAGAGGCTGGAGGTCCCAGG 0: 1
1: 1
2: 3
3: 34
4: 349
925084775_925084783 3 Left 925084775 2:1099506-1099528 CCAGTATGCAGGTAGAGTGCCCT 0: 1
1: 0
2: 0
3: 1
4: 75
Right 925084783 2:1099532-1099554 GAGGCTGGAGGTCCCAGGCTGGG 0: 1
1: 0
2: 3
3: 64
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925084775 Original CRISPR AGGGCACTCTACCTGCATAC TGG (reversed) Intronic
910217515 1:84857201-84857223 AGGGCATTCTGCTTGAATACAGG + Intronic
916260891 1:162841037-162841059 AGTGCACTGTACTTGCATGCTGG + Intronic
1063892603 10:10645703-10645725 AGGACACTCTCCCTGCACTCTGG - Intergenic
1074752267 10:116598109-116598131 AGGGCATTCTTCTTGCATCCCGG - Exonic
1074783472 10:116818909-116818931 AGGGCACCCTTCCTGCTTCCAGG + Intergenic
1076478561 10:130769116-130769138 AGGTTACTCTACCTGCATGGGGG + Intergenic
1077483594 11:2828027-2828049 AGGGAACACTACCTGCAAAGGGG + Intronic
1079348432 11:19672753-19672775 AGGGCACTCAACCTGCCCATGGG - Intronic
1086249349 11:84795256-84795278 AGGACACTCTGCCTGCAGAGAGG + Intronic
1087561610 11:99797004-99797026 AGGGCACCCTAGCTTCATGCAGG + Intronic
1089263323 11:117238445-117238467 AGGCTATACTACCTGCATACAGG + Intronic
1089466331 11:118688931-118688953 AGGCAACTCTACCTGCAGCCGGG - Intergenic
1100299564 12:93294638-93294660 AGATCACTCTTCCTGCATAGTGG + Intergenic
1102435115 12:112916783-112916805 AAGGCACTGTACCTGTATCCAGG - Intronic
1105881276 13:24608519-24608541 AAGACAGTATACCTGCATACTGG + Intergenic
1107484157 13:40810529-40810551 AAGACAGTATACCTGCATACTGG + Intergenic
1107593941 13:41942042-41942064 AGGGCACTTTTCCTGCTTTCTGG - Intronic
1107901289 13:45017277-45017299 TGAGCACTCTGCCTGCATATTGG + Intronic
1108585388 13:51866081-51866103 AGGGCCCTGCACCTGCATGCTGG - Exonic
1112443824 13:99445457-99445479 CTGGCACGCTAGCTGCATACGGG - Intergenic
1115420786 14:33192616-33192638 AGGGCATCTTACCTTCATACGGG + Intronic
1117284007 14:54268477-54268499 AGTGAACTCTACCTGCAGATGGG - Intergenic
1118697087 14:68395704-68395726 TGGGCACTCTGCCTGAATCCAGG - Intronic
1120590080 14:86364411-86364433 AGGACACTCTGCCTGCAGAGAGG + Intergenic
1120969841 14:90198157-90198179 AGGGCGCTCTGCCTGTGTACCGG - Intergenic
1121437798 14:93930396-93930418 AGGGGCCTCCACCTGCACACAGG + Intergenic
1123149483 14:106167003-106167025 AGGGCACCTCACCTTCATACAGG + Intergenic
1123172981 14:106391305-106391327 AGGTCACTTCACCTTCATACAGG + Intergenic
1129852871 15:78804600-78804622 AGGGCACTCTACGTGCAGTTCGG - Intronic
1130250093 15:82294445-82294467 AGGGCACTCTACATGCAGTTTGG + Intergenic
1131395421 15:92081746-92081768 AGGTGATTCTACCTGCAGACAGG - Intronic
1131424723 15:92336192-92336214 AAGGCACTCTTCCTACACACTGG - Intergenic
1132366991 15:101264944-101264966 AGGGCTCCCTGCATGCATACAGG + Intergenic
1132714221 16:1282736-1282758 CGGGCACTCTCCCTGCACATCGG - Intergenic
1146985822 17:37216874-37216896 ACGGCACTCTGTCTGCAAACTGG - Intronic
1147582577 17:41635606-41635628 TGGGCTCTCTGCCCGCATACGGG + Intergenic
1151343324 17:73485923-73485945 AGGTCACTCTGACTGCAGACTGG + Intronic
1151770232 17:76155804-76155826 AGAGCCCTCTCCCTGCATTCAGG + Intronic
1157837708 18:50922712-50922734 AGGCCAAGCTACCTGCACACTGG - Intronic
1159217205 18:65408522-65408544 ATGGCACTGTGCCTGGATACAGG + Intergenic
1165529476 19:36386186-36386208 AGGGCACTCTACTGGCATGTGGG - Intronic
1167178497 19:47883128-47883150 GGGGCAGTCAACCTGGATACAGG + Intronic
925084775 2:1099506-1099528 AGGGCACTCTACCTGCATACTGG - Intronic
933894610 2:86799449-86799471 AGATGACTCTACCTGGATACTGG - Intronic
935363323 2:102266391-102266413 ATGACACTCTAGCTGCATTCTGG + Intergenic
948621401 2:239237124-239237146 AGGCCACTCTAGCTGCAAATAGG + Intronic
1170922743 20:20694320-20694342 AGGTCATTCCACCTGCAAACTGG - Intronic
1175673252 20:60924544-60924566 AGGTCACTCTACATGTATACTGG - Intergenic
1178627808 21:34232934-34232956 AGAGCAATCTACCTGCAGGCAGG - Intergenic
1181527186 22:23496660-23496682 AGGGCCCCCTTCCTGCATCCAGG - Intergenic
1183005610 22:34899095-34899117 AGGGCTCTCTCTCTGCATAGTGG - Intergenic
1183415908 22:37681728-37681750 AGGGCACTCCATCTGCAGCCAGG - Intronic
950003094 3:9672748-9672770 AGAGCCCCCTACCTGGATACGGG - Exonic
951074927 3:18378877-18378899 AAGGCACTCTACCTGCTTCATGG - Intronic
951117728 3:18885474-18885496 AGGGCACTCCACCCCCACACAGG + Intergenic
968128573 3:196178245-196178267 AGGGAACTCTGCCTGCCCACTGG - Intergenic
970786946 4:19809352-19809374 AGGGCACTCTTTCTGCCAACAGG - Intergenic
974878746 4:67728716-67728738 AGAGCATTCTAGCTGCATAGTGG + Intergenic
994296166 5:98090778-98090800 AGGGCACTCTACCTTGAAAATGG + Intergenic
996978089 5:129459540-129459562 AGGCACCTCTACCTGCACACGGG + Intergenic
1004767918 6:18752341-18752363 CGGGCACTCTACCTGCAATTTGG + Intergenic
1006408958 6:33861022-33861044 TGGGCTTTCTACCTGCAGACAGG + Intergenic
1012122411 6:95384668-95384690 AGGACACTCTGCCTGCAAAGAGG + Intergenic
1013129203 6:107215624-107215646 AAGGCAATATAACTGCATACTGG + Intronic
1016345285 6:143106467-143106489 AGGGCACTCTACATTCATTGAGG + Intronic
1022623008 7:32004394-32004416 AGTGGACTCTTACTGCATACAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031607520 7:123787416-123787438 AGGGCAGCCTACCTTCAAACAGG - Intergenic
1035320561 7:158026761-158026783 AGGGCACTCTGCCTTCCTCCCGG - Intronic
1039374335 8:37018271-37018293 AGGGTACTCAACCTGTATATGGG + Intergenic
1049741799 8:144244584-144244606 AGGGCACTCCACCTGGCTGCTGG + Intronic
1050146686 9:2575495-2575517 AGGGCACTATGCCAGCATATAGG - Intergenic
1050672581 9:8014483-8014505 TGAGCAATCCACCTGCATACAGG - Intergenic
1056868486 9:90253748-90253770 AGGGAACTCTACCTGAAAAAGGG - Intergenic
1056932150 9:90888001-90888023 AGGGCACATTAACTGCTTACTGG - Intronic
1189141679 X:38613659-38613681 AGGGCAGTCTCTCTGCATTCAGG + Intronic
1201240681 Y:11954418-11954440 AGTGCAATCTGCCTGCATGCGGG - Intergenic