ID: 925085815

View in Genome Browser
Species Human (GRCh38)
Location 2:1106600-1106622
Sequence TGTCACTTGGGTGCAGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 53, 2: 6, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925085810_925085815 0 Left 925085810 2:1106577-1106599 CCTTGGTAACAGTGGACACGTGC 0: 1
1: 28
2: 7
3: 14
4: 80
Right 925085815 2:1106600-1106622 TGTCACTTGGGTGCAGGGTATGG 0: 1
1: 53
2: 6
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925085815 Original CRISPR TGTCACTTGGGTGCAGGGTA TGG Intronic
900394972 1:2449648-2449670 TGTCACTGGGGTGGAGGACATGG + Intronic
900844259 1:5083628-5083650 TGTCATTTTTGTGCATGGTAAGG - Intergenic
901443931 1:9295492-9295514 TGTCACTTTGGAGCTGGGTGAGG + Intronic
901779814 1:11586478-11586500 AGTCACATGGATGCAGGGTTTGG + Intergenic
903023892 1:20413371-20413393 TCTTACCTGTGTGCAGGGTAGGG - Intergenic
903350379 1:22713110-22713132 TGCCACTTGGGGGCAGGGTGGGG + Intronic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
907337372 1:53708892-53708914 TGCCCCTTGTGTGCTGGGTACGG - Intronic
907707855 1:56848059-56848081 TGTGACTTGGGTGCAGTTAAAGG - Intergenic
908307487 1:62837793-62837815 TGTCTTTTGGGTGGAGGATAGGG + Intronic
913407506 1:118511973-118511995 GATCACTTGGATGCAGGGCAGGG - Intergenic
914810549 1:151024596-151024618 TGTCACTTCTGTGGAGGGGAGGG - Exonic
915033408 1:152903064-152903086 GGGCCCTTGGGTGCAGGGAATGG - Intergenic
919097223 1:193052397-193052419 TGTCACTGGTGTGGACGGTAGGG + Intronic
920768045 1:208852336-208852358 TGGCAATAGGGTGCAGGGTAGGG - Intergenic
921152025 1:212410315-212410337 TGACACCAGGGTGCAGGGAAGGG + Intronic
922743497 1:228029999-228030021 TGTCACTTGAGTCCAGGTTGAGG + Intronic
1067430313 10:46238541-46238563 TGTCACACGGATGCAGGGTGTGG - Intergenic
1071426163 10:85555250-85555272 TGTTAACTGTGTGCAGGGTATGG + Intergenic
1072189707 10:93069585-93069607 AGGCACTGGGGTGCAGGGTTGGG + Intergenic
1072716183 10:97754077-97754099 TGTCAGATGGGAGCAGGGTAAGG + Intronic
1072909537 10:99487586-99487608 TGTCACTGGGGTGTGGGGTGGGG - Intergenic
1073063448 10:100745386-100745408 TGTCACTCCGGTGCCGGCTAGGG - Intronic
1073741647 10:106414569-106414591 CGTCAGTTGGGGGCAGGGTTAGG - Intergenic
1075382787 10:122032508-122032530 TGTCACTAGGGCAAAGGGTAAGG + Intronic
1075700723 10:124467998-124468020 TGTCCCTTGGGGGCTGGGCATGG - Intronic
1077176916 11:1195281-1195303 TGAGACTTGGGTGCAAGGGAGGG + Intronic
1083763497 11:64831394-64831416 TGTCTCGTGGCTGCAGGGAATGG + Intronic
1084187776 11:67483925-67483947 TGCCACTTGTTTGCAGAGTAGGG + Intronic
1085448528 11:76616980-76617002 TGTCACTGGGCTGGGGGGTAGGG + Intergenic
1085948273 11:81298385-81298407 AGTCATTTTGGTGCAGGGTAGGG + Intergenic
1088512573 11:110593510-110593532 TGACACTTGGATGAAGGGAATGG + Intronic
1089384298 11:118057997-118058019 TGATACCTGGCTGCAGGGTAGGG + Intergenic
1090204914 11:124878749-124878771 TGTCAGTTGGGGGCTGGGGAGGG - Exonic
1101823612 12:108203156-108203178 TGTCCCTTGGCACCAGGGTAGGG - Intronic
1102573734 12:113843283-113843305 TGTCACCTGGGTACAGACTAGGG - Intronic
1103503557 12:121424439-121424461 TGTCACATGGGGGCCGGGTGCGG + Intronic
1106774428 13:32994730-32994752 AGTCAGTTAAGTGCAGGGTAGGG - Intergenic
1110158045 13:72342294-72342316 TGTCAGGTGGGGGCAGGGTTAGG + Intergenic
1115185451 14:30683310-30683332 TTTCACCTGGGTGCATTGTAAGG + Intronic
1117333938 14:54740636-54740658 TGCCTCTTGGGTCAAGGGTATGG + Intronic
1118716710 14:68564904-68564926 TGTCACTAGGGTGGATGGCAGGG - Intronic
1118748245 14:68789475-68789497 TGGGATGTGGGTGCAGGGTAGGG + Exonic
1119079101 14:71675261-71675283 TGTCACTTGGGTGCCAGGAGGGG + Intronic
1121787091 14:96670294-96670316 TGTCACAAAGGTGCAGGGAAAGG - Intergenic
1123724810 15:23091407-23091429 TTTCACTTGTGTCCAGGGTCGGG - Intergenic
1125599454 15:40907320-40907342 TGTAACCTGGGAGCAGGTTAAGG - Intergenic
1126083276 15:44986416-44986438 CGTCACTTGGGTCTAGGCTATGG + Intergenic
1127614405 15:60669433-60669455 TGTCACCTGGGTTCAGAGAAGGG + Intronic
1128726542 15:69992206-69992228 GGGCACCTGGGTGCAGGGTGTGG + Intergenic
1129192259 15:73944404-73944426 TGTCACTGGGGTACAGGTGAGGG - Intronic
1129316493 15:74748598-74748620 TGTCTTTAGGGTTCAGGGTAGGG - Intergenic
1130125028 15:81086081-81086103 TGTCACTAAGGTGCAGGGCGGGG + Intronic
1130651160 15:85762933-85762955 AGCCACTGGGGTGCAGGGCAGGG - Intronic
1131819907 15:96261904-96261926 TGACATTTGTGTGCAGGGAAAGG + Intergenic
1134243096 16:12520221-12520243 TGACACCTGGGTGCAGGGGCAGG - Intronic
1135386075 16:22041489-22041511 TGTAACCTGGGTGCAGGTTGGGG - Intronic
1142062181 16:88037714-88037736 TTTCATTTGGGGTCAGGGTAGGG + Intronic
1142847476 17:2689247-2689269 TGTCACTTGAGTGGGAGGTAAGG - Intergenic
1144811668 17:18004127-18004149 TCTCACTTGTGTCAAGGGTAGGG + Intronic
1145760027 17:27420606-27420628 TGTGGCTTGGGTGCAGGGAGAGG + Intergenic
1145799028 17:27671748-27671770 TGTGGCTTGGGTGCAGGGAGAGG - Intergenic
1146401933 17:32506376-32506398 TCTCATTTGGGAGGAGGGTAGGG + Intronic
1146628422 17:34452570-34452592 TGGCACTTGGGAGAAGGGAAGGG - Intergenic
1146920748 17:36708980-36709002 TGTGACTGGGGTGCAGTATAGGG - Intergenic
1148760606 17:49997933-49997955 AGGCACTGGGCTGCAGGGTAGGG + Intergenic
1151102682 17:71573892-71573914 TGTAGTTTGGGAGCAGGGTAGGG - Intergenic
1151979560 17:77500368-77500390 TGTCACTTGGTGGCGGGGTGGGG + Exonic
1156985247 18:43343056-43343078 TGTGACATGGGGGAAGGGTATGG + Intergenic
1160386569 18:78500507-78500529 TGTCCCTGGGGTGCAGGAAAAGG - Intergenic
1160849573 19:1183865-1183887 TGCCACGTGAGTGCAGGGCAAGG + Intronic
1161421276 19:4177051-4177073 TGCCACCTGGGTGCAGGGGTGGG - Intronic
1162530313 19:11232150-11232172 TGTCACATGAGTGCAGGGACAGG + Intronic
1163426577 19:17243965-17243987 TGTTCCTGGGGTGCAGAGTAGGG + Intronic
1164752542 19:30667366-30667388 TGGCCCTTGGGTGCAGGGAGGGG + Intronic
1166351785 19:42202310-42202332 TGTGACTGGAGTGCAGGGTATGG - Intronic
1166701813 19:44886428-44886450 AGTCACTTGGGGGCTGGGCACGG + Intronic
1168540100 19:57202877-57202899 TGTGACTGGAGTGCAGGGTGGGG + Intronic
925085720 2:1105977-1105999 TGTCATTGGGGTGCAGGGTATGG + Intronic
925085728 2:1106029-1106051 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085737 2:1106081-1106103 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085746 2:1106133-1106155 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085754 2:1106185-1106207 TGTCACTCGGGTTCAGGGTATGG + Intronic
925085762 2:1106237-1106259 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085770 2:1106289-1106311 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085784 2:1106392-1106414 TGTCACTCGGGTGCAGGGTGTGG + Intronic
925085791 2:1106444-1106466 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085799 2:1106496-1106518 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085807 2:1106548-1106570 TGTCACTCGGGTGCAGGGTGTGG + Intronic
925085815 2:1106600-1106622 TGTCACTTGGGTGCAGGGTATGG + Intronic
925085823 2:1106652-1106674 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085831 2:1106704-1106726 TGTCACTCGGGTGCAGGGTGTGG + Intronic
925085838 2:1106756-1106778 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085846 2:1106808-1106830 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085854 2:1106860-1106882 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085861 2:1106912-1106934 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085868 2:1106964-1106986 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085876 2:1107016-1107038 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085883 2:1107068-1107090 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085891 2:1107120-1107142 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085898 2:1107172-1107194 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085906 2:1107224-1107246 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085914 2:1107276-1107298 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085922 2:1107328-1107350 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085929 2:1107380-1107402 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085937 2:1107432-1107454 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085945 2:1107484-1107506 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085952 2:1107536-1107558 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085959 2:1107588-1107610 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085967 2:1107640-1107662 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085974 2:1107692-1107714 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085982 2:1107744-1107766 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085990 2:1107796-1107818 TGTCACTCGGGTGCAGGGTATGG + Intronic
925085998 2:1107848-1107870 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086005 2:1107900-1107922 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086013 2:1107952-1107974 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086021 2:1108004-1108026 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086029 2:1108056-1108078 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086037 2:1108108-1108130 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086045 2:1108160-1108182 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086052 2:1108212-1108234 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086060 2:1108264-1108286 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086068 2:1108316-1108338 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086076 2:1108368-1108390 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086083 2:1108420-1108442 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086091 2:1108472-1108494 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086098 2:1108524-1108546 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086106 2:1108576-1108598 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086113 2:1108628-1108650 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086121 2:1108680-1108702 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086129 2:1108732-1108754 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086137 2:1108784-1108806 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086144 2:1108836-1108858 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086152 2:1108888-1108910 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086160 2:1108940-1108962 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086168 2:1108992-1109014 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086175 2:1109044-1109066 TGTCACTCGGGTGCAGGGTATGG + Intronic
925086184 2:1109096-1109118 TGTCACTGGGGCGCAGGGTATGG + Intronic
925507511 2:4584356-4584378 TGTGCATTGGCTGCAGGGTAGGG - Intergenic
928422010 2:31144704-31144726 TGTCACTTGGGAGCAATGTTGGG - Intronic
928843949 2:35645944-35645966 TGTCTCTTGGGTGGAGGTGAGGG - Intergenic
929918825 2:46157831-46157853 TGTCACTTGACTGCAGGGCCAGG + Intronic
932497760 2:72155116-72155138 TGTAGCTTGGGTGGAGGGTGGGG - Intergenic
933749984 2:85597024-85597046 TGGCAGTTGGGAGCAGGGGAGGG + Intronic
934779361 2:96960007-96960029 TGACACTGGGGTGTAGGGGAGGG + Intronic
935259823 2:101344472-101344494 TGTATCTTGAGTGCAGGGCATGG + Intergenic
943359082 2:186896266-186896288 TGTCACTTGGACACAGGGCAGGG - Intergenic
946595392 2:221300679-221300701 TGTGAGTTGGGTGCAGGAAATGG + Intergenic
947720935 2:232368856-232368878 TGTCACTCAGGCTCAGGGTATGG + Intergenic
1169857110 20:10115043-10115065 TGTCAGAGGGGTGTAGGGTATGG - Intergenic
1170401810 20:15993969-15993991 TGTCACTGGGGTGGAAGGTTGGG - Intronic
1171285747 20:23936961-23936983 TTTCACTAGAGTGCAGGGCAGGG + Intergenic
1172035282 20:32006324-32006346 GGTCACTTGTGTACAGGGAAAGG - Intergenic
1172113545 20:32561163-32561185 TCTCACCTGCGTGCAGGGTCTGG - Intronic
1172428134 20:34869991-34870013 TGGCACTTGGGTTTAGGGAATGG + Intronic
1172445854 20:34993105-34993127 TGGCACTGGGGTTCAGGATACGG - Exonic
1172913433 20:38426970-38426992 TGTAACTTGGGGACAGGATAGGG - Intergenic
1173735583 20:45359114-45359136 TGTCCTTTGGGTGGAGGGGAGGG - Intergenic
1173970514 20:47148720-47148742 TGTCACCTGGGTCATGGGTAAGG + Intronic
1174419360 20:50389706-50389728 TGACAGTAGGGTGCAGGGGAGGG - Intergenic
1174563967 20:51451444-51451466 TGTCACGTGGGTGGAGGTCAGGG + Intronic
1178459652 21:32791088-32791110 TGGCACTTAGCTGCAGGGTTTGG - Exonic
1179891440 21:44337378-44337400 TGTCACTTGGTCGCAGAGGAGGG - Intronic
1182318602 22:29463978-29464000 TTCCACCTGGCTGCAGGGTAAGG - Intergenic
1182445991 22:30390014-30390036 GGTCAGTGGGGTGAAGGGTAGGG - Intronic
1183407711 22:37638684-37638706 TGCCACAGGGGTGCAGGGTAAGG + Intronic
1184838132 22:47036104-47036126 TGTAACTTGGAAGCAGGGTAAGG + Intronic
949146042 3:701195-701217 TATCAGTTGGGTACAGGGTTAGG + Intergenic
949535174 3:4989681-4989703 TGTCACAAGGCTGCTGGGTAGGG + Intergenic
949953557 3:9249077-9249099 TTTCACTTGGCTGCAGAGCAGGG + Exonic
951625821 3:24662562-24662584 TCTCACTTGGGTTCAGGTCATGG + Intergenic
953032264 3:39186541-39186563 TCTCAGTTGGGTGCAGGCTCTGG + Exonic
953185308 3:40631848-40631870 TGTCAGATGGGGGCAGGGTTAGG - Intergenic
954951891 3:54482179-54482201 TGTTACTTGGGAGCAGAGGAGGG + Intronic
956585582 3:70861008-70861030 TGTCCCTTGGTAGCAAGGTAAGG + Intergenic
958416683 3:93882740-93882762 TTTCTCTTGAGTGCATGGTAAGG - Intronic
958600283 3:96288491-96288513 TGTCACTTGGGTGCTGTTAAAGG + Intergenic
958763917 3:98342045-98342067 TGTCACTTGGTCACAGTGTATGG + Intergenic
962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG + Intergenic
963757531 3:149251241-149251263 TGTGACTTTTGTGGAGGGTAAGG + Intergenic
964846831 3:161053466-161053488 TCACACTTGGGTGCAGCCTATGG - Intronic
967764934 3:193268919-193268941 TGTCAAATGGTAGCAGGGTACGG - Intronic
973888601 4:55346936-55346958 AGCCACTGGAGTGCAGGGTACGG - Intronic
980629185 4:135411125-135411147 TGTGACCTGGGTGCAGGGACAGG + Intergenic
980908041 4:138968134-138968156 TGTCACTTAGGTGCTGAGCATGG - Intergenic
980947835 4:139340233-139340255 TATCACTTGAGTGCAGGGAGTGG + Intronic
981777125 4:148382004-148382026 TGTCTATTGGGTGGAGGGAATGG - Intronic
981896912 4:149812835-149812857 TGTCACCTGGGTGTAGGGGAGGG - Intergenic
983368251 4:166824032-166824054 TGTCACTCAGGAGCAGGGCAAGG - Intronic
983985878 4:174060366-174060388 TGTTACCTGGATGCAGGATATGG - Intergenic
990242039 5:53825471-53825493 TTACACTTGGGACCAGGGTAAGG + Intergenic
991044254 5:62206480-62206502 TGTCCCTTGGATCTAGGGTATGG - Intergenic
991452664 5:66769345-66769367 TGGGACTTGGGTGCATGGTGGGG + Intronic
996091155 5:119353376-119353398 TGTCACCATGTTGCAGGGTAGGG + Intronic
1000564963 5:162835396-162835418 TGTGACTTGGGTGCTGTGAAAGG - Intergenic
1002527602 5:179823586-179823608 TGGCGCTTGGGTGAAGGGCAAGG + Intronic
1004609618 6:17227277-17227299 TGTCAAGTGGGAGCATGGTATGG + Intergenic
1006301539 6:33196027-33196049 GGTCATTTGGCTGCAGGGGACGG + Exonic
1007297106 6:40832924-40832946 TCTCACTTGAGTCCAGGGTTAGG + Intergenic
1007516556 6:42417461-42417483 TGTCACCTGAGTGAAGGGTTAGG + Intronic
1009316801 6:62229724-62229746 TCTCACTTGGCTGGGGGGTAGGG + Intronic
1011177056 6:84575329-84575351 TGACACTTCTGTGCAGGTTATGG + Intergenic
1014454337 6:121620067-121620089 AGTCTCATGGGGGCAGGGTAGGG + Intergenic
1019687761 7:2391110-2391132 AGTCACTTGGCTGCAGGGCCTGG - Intergenic
1019731872 7:2633114-2633136 TGTCATTTGAGTGCGGGGCAGGG + Intronic
1020432823 7:8130974-8130996 ATTCACTGGGGTGGAGGGTAAGG - Intronic
1026387447 7:69864277-69864299 TCTCACTTGGCTGCACCGTAGGG - Intronic
1029115799 7:98236501-98236523 CGGCACCTGGGAGCAGGGTAAGG - Intronic
1030160776 7:106506402-106506424 TGACACCTGGGTGCATGGTCAGG + Intergenic
1031156866 7:118120481-118120503 TGTGACTCGGGTGCAGGGACAGG + Intergenic
1032489792 7:132315844-132315866 TGCCACGTGTGTGCAGTGTAGGG + Intronic
1033216351 7:139496212-139496234 TGTGATTTGGGAGCAGGGTGTGG - Intergenic
1034513379 7:151553990-151554012 TGTCACCTGGGTGGTGGATAAGG - Intergenic
1035817613 8:2557909-2557931 AGTCACTTGGCTGTAGGATATGG - Intergenic
1039268512 8:35854781-35854803 TATCACGTGGGGGCAGGGTTAGG - Intergenic
1039679500 8:39714242-39714264 GATCACTTGGTTGCAGGGCAGGG + Intronic
1041342695 8:56862903-56862925 TTTTACTTGGCTGCAGGCTATGG - Intergenic
1044714664 8:95089361-95089383 TGTGACTTGGAGGCTGGGTACGG - Intronic
1047270390 8:123352181-123352203 TGTCTCTTTGGAGCAGGGCATGG - Intronic
1048712464 8:137227389-137227411 TGTAAATTGGGTGAAGGGTGGGG + Intergenic
1049252052 8:141594467-141594489 GGCCACTGGGGTGCAGGGGATGG - Intergenic
1051114250 9:13675754-13675776 TGTTACTTGGGTTCAGGGTTAGG + Intergenic
1052843382 9:33312961-33312983 TGTGACTTTGCTTCAGGGTAGGG - Intronic
1058447107 9:105064179-105064201 TGGCACTTGGGTGCTGTGTGTGG - Intergenic
1059350364 9:113659936-113659958 TGGCACATGTGTTCAGGGTATGG - Intergenic
1060195904 9:121623203-121623225 TGCCACCTGGGTCTAGGGTAGGG - Intronic
1062261277 9:135664433-135664455 TGACCCTTGGGGGCAGGGTGAGG + Intronic
1186378681 X:9034205-9034227 TGTCACTTAGGGGAAGGGTGAGG - Intronic
1187412503 X:19063331-19063353 TGTCACTGAGGTGCAGGGCTAGG - Intronic
1188536435 X:31201803-31201825 TGTGACTTGGGTTAAAGGTAAGG - Intronic
1190854866 X:54283976-54283998 TGTAACTTGGGTGTAGGCAAAGG + Intronic
1191876145 X:65798618-65798640 TGTCTCTTTGCTGCTGGGTAGGG + Intergenic
1193469386 X:81880545-81880567 TGACACTTGTGTTCATGGTAAGG + Intergenic
1194278230 X:91913586-91913608 TGTCATGTGGGGGCAGGGTTTGG - Intronic
1197365844 X:125563617-125563639 TGTCTCTTGGGAGCAGGGGGAGG + Intergenic
1198363324 X:135916941-135916963 TGTCACATGGTTGGAGGGAAAGG + Intergenic
1200595567 Y:5135661-5135683 TGTCATGTGGGGGCAGGGTTTGG - Intronic