ID: 925084949

View in Genome Browser
Species Human (GRCh38)
Location 2:1100613-1100635
Sequence CACGCCCGACACAGCAACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 24}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925084949_925084957 21 Left 925084949 2:1100613-1100635 CCACCGTTGCTGTGTCGGGCGTG 0: 1
1: 0
2: 2
3: 2
4: 24
Right 925084957 2:1100657-1100679 GAAGCCATCTGGCTGACTGATGG 0: 1
1: 0
2: 1
3: 36
4: 187
925084949_925084959 28 Left 925084949 2:1100613-1100635 CCACCGTTGCTGTGTCGGGCGTG 0: 1
1: 0
2: 2
3: 2
4: 24
Right 925084959 2:1100664-1100686 TCTGGCTGACTGATGGATAGTGG 0: 1
1: 0
2: 0
3: 17
4: 150
925084949_925084953 10 Left 925084949 2:1100613-1100635 CCACCGTTGCTGTGTCGGGCGTG 0: 1
1: 0
2: 2
3: 2
4: 24
Right 925084953 2:1100646-1100668 GTTGCACCCCTGAAGCCATCTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925084949 Original CRISPR CACGCCCGACACAGCAACGG TGG (reversed) Intronic
900487611 1:2930913-2930935 CACCCCCCACACAGCACAGGAGG - Intergenic
909957874 1:81801532-81801554 CACGCCACACACAGCAGCGGAGG - Intronic
919801707 1:201358367-201358389 CACGCCTGACAAAGGAATGGAGG + Intergenic
1067173080 10:43923387-43923409 CAGGCCCGACCTAGCAATGGTGG + Intergenic
1077049129 11:558875-558897 CACGCCCCACCCCGCACCGGTGG - Exonic
1113824956 13:113245133-113245155 CACTCTGGACACAGCAAAGGAGG - Exonic
1121949923 14:98162854-98162876 CACGCCCGACACAGGGAGAGGGG - Intergenic
1123035991 14:105472156-105472178 CAGGCCCCACCCAGCACCGGTGG - Intergenic
1126753406 15:51900337-51900359 CAAGCCCTACACAGCAGCGTGGG - Intronic
1135325642 16:21523789-21523811 CATGCCCGACACAGCAAGTGTGG - Intergenic
1136655743 16:31708157-31708179 CACGCTGGACACAGCAGAGGTGG + Intergenic
1140682418 16:77398416-77398438 CACACACGACAGAGAAACGGAGG + Intronic
1142038653 16:87878431-87878453 CACGCCCGACACAGCAAGTGTGG - Intergenic
1142401415 16:89860715-89860737 CACCCCCTACTCAGCAACCGGGG + Exonic
1165482421 19:36072486-36072508 CACTCTCGACACAGCAGCTGAGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
925084949 2:1100613-1100635 CACGCCCGACACAGCAACGGTGG - Intronic
927168049 2:20344947-20344969 CACTCCAGCCAGAGCAACGGAGG + Intronic
947179345 2:227398371-227398393 CACTCCTGAAACAACAACGGTGG + Intergenic
948037853 2:234873635-234873657 CAGGCCAGGCACAGCACCGGAGG - Intergenic
1184059242 22:42072100-42072122 CAGGCCCGACACAGAAAGGTGGG + Intergenic
950176442 3:10878070-10878092 CACTCCCCACCCAGCAACAGAGG + Intronic
967099038 3:186200883-186200905 CCCGCCTGGCACAGCAACAGAGG - Intronic
975892900 4:79050387-79050409 CACGCAGGACAGAGCAAGGGAGG + Intergenic
1001948732 5:175801195-175801217 CACTCTCCACACAGCAACAGAGG - Intronic
1018731814 6:166657066-166657088 CACCCCCAACACAGAGACGGTGG + Intronic
1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG + Intronic
1046104725 8:109651770-109651792 CAAGCAAGACACAGCAATGGTGG - Intronic
1057441050 9:95083730-95083752 CACGCACCACACAGCACCCGCGG + Intronic