ID: 925085199

View in Genome Browser
Species Human (GRCh38)
Location 2:1102309-1102331
Sequence CAGCCTCCTCACAACAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 345}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925085199_925085204 -5 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085204 2:1102327-1102349 GGCTGTTCCAGGAAGCAGGGAGG 0: 1
1: 2
2: 3
3: 40
4: 387
925085199_925085208 16 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085208 2:1102348-1102370 GGAAGGTGGAGAGCCAGTGCAGG 0: 1
1: 0
2: 5
3: 37
4: 496
925085199_925085205 -1 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085205 2:1102331-1102353 GTTCCAGGAAGCAGGGAGGAAGG 0: 1
1: 1
2: 6
3: 81
4: 710
925085199_925085203 -8 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085203 2:1102324-1102346 GGAGGCTGTTCCAGGAAGCAGGG 0: 1
1: 0
2: 4
3: 48
4: 430
925085199_925085212 27 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085212 2:1102359-1102381 AGCCAGTGCAGGGTGCAGGAGGG 0: 1
1: 0
2: 5
3: 46
4: 458
925085199_925085209 17 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085209 2:1102349-1102371 GAAGGTGGAGAGCCAGTGCAGGG 0: 1
1: 0
2: 2
3: 40
4: 351
925085199_925085210 23 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085210 2:1102355-1102377 GGAGAGCCAGTGCAGGGTGCAGG 0: 1
1: 0
2: 5
3: 52
4: 537
925085199_925085207 2 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085207 2:1102334-1102356 CCAGGAAGCAGGGAGGAAGGTGG 0: 1
1: 0
2: 23
3: 197
4: 1530
925085199_925085211 26 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085211 2:1102358-1102380 GAGCCAGTGCAGGGTGCAGGAGG 0: 1
1: 0
2: 1
3: 45
4: 505
925085199_925085202 -9 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085202 2:1102323-1102345 AGGAGGCTGTTCCAGGAAGCAGG 0: 1
1: 0
2: 8
3: 69
4: 532
925085199_925085213 28 Left 925085199 2:1102309-1102331 CCCTGGCTGTTGTGAGGAGGCTG 0: 1
1: 0
2: 4
3: 44
4: 345
Right 925085213 2:1102360-1102382 GCCAGTGCAGGGTGCAGGAGGGG 0: 1
1: 1
2: 4
3: 77
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925085199 Original CRISPR CAGCCTCCTCACAACAGCCA GGG (reversed) Intronic
901066997 1:6498908-6498930 CAGCTTCCTCCCAGCAGGCAGGG - Intronic
901166435 1:7224972-7224994 CAGCCTCCTCATCTCAGTCAAGG - Intronic
901926191 1:12567691-12567713 CAGGCCCCTCCCAGCAGCCATGG - Intergenic
902620713 1:17649267-17649289 CTGCCTGATCACAACACCCAGGG + Intronic
903002996 1:20279662-20279684 CAGACTCCTCACCACAGTCTTGG - Intergenic
903302177 1:22386863-22386885 CAGCCTCCTCACAACCTGAATGG + Intergenic
903362599 1:22786195-22786217 CTGACTCCTCACACCAGCCTAGG - Intronic
903459776 1:23512549-23512571 GCGCCTCCTCTCACCAGCCATGG + Intronic
904343399 1:29852590-29852612 CTGCCACCACACAAGAGCCAGGG + Intergenic
904395839 1:30221318-30221340 CTGCCAGTTCACAACAGCCAAGG + Intergenic
904558739 1:31382727-31382749 CAGCCTCCACACAGCAGACAGGG - Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904853792 1:33479633-33479655 CAGCCTCCTCACCACTCTCAGGG - Exonic
906145307 1:43557095-43557117 CAGCCACCTCCCAAATGCCAGGG - Intronic
906459665 1:46027728-46027750 CAGCCTCCTAATTACATCCATGG + Exonic
906514357 1:46430133-46430155 CAGCCTCTTCACTGCAGCCTGGG - Intergenic
906669186 1:47642581-47642603 CATCCTCCACCCAGCAGCCAGGG - Intergenic
906801837 1:48744786-48744808 CAGCCTCCTCTCTACCGCTAGGG + Intronic
907283376 1:53365172-53365194 CAGTCTCCTCAAAACTGTCAAGG + Intergenic
908792251 1:67794372-67794394 CTGCTTCCTCACAAAAGCCAGGG + Intronic
909639146 1:77852531-77852553 CAGCCTTATCCAAACAGCCAAGG - Intronic
911334792 1:96569730-96569752 CAGCCTCCTCTAAACACCAAAGG + Intergenic
914385498 1:147165838-147165860 GAGCCTCCTCACTCCAGCCTGGG - Intronic
916759470 1:167803549-167803571 CAGCCTCCTAACAACAGAATGGG - Intergenic
917731179 1:177876621-177876643 CAGCCTCCTCCCCACTGCCCAGG - Intergenic
917919331 1:179737071-179737093 CAGCATTATCACAATAGCCAAGG + Intergenic
919804085 1:201370398-201370420 CAGCATCCTCCCAACAGGCCGGG - Intronic
919928168 1:202203517-202203539 CTTGCTCCTCACAACAGCCTGGG - Intronic
919970145 1:202571033-202571055 CAGCCTCCACTCACCAGTCATGG + Intronic
920253984 1:204641934-204641956 CACCCTCCTCTCTGCAGCCAGGG + Intronic
920721415 1:208390426-208390448 CAACCTCCAGAAAACAGCCAAGG - Intergenic
921410904 1:214835615-214835637 CAGACTCCTCAGAAGAACCATGG - Intergenic
922933175 1:229405780-229405802 CAGACTCCTCAAAACTGTCAAGG + Intergenic
923021659 1:230168991-230169013 AAGCCTCCTCAAAACCGTCAAGG - Intronic
1063449494 10:6142049-6142071 CAGCCTCCTGACTCCAGCCCAGG + Intergenic
1063543034 10:6953883-6953905 GAACCTCCCAACAACAGCCATGG + Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1064358576 10:14642291-14642313 CAGCCTTCTGACAAGACCCAGGG - Intronic
1065937350 10:30532444-30532466 CAGCCACTGCACAACAGCCTGGG - Intergenic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067055664 10:43048476-43048498 CAGGGTCCCCACCACAGCCATGG + Intergenic
1068563175 10:58540621-58540643 AAGCCTCCTGACAAAAGCCCAGG + Intronic
1068805341 10:61188809-61188831 CAGCCTCCTCACAACTCCTGAGG + Intergenic
1070483592 10:76909354-76909376 CATCCTCCCTACAACAGCCAAGG + Intronic
1072086749 10:92087257-92087279 AACCATCCTCACAACAGTCAGGG + Intronic
1072316368 10:94207147-94207169 CACCCTCCCCACACGAGCCAGGG - Intronic
1072427002 10:95338100-95338122 CAACCTCCTTACAACATACATGG + Intronic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1073740955 10:106406381-106406403 AAGTCTCCACACAGCAGCCAGGG - Intergenic
1074156528 10:110804973-110804995 CAGCCTCCTCGCTACAGAGAGGG + Intronic
1074299349 10:112219259-112219281 CAGCCTCCTCTCTACCCCCATGG - Intergenic
1076017612 10:127040640-127040662 CAGCCTCTTCCCAACACCCAGGG - Intronic
1076207303 10:128613371-128613393 CACCCACCTCACAAAAGGCATGG - Intergenic
1076338456 10:129726418-129726440 GAGCGTCCTCACAACACCCATGG - Intronic
1076673105 10:132133843-132133865 CAGCCTCCTCCCACCAACCCAGG - Intronic
1076770708 10:132662677-132662699 CAGCATCCTCACCTCGGCCAAGG - Intronic
1077464362 11:2726538-2726560 CACCTCCCTCACATCAGCCATGG - Intronic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1077955372 11:7013617-7013639 CAGCCTCCGTACAATAGCGATGG + Intronic
1078339878 11:10491110-10491132 CCGCCTCCTCACCCCAGCCCGGG + Intronic
1078367033 11:10715399-10715421 CAGTCCCCCCATAACAGCCATGG + Intergenic
1078487387 11:11736202-11736224 CATTCTCCACACAGCAGCCAGGG - Intergenic
1078498758 11:11847769-11847791 CATCCTCCCCACAACTGCCAGGG + Intronic
1079504309 11:21136275-21136297 CACCCCCCTCACAACAGGCATGG - Intronic
1081909880 11:46694090-46694112 CAGCCTCCTCTCAGCAATCAGGG + Intronic
1083652378 11:64210988-64211010 CAGCCTCCCCACCTCACCCATGG - Intronic
1084224236 11:67705568-67705590 CAGCCTCTGGACAACAGCCTGGG - Intergenic
1085301696 11:75462587-75462609 CAGCCTCCTCACCAAAGCCCTGG + Intronic
1087042244 11:93812970-93812992 CAGCCTCCACCCAGCAGCCCTGG + Exonic
1087281182 11:96212577-96212599 GAGCCTCCTCTCAAGAGACAAGG + Intronic
1087538099 11:99478278-99478300 CTGAATCCTCCCAACAGCCATGG - Intronic
1088084547 11:105960853-105960875 GAACCTCCTCTCCACAGCCACGG - Intronic
1088143949 11:106652223-106652245 CAGCCTCCCCACTGGAGCCAAGG + Intergenic
1088599271 11:111461037-111461059 CATCCTCCGCACAGCTGCCAGGG - Intergenic
1092132247 12:6120704-6120726 CTGCATCCCCACAACAGCCCTGG - Intronic
1096259461 12:50081714-50081736 CTGCCTCCTCACATCTGCCCTGG + Exonic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1098055440 12:66499958-66499980 CTACCACCTCACAACAGCCTGGG + Intronic
1098706898 12:73702663-73702685 CAGCCTCCTTAGCACTGCCAGGG - Intergenic
1101309227 12:103561189-103561211 CTGCCCCCTCTCCACAGCCACGG - Intergenic
1103326724 12:120126338-120126360 CAGCATCCTCCCAACTGCCAAGG - Intergenic
1103521975 12:121542224-121542246 AGGCCTCCTGCCAACAGCCACGG + Intronic
1103796551 12:123506967-123506989 CTGCCTCTGCACACCAGCCAGGG - Intronic
1104792591 12:131493295-131493317 CAGCCTCCTCACACCTGCCCGGG - Intergenic
1105518515 13:21111609-21111631 CAGTCTCCACACTACAGCCCAGG - Intergenic
1105715088 13:23055513-23055535 CAGCCTCTTCACCACACGCAGGG - Intergenic
1106192184 13:27463441-27463463 CTGCCTCCTCAGGAAAGCCATGG - Intergenic
1110331528 13:74278540-74278562 CAGTGTCCTCCAAACAGCCAAGG + Intergenic
1110434495 13:75464172-75464194 GAGCCTGTTCCCAACAGCCAGGG - Intronic
1112754192 13:102612218-102612240 CAGCCTCATCACACAGGCCAGGG - Intronic
1117204950 14:53432484-53432506 CAACCTCCAGACAGCAGCCAAGG - Intergenic
1117488171 14:56219890-56219912 CAGCCTCCTTAAAACAGCTCAGG + Intronic
1118270011 14:64334388-64334410 AGGCCTACTCCCAACAGCCAGGG - Intronic
1118347030 14:64948045-64948067 CACCCACCAGACAACAGCCAGGG - Exonic
1118838643 14:69494803-69494825 CAGCATCTTCTCAACAGGCAGGG - Intronic
1119130220 14:72165243-72165265 CAGCGTCTTTACACCAGCCAGGG + Intronic
1119945316 14:78687291-78687313 CACCCTCCATAGAACAGCCAGGG - Intronic
1120009763 14:79400247-79400269 GAGCCTCCTCTGAAAAGCCATGG - Intronic
1120741326 14:88111810-88111832 GAGCCTCCACAGAAGAGCCAAGG - Intergenic
1121846919 14:97180291-97180313 CAGCTTCCCCAAAACAGCCTGGG + Intergenic
1122112716 14:99513453-99513475 GAGCCTCCTGGCAACACCCACGG + Exonic
1122706851 14:103627308-103627330 CATGATCCTCATAACAGCCAAGG - Intronic
1123066387 14:105621534-105621556 CAGCCTCCTGAACACAGGCATGG - Intergenic
1123089859 14:105737708-105737730 CAGACCCCACACACCAGCCATGG - Intergenic
1123102947 14:105818138-105818160 CAGCCTCCTGACATGGGCCAGGG - Intergenic
1123105306 14:105838704-105838726 CTTCCTCCTCACAGCAGCCCAGG + Intergenic
1123114622 14:105889086-105889108 CAGCCACCACTGAACAGCCACGG - Intergenic
1123121065 14:105917356-105917378 CAGCCACCACTGAACAGCCACGG - Intergenic
1123403778 15:20008931-20008953 CAGCCACCACCAAACAGCCATGG - Intergenic
1123513117 15:21015577-21015599 CAGCCACCACCAAACAGCCATGG - Intergenic
1124267770 15:28252408-28252430 CAGCCTCCTCAGAAAAGGGAGGG + Intronic
1124631308 15:31339067-31339089 CCACCTCCTCCCAACACCCAAGG - Intronic
1125136598 15:36350938-36350960 CTGCCTGCCCACAACACCCATGG + Intergenic
1125793899 15:42390164-42390186 CAGACTCCCCTCAGCAGCCAGGG + Intronic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1127598387 15:60510664-60510686 CAGCCAACTGGCAACAGCCAGGG - Intronic
1127923233 15:63511611-63511633 CAGCCTCCTCACTATAGCTATGG + Intronic
1128773951 15:70304367-70304389 CTGCCTCCTCAGTGCAGCCATGG - Intergenic
1129462630 15:75707566-75707588 CAGCTTCCTCACAGCAGGCCTGG - Intronic
1129722239 15:77883850-77883872 CAGCTTCCTCACAGCAGGCCTGG + Intergenic
1130044803 15:80435423-80435445 CAGCCTCCGCTCAGCAGCAACGG - Intronic
1130517998 15:84640880-84640902 CAGGATCCTCATAACAGCCCAGG - Exonic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1131084667 15:89566372-89566394 CAGGCCCCTCAACACAGCCAGGG + Intergenic
1132074953 15:98812188-98812210 CAGCCGCATCCCAAGAGCCATGG - Intronic
1132598946 16:765431-765453 CAGCGTCCCCTCCACAGCCAGGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133229077 16:4357967-4357989 CAGCCTCCTGACATGAGCCCAGG - Exonic
1135096717 16:19570503-19570525 CATCATTCTCACAACCGCCAGGG - Intronic
1135943894 16:26847040-26847062 CAGTTTCCTCACATCAGTCATGG + Intergenic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137280696 16:46973887-46973909 CAGCTTCCTCTCAAAAGCCATGG + Intergenic
1137800702 16:51259671-51259693 CAGCCTTCTCTAACCAGCCAAGG - Intergenic
1138998677 16:62481803-62481825 CAGCATTATCACAACAGCAAAGG - Intergenic
1139441596 16:66970660-66970682 TAGTCTCCTTACAACAGCCCAGG - Intronic
1140718849 16:77752236-77752258 CAGCCTTCTAGCAAAAGCCATGG + Intergenic
1140942199 16:79732719-79732741 CTTCATCCTCACAACAACCATGG - Intergenic
1142282366 16:89155200-89155222 CTGCCTCCTCCCCACAGCCTGGG + Exonic
1142372757 16:89692110-89692132 CTGCCTGCTCCCAACAGCCCAGG - Intronic
1142876474 17:2854264-2854286 CAGGCTCCTCGCACCAGCCAGGG - Intronic
1143108751 17:4542148-4542170 CAGCCTGCCCCCAACAGCCCTGG + Intronic
1143706971 17:8705389-8705411 CATTCTCCACACAACAGCCAGGG + Intergenic
1144440010 17:15272778-15272800 CAGCTTCCTCACGTCACCCAGGG + Intergenic
1146917339 17:36686670-36686692 CAGCCTAATCACAGCAGCCCTGG + Intergenic
1148812273 17:50301051-50301073 CAGCCTCCACACCACCACCAAGG - Intergenic
1148992969 17:51682352-51682374 CAGCCTCCTCACAGTGGCCAGGG - Intronic
1149238853 17:54624903-54624925 CAGCCTCCACTAAACAGCCAAGG + Intergenic
1149718125 17:58814395-58814417 GAGACTTCTAACAACAGCCAAGG + Intronic
1150619325 17:66797575-66797597 CTGGATCCTCACAACAGCCTGGG + Intronic
1150856163 17:68755017-68755039 AAGCCTCCTGAAAACAGTCATGG + Intergenic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1152211696 17:79005778-79005800 CAGACTCTTCAGCACAGCCAAGG + Intronic
1155444261 18:25894397-25894419 CAGCCTCATCCCAAAAGCAAGGG + Intergenic
1156697705 18:39787179-39787201 CAGTCTCCTCATAACAGCAGGGG + Intergenic
1157169247 18:45386832-45386854 CATCATCTTCACAACAGCCCTGG - Intronic
1157528462 18:48403077-48403099 CAGCCTCCTCAGAACAGCTGTGG - Intronic
1157644940 18:49258669-49258691 CTGCCTACTCTCCACAGCCATGG - Intronic
1157751158 18:50179689-50179711 CAGCCTGCTCTCTAAAGCCATGG + Intronic
1157791278 18:50533403-50533425 CACCATCCTTACAACAGCAAAGG - Intergenic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1159610955 18:70525093-70525115 CAGCCTCCGCACACTAGCGATGG + Intergenic
1160019178 18:75167232-75167254 GGTCCTCCTCAGAACAGCCAAGG + Intergenic
1160282177 18:77501483-77501505 CAGTCACCTCACTTCAGCCAAGG - Intergenic
1160665291 19:325322-325344 CAGCCGCCTCCCCACAGCCTGGG - Intronic
1160838573 19:1136275-1136297 CTGCTTCCTCACAGCAGCCCTGG + Intronic
1161929360 19:7326276-7326298 CATTCTCATCACTACAGCCACGG + Intergenic
1163371645 19:16904268-16904290 CAGCCACTTCACCACAGGCAGGG + Exonic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164228578 19:23267853-23267875 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164243547 19:23410834-23410856 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164530872 19:29047306-29047328 CAGACCCCTTTCAACAGCCAAGG - Intergenic
1164588342 19:29491720-29491742 CAGCCAACACACAGCAGCCAGGG + Intergenic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1165309995 19:35023949-35023971 CTGACACATCACAACAGCCAGGG + Intronic
1167210025 19:48128385-48128407 CAGCTTCCCCATAGCAGCCAGGG + Intronic
1167624625 19:50579368-50579390 CATTCTCCACACAGCAGCCAGGG + Intergenic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
930033038 2:47069817-47069839 CAGGCTCCTCCCAGCAGCCCTGG + Intronic
930442724 2:51429313-51429335 AAGCCTCCTGCCAACAGCTATGG + Intergenic
931318150 2:61151605-61151627 CTCCCTCCTTCCAACAGCCAGGG - Intronic
931704095 2:64932595-64932617 CAACCTCCTGACCACAGCGATGG - Intergenic
935209290 2:100924619-100924641 CACCCTGCCTACAACAGCCAGGG - Intronic
935218923 2:100995452-100995474 CCACCTACTCACAACAGCCAGGG + Exonic
936146020 2:109981127-109981149 AGGCCTCCTCACCACATCCAGGG + Intergenic
936198669 2:110390351-110390373 AGGCCTCCTCACCACATCCAGGG - Intergenic
936285208 2:111176283-111176305 CAGCTTGCTCAAAACTGCCAGGG + Intergenic
938991589 2:136635350-136635372 AAGCCTCCTATTAACAGCCATGG - Intergenic
940974944 2:159932207-159932229 GACCCTCCTGACCACAGCCAAGG - Intronic
944248629 2:197558757-197558779 CAGACTATTCACAATAGCCAAGG - Intergenic
944581514 2:201136961-201136983 CAGCCTCCTCCCCAGGGCCAGGG + Intronic
946173138 2:217907149-217907171 CAGCCTTCTCACACCTGCCCAGG + Intronic
946312140 2:218888192-218888214 CAGCCTCCGCACACCAGAGAGGG - Intronic
946396847 2:219447694-219447716 CAGCCTCCTCCCCCCAGCCCTGG - Intronic
948259073 2:236589776-236589798 CCGCCTCCTCTGAACCGCCACGG - Intergenic
948290663 2:236821946-236821968 AGGCCTCCTGCCAACAGCCAGGG + Intergenic
948458097 2:238116609-238116631 CAGACCCCTCACAGCTGCCATGG - Intronic
948584760 2:239012431-239012453 CAGCCTCCACCCAACAGCCATGG + Intergenic
948671467 2:239571304-239571326 CAGCCTTCACACATCAGCAAGGG + Intergenic
948863665 2:240764709-240764731 AAACCTCCACACAACACCCAGGG - Intronic
948888631 2:240896427-240896449 CACCCTCCTCCCCACAGCCCAGG + Intronic
1168924966 20:1571831-1571853 CAGCATCCACAGCACAGCCAGGG - Exonic
1168928836 20:1604853-1604875 CAGCATCCACAGCACAGCCAAGG - Intronic
1168932639 20:1636299-1636321 CAGCATCCGCAGCACAGCCAGGG - Exonic
1168969544 20:1921579-1921601 CAGCATCCACAGCACAGCCAAGG + Exonic
1168976442 20:1969632-1969654 CAGCCCCCTCACTCCCGCCAAGG + Intergenic
1170589211 20:17758450-17758472 CATCCCCCACACATCAGCCAGGG - Intergenic
1170591579 20:17775778-17775800 CACCCTCCTCAGAGCATCCATGG + Intergenic
1170799604 20:19580142-19580164 CAGCCTCCTCACCAAAGTCCTGG + Intronic
1172130153 20:32650078-32650100 CAGCCTCCTCCCAGCACTCAGGG + Intergenic
1173986776 20:47267614-47267636 CACTCTCCACACAGCAGCCAGGG + Intronic
1174186664 20:48711050-48711072 CATCCTCCTGTCAGCAGCCAGGG - Intronic
1174238910 20:49117160-49117182 CAGCCACCTCTGATCAGCCATGG - Exonic
1174950841 20:55040309-55040331 CAGCCTATTCACAATATCCAAGG + Intergenic
1176045563 20:63090949-63090971 CACCCTCCCCACACCAGCCTGGG + Intergenic
1176235354 20:64051169-64051191 CTGCCTCCCCAGAAAAGCCAGGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178271421 21:31193406-31193428 CAGCCTCCCCAGAAAAGCCCTGG + Intronic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179800146 21:43807938-43807960 CCGACTCCTCACAACAAACAGGG - Intergenic
1179994960 21:44969912-44969934 CAGCTTCCTCAGAACAGTCAAGG - Intronic
1181474824 22:23161618-23161640 CAGTCTCCACACCACAGTCACGG - Exonic
1181537433 22:23553822-23553844 CCACCTCCTCACAGCAGCCTGGG - Intergenic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1183315281 22:37133653-37133675 CACGCTCCACACAGCAGCCAGGG + Intronic
1184668357 22:46000300-46000322 CTTCGTCCTCACAACAGCCTGGG + Intergenic
1185319931 22:50195996-50196018 CAGCCTCCCCACCAGAGCCTGGG + Intronic
1185324653 22:50219746-50219768 CCGCCTCCTCACCACGGCCTGGG + Exonic
1185405090 22:50643105-50643127 CAGCTACCTCACACCTGCCACGG - Intergenic
950070045 3:10144537-10144559 CAGCCTCCACACTCCAGCCCAGG - Intronic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
950831637 3:15880098-15880120 CAGCCTCCTCCCCAGGGCCAGGG - Intergenic
953624224 3:44557401-44557423 CAGCCTCCTCACCACTCTCAGGG - Exonic
953632326 3:44629472-44629494 CAGCCTCCTCGCCACTTCCAGGG - Exonic
953982815 3:47421107-47421129 CAGCCACCTCATAACCGGCAGGG + Intronic
954716666 3:52530245-52530267 CAGCCTCCTGGGAGCAGCCAGGG - Intronic
954885546 3:53870265-53870287 CACCCTCCACACTGCAGCCAGGG + Intronic
955083451 3:55679020-55679042 CATCCTCTACACAGCAGCCAGGG + Intronic
955679782 3:61488416-61488438 AAGCCTCCTCAAAATAGTCATGG + Intergenic
957360709 3:79153073-79153095 CGTCCTCCACACAACAGGCAAGG - Intronic
959873880 3:111359863-111359885 CACCCTCCCCACCACAGCCCTGG + Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
961392021 3:126557905-126557927 CAGAGTCCTCAGAACAGCCAGGG - Intronic
966780261 3:183578349-183578371 CATCCTCCACACCATAGCCAGGG - Intergenic
967084933 3:186085968-186085990 CAGACTCCGCACTGCAGCCATGG + Intronic
967986066 3:195096105-195096127 CAGCCTTCTCCCAGCCGCCACGG + Intronic
968489291 4:881441-881463 CAGCCTCCTCCACACGGCCAGGG + Intronic
968656435 4:1780284-1780306 CAGCCTCCTCCCCAAATCCATGG + Intergenic
969042838 4:4314412-4314434 CAGCCACTTCACTACAGCCTGGG - Intronic
969513521 4:7633270-7633292 CAGGCTCCTGGCATCAGCCACGG - Intronic
971914632 4:32851708-32851730 CAACCTACTGACACCAGCCAGGG - Intergenic
974723726 4:65773561-65773583 CAGCATTCTCACCACAGCAATGG + Intergenic
975915268 4:79317588-79317610 GAGCCACTGCACAACAGCCAAGG - Exonic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
976972791 4:91128092-91128114 CAGACTCCTGATAACAGACATGG - Intronic
977479601 4:97558575-97558597 CAACCTCCAGCCAACAGCCAAGG + Intronic
978928084 4:114274910-114274932 CAGTGTACTCAAAACAGCCAGGG - Intergenic
979476671 4:121166531-121166553 AAGACTCTTCACAACAGCCTTGG - Intronic
980256948 4:130393856-130393878 CAGCCAAGTCATAACAGCCAAGG + Intergenic
981242971 4:142500636-142500658 CAGCATTATCACAATAGCCAAGG - Intronic
982207026 4:153004566-153004588 CAGCCTCCTCCCAACACCCAGGG + Intergenic
982262363 4:153505877-153505899 CAGCCTCCTCACCACACCCTGGG - Intronic
983228768 4:165109478-165109500 CAGCCTCCTGACCACAGGCTGGG + Intronic
983485883 4:168331146-168331168 CAGCCTCCTTAGCACTGCCAGGG + Intergenic
984938736 4:184912828-184912850 CAGCCTCCACACACTAGCGATGG - Intergenic
989170357 5:38466867-38466889 CCTCCTCCTCAGAACAGCAACGG - Intergenic
993023870 5:82624404-82624426 CAGTTTCCTCACAACAGTCCTGG - Intergenic
996603746 5:125296630-125296652 CAGCATACCCACAATAGCCAAGG - Intergenic
997768173 5:136526045-136526067 CAGGTTGCTCACAACCGCCAGGG - Intergenic
998927474 5:147142333-147142355 CAGCCTCCTTAAGACTGCCAGGG + Intergenic
999387931 5:151168530-151168552 CAGCCCCCTCCCAACACACATGG - Intergenic
1000939405 5:167342260-167342282 AAGACTCCTCAAAACTGCCATGG - Intronic
1001549549 5:172593313-172593335 GGGCCTCCTCTCAGCAGCCAGGG - Intergenic
1001773995 5:174315239-174315261 CAGCCTCCACATAACAGGGAAGG + Intergenic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1003026133 6:2557289-2557311 CAGCCCCCTCCCACCAGGCAAGG - Intergenic
1003507578 6:6752337-6752359 CAGCTTCCCCACAGCAGCCAGGG + Intergenic
1005247070 6:23899156-23899178 CAGCCTCCATACACTAGCCATGG + Intergenic
1005505895 6:26468600-26468622 CAGCCACCGCACAACACCCCTGG + Exonic
1006818766 6:36873808-36873830 CATTCTCCCCTCAACAGCCAGGG - Intronic
1006916871 6:37600360-37600382 CAGGCTCCTCTTAATAGCCAAGG - Intergenic
1007461499 6:42022601-42022623 CAGGCTCCCCCCAACCGCCAGGG + Intronic
1010216063 6:73402958-73402980 CTGCCTCCTCCCGAGAGCCAAGG - Intronic
1010283181 6:74043551-74043573 CAGCCTGCTCACCACAGCAGGGG + Intergenic
1012075029 6:94672550-94672572 CAGTCTCCTCCCACCAGCCATGG - Intergenic
1012278720 6:97303363-97303385 CAGGCTTCTCAGAACTGCCAAGG - Intergenic
1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG + Intergenic
1015567868 6:134592171-134592193 AATGCTCCTCAAAACAGCCAAGG + Intergenic
1018074481 6:160199628-160199650 CAGCCCCCTCACCACACCAAAGG - Intronic
1018444412 6:163842071-163842093 CAGGGTCATCACACCAGCCAGGG - Intergenic
1018824159 6:167396926-167396948 AACCCTCCTCCAAACAGCCAAGG - Intergenic
1018918656 6:168155166-168155188 CAGGCCCCTGACAACAGTCATGG + Intergenic
1019205457 6:170357866-170357888 CAGCCTCTTCACACCATCCTTGG - Intronic
1019508321 7:1404700-1404722 CCCCCTCCTCACCACACCCAGGG - Intergenic
1019568485 7:1696790-1696812 CTGCCTCCTCTCATCAGCCGGGG + Intronic
1020256208 7:6504204-6504226 CAGGCTCCTCACAGTAGCCCCGG - Intronic
1022459250 7:30588381-30588403 TGGCCTCCTGCCAACAGCCATGG - Intergenic
1022575187 7:31490424-31490446 CAGTCTCCTCACGACCTCCAGGG + Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1025974462 7:66358900-66358922 CAACCTCCACACACAAGCCAGGG - Intronic
1027218028 7:76196748-76196770 CAGCCTCCTCCCTACAGCCTAGG - Intergenic
1029657125 7:101934689-101934711 AAGCCTCATGACAAGAGCCAGGG - Intronic
1030084249 7:105803434-105803456 CCACCTTCTCACAGCAGCCAGGG - Intronic
1032414434 7:131725488-131725510 CAGCCTCCTCCCCTGAGCCAGGG - Intergenic
1035464468 7:159065440-159065462 CAGCCTCCACTCTCCAGCCACGG - Intronic
1037681422 8:21100861-21100883 CAGCCCTGTCACAGCAGCCATGG + Intergenic
1037757465 8:21720454-21720476 AGGGCTCCTCATAACAGCCAAGG - Intronic
1037768805 8:21787377-21787399 CCGCCTCTTCCCACCAGCCACGG + Intronic
1038056586 8:23864023-23864045 CAGACTCATCAAAGCAGCCATGG - Intergenic
1038243933 8:25836396-25836418 CATCGTCCTCTCAACAGCCCGGG - Intergenic
1038382784 8:27112683-27112705 CAGCCTCCTCCCCAGAGCCCAGG - Intergenic
1038940778 8:32302257-32302279 CAGTGTCCTCAGAGCAGCCAGGG + Intronic
1039077831 8:33708511-33708533 CAGCTTCCACACAGCAGTCACGG - Intergenic
1040286790 8:46104556-46104578 CAGCCTGCCCATAACAGCCCTGG + Intergenic
1040288348 8:46111776-46111798 CAGCCTGCTCAGGACAGCCCTGG + Intergenic
1040290025 8:46119516-46119538 CAGCCTGTTCGCAACAGCCCTGG + Intergenic
1040301222 8:46188993-46189015 CAGCCTGCCCACAACAGCCCTGG - Intergenic
1041845928 8:62329067-62329089 AAGCCTTCTGCCAACAGCCATGG + Intronic
1048425455 8:134319221-134319243 CAGCCTCTGAACAACTGCCAGGG - Intergenic
1048599873 8:135908461-135908483 CAGACTCTTCACAACAGTCTAGG - Intergenic
1049408666 8:142462815-142462837 CAGTCTCCTCACCACCCCCAAGG - Intronic
1051104904 9:13568543-13568565 CAGCCTTCTCACAACTGTGATGG - Intergenic
1052252924 9:26421294-26421316 CAGCTACCTCACAAGAGCCTGGG - Intergenic
1052538844 9:29780384-29780406 CAGCCTCCGTACAATAGCGATGG - Intergenic
1052941050 9:34132628-34132650 CAGCCTCCTCCCCAGGGCCAGGG + Intergenic
1056013537 9:82357619-82357641 CAGCCACCTCACTCCAGCCTGGG + Intergenic
1056443634 9:86643974-86643996 CAGCCTCCTCAGACCCGACACGG - Intergenic
1056724321 9:89099685-89099707 CAGCAACCACACAACTGCCATGG + Intronic
1058590261 9:106557931-106557953 AAGCCACCTCACATCAGCCAGGG + Intergenic
1059466515 9:114472123-114472145 CCTCATCCTCACAACAGCCCTGG - Intronic
1059988175 9:119839923-119839945 CAGCCTCCCCGCACCAGCCATGG - Intergenic
1060487321 9:124056278-124056300 CTGACTCCTCACAATAGCCTGGG + Intergenic
1060890657 9:127186068-127186090 GAGCCTCCTAACAACAGCCTTGG - Intronic
1060945270 9:127566757-127566779 CACCCTCCTCACCCCACCCAAGG - Intronic
1061032316 9:128092711-128092733 TACCATCCTCACAAGAGCCAAGG + Intronic
1061244562 9:129394777-129394799 CCGCCTCCTCACAGCAGCCTGGG + Intergenic
1062020736 9:134318237-134318259 CAGCCAGCTCAGAACAGCCCTGG + Intronic
1062442367 9:136576493-136576515 CAGCCTCCTCACCACTACCCTGG - Intergenic
1062597236 9:137304877-137304899 CAGCATCCTCAGGACAGGCAGGG - Intergenic
1186888378 X:13937751-13937773 CAGCCGCCTTACACCAGCCTCGG + Intronic
1187023270 X:15406702-15406724 CATCCTCCTAAAAGCAGCCATGG - Intronic
1187550275 X:20295863-20295885 CTGCCCCCTAACACCAGCCATGG + Intergenic
1189304387 X:39975625-39975647 CAGCCTGCTCTCAGCAGACAGGG - Intergenic
1189658876 X:43277545-43277567 CAGCCTCCTCCCCAAGGCCAGGG + Intergenic
1190481609 X:50882921-50882943 CAACCTCCTCACCACTGCCAGGG + Intergenic
1191094334 X:56658934-56658956 CAGCCTCCTTAGCACAGTCAGGG + Intergenic
1192197541 X:69038530-69038552 CTGCCTCCACACAGCTGCCAAGG + Intergenic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1193775099 X:85631517-85631539 CATCCTTCACACAACTGCCATGG + Intergenic
1195294738 X:103464701-103464723 CTGCCTCCCAGCAACAGCCAAGG + Intergenic
1196714006 X:118793814-118793836 CAGCTTCCTCAGAGAAGCCAGGG - Exonic
1197402466 X:126007565-126007587 CAGCCTGCCCACAACAGCTCCGG - Intergenic
1199643490 X:149884017-149884039 CAGCCTCCTGGCAAAGGCCAAGG - Intronic
1200150513 X:153949144-153949166 CTGCTTCCTCCCAACAGCAATGG + Exonic
1200601234 Y:5208114-5208136 CTGCCTCCGCACAGCAGCCCCGG - Intronic
1200686564 Y:6264494-6264516 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200992112 Y:9355743-9355765 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200994764 Y:9376021-9376043 CAGCCGCCTCACACCACCCCCGG - Intronic
1200997428 Y:9396367-9396389 CAGCCGCCTCACACCACCCCCGG - Intergenic
1200999940 Y:9464903-9464925 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201002601 Y:9485213-9485235 CAGCCGCCTCACACCACCCCCGG - Intronic
1201005256 Y:9505497-9505519 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201007917 Y:9525826-9525848 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201010534 Y:9546017-9546039 CAGCCGCCTCACACCACCCCCGG - Intergenic
1201099599 Y:10661426-10661448 GTGCCTCTTCACTACAGCCAAGG - Intergenic