ID: 925091889

View in Genome Browser
Species Human (GRCh38)
Location 2:1163016-1163038
Sequence CCTGTCATGCTCCACAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925091889_925091897 8 Left 925091889 2:1163016-1163038 CCCAGCCTGTGGAGCATGACAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 925091897 2:1163047-1163069 GCTGCAGGATCACAGGAAGTGGG 0: 1
1: 0
2: 0
3: 28
4: 390
925091889_925091898 29 Left 925091889 2:1163016-1163038 CCCAGCCTGTGGAGCATGACAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 925091898 2:1163068-1163090 GGCATGTGAAGCCTCCCAACTGG 0: 1
1: 6
2: 2
3: 6
4: 94
925091889_925091896 7 Left 925091889 2:1163016-1163038 CCCAGCCTGTGGAGCATGACAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 925091896 2:1163046-1163068 TGCTGCAGGATCACAGGAAGTGG 0: 1
1: 0
2: 1
3: 30
4: 271
925091889_925091895 1 Left 925091889 2:1163016-1163038 CCCAGCCTGTGGAGCATGACAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 925091895 2:1163040-1163062 AGGCAGTGCTGCAGGATCACAGG 0: 1
1: 0
2: 4
3: 24
4: 249
925091889_925091894 -7 Left 925091889 2:1163016-1163038 CCCAGCCTGTGGAGCATGACAGG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 925091894 2:1163032-1163054 TGACAGGAAGGCAGTGCTGCAGG 0: 1
1: 0
2: 0
3: 44
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925091889 Original CRISPR CCTGTCATGCTCCACAGGCT GGG (reversed) Intronic
900604051 1:3516024-3516046 GCTGCCATGGGCCACAGGCTTGG + Intronic
901266747 1:7916539-7916561 CTGGTCATGCCCCACAGGGTTGG - Exonic
901732611 1:11291153-11291175 CCTGTCATTCTTCTCATGCTGGG + Intronic
901833556 1:11908908-11908930 CCTGGCACGCTCCTCAGGCGGGG - Intergenic
902301185 1:15503870-15503892 CCTGTCATGACCCACAAACTAGG + Intronic
906279695 1:44544657-44544679 CCTTTCAATCTCCAAAGGCTGGG + Intronic
906282947 1:44566426-44566448 TCTTCCATGCTCCATAGGCTAGG - Intronic
909109344 1:71454950-71454972 GTTGGCATACTCCACAGGCTTGG + Intronic
912567454 1:110598442-110598464 CCTCTGAAGCTCCTCAGGCTGGG - Intronic
913606350 1:120470097-120470119 CCTGTCCTGCTGCAAAAGCTTGG + Intergenic
914210083 1:145570041-145570063 CCTGTCCTGCTGCAAAAGCTTGG - Intergenic
914269005 1:146062413-146062435 CCTGTCCTGCTGCAAAAGCTTGG - Intergenic
914368091 1:146998451-146998473 CCTGTCCTGCTGCAAAAGCTTGG + Intergenic
914484889 1:148099754-148099776 CCTGTCCTGCTGCAAAAGCTTGG - Intergenic
914584849 1:149051741-149051763 CCTGTCCTGCTGCAAAAGCTTGG - Intergenic
914980385 1:152409996-152410018 TCTGTCCTGCTCCACAGTCTCGG + Exonic
914980416 1:152410164-152410186 GCTGTCCTGCTCCACGGTCTGGG + Exonic
914980449 1:152410344-152410366 GCTGTCCTGCTCCACAGTCTGGG + Exonic
916253263 1:162759782-162759804 TCTGTCATGCTGCTCAGGCCAGG - Exonic
919478622 1:198058808-198058830 CTTGTCTTGTTCCACTGGCTAGG + Intergenic
921049569 1:211501353-211501375 CCTGTCCTCCTCCTCTGGCTGGG - Intergenic
921052476 1:211520789-211520811 CCTGTCTTGCTCAACTGGGTAGG + Intergenic
922413993 1:225403773-225403795 GCTGTCTTCCACCACAGGCTGGG + Intronic
1063390018 10:5643926-5643948 CCTGCCACGCTCCACAGACGAGG + Intronic
1066439725 10:35426958-35426980 CCTGTCTTGGTCCACAGGGTTGG + Intronic
1066704019 10:38157795-38157817 CCTGCCACGCCCCACAGGCCTGG + Intergenic
1066986757 10:42475281-42475303 CCTGCCATGCCCCGCAGGCCCGG - Intergenic
1067175644 10:43943643-43943665 CTTGTCATGCTCCACAGAGTCGG - Intergenic
1069092244 10:64214328-64214350 GCTGTAATGATCCACATGCTAGG - Intergenic
1069812576 10:71173313-71173335 CCTGTCTTACGCCACAGGTTAGG + Intergenic
1070672855 10:78390174-78390196 CCTGTGATGCCGCCCAGGCTTGG - Intergenic
1072742789 10:97920097-97920119 CCAGTCATTCTGCACAGCCTAGG - Intronic
1076150753 10:128160193-128160215 CCTGTGATGGGCCACAGACTGGG - Intergenic
1076342214 10:129756970-129756992 CATGTGATTCTGCACAGGCTAGG + Intronic
1076608947 10:131708384-131708406 CCTGGCAGGCTGCACAGGCGAGG - Intergenic
1077014810 11:394774-394796 CCTGTCATCCCCCACAGGGATGG - Intronic
1077446328 11:2592709-2592731 AGTGTCAGGCTCCCCAGGCTGGG - Intronic
1078196941 11:9144176-9144198 CCTCTCATCCACCTCAGGCTGGG + Exonic
1078455357 11:11470659-11470681 CCTTTCAGGCTCCACTAGCTGGG + Intronic
1080456784 11:32426518-32426540 CCTGTTCTGCACCACAGGCGCGG - Intronic
1082284273 11:50302211-50302233 TCTGCCATGTTCCCCAGGCTGGG - Intergenic
1084150502 11:67285891-67285913 ACTGTCCTGCTCCACAGTGTTGG + Exonic
1084262070 11:67985609-67985631 CATGTCATACTCTACAAGCTGGG - Intergenic
1090297991 11:125607258-125607280 GCTGTGATGTTCCATAGGCTAGG + Intronic
1096689081 12:53308344-53308366 CCTGTCCTTACCCACAGGCTTGG - Exonic
1096757520 12:53812598-53812620 CCTGCCATGCACTCCAGGCTGGG - Intergenic
1101130372 12:101684478-101684500 CATGCCATACTCCACAGGCTTGG - Intronic
1103561547 12:121795568-121795590 CCTGCCAGGCTCCACAGGAGTGG + Intronic
1104276320 12:127331691-127331713 CCTCTCATCCTCTACAGGCATGG - Intergenic
1104297129 12:127526579-127526601 TTTCTCATGCTCCACTGGCTAGG + Intergenic
1104746965 12:131216719-131216741 CCTGTCAGAACCCACAGGCTGGG - Intergenic
1104785655 12:131446466-131446488 CCTGTCAGAACCCACAGGCTGGG + Intergenic
1106659459 13:31783719-31783741 ACAGTCATCCTCCACAGCCTGGG - Intronic
1107555855 13:41516226-41516248 CCTGTCCTTCCCCACATGCTTGG + Intergenic
1108593820 13:51933836-51933858 CGTTTCAAGCACCACAGGCTGGG + Exonic
1112433815 13:99376253-99376275 TCTGTCATGCTCCCCTGCCTTGG + Intronic
1113770358 13:112904298-112904320 CCTGACATGCTCCTGAGCCTGGG - Intronic
1114528009 14:23378318-23378340 CTTGGCATGTTCCACATGCTCGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1123105859 14:105840781-105840803 CCGGTCATCCTCCACAGGAAAGG - Intergenic
1126735267 15:51726478-51726500 CCTGTGATGCTCCCCAGGGCAGG - Intronic
1130985908 15:88844329-88844351 CTTGTCATGTTGCCCAGGCTGGG + Intronic
1132001619 15:98186215-98186237 CCTGTGCTGCTCCAGAAGCTGGG - Intergenic
1132612435 16:824075-824097 CCTGTCATTCTCCAGGGGCTGGG + Intergenic
1133000002 16:2845275-2845297 CGTGTCATGATACACAAGCTAGG + Intergenic
1133621091 16:7527021-7527043 TCTGTAATGTTGCACAGGCTTGG - Intronic
1135722900 16:24832348-24832370 CCTCTCTTTCTCCACTGGCTGGG - Intergenic
1139325464 16:66149417-66149439 CCTGTCATGTTGGACAGTCTGGG + Intergenic
1139658065 16:68401154-68401176 TTTGTCATGCTCCAAAGTCTGGG + Intronic
1140640757 16:76969536-76969558 CCTGTCATGTTCCGCATGCAAGG + Intergenic
1145252531 17:21304379-21304401 CCAGTCGTGCTCCACAGACGTGG + Intronic
1146642633 17:34552871-34552893 AGTGCCATGCCCCACAGGCTCGG - Intergenic
1146667545 17:34715175-34715197 CCTGACCTGCCCCAGAGGCTGGG + Intergenic
1147175574 17:38654275-38654297 CCTGACAGGCTCTGCAGGCTGGG - Intergenic
1147359868 17:39923822-39923844 CCTGTCATGGTACACAGGGCAGG + Intronic
1150072561 17:62164174-62164196 CCTGTCAGAGTCCACATGCTAGG - Intergenic
1151623352 17:75261280-75261302 CCTGTCGGGCACCGCAGGCTCGG - Intronic
1153048932 18:882848-882870 CCTTCCATGTTCCACAGGCATGG + Intergenic
1153457029 18:5294307-5294329 CCTGTAATCATCCAGAGGCTAGG + Intronic
1155263331 18:24066744-24066766 CCTGTGATGCTTCATAGGCAGGG - Intronic
1156223336 18:35076560-35076582 CCTGACAGACTCCCCAGGCTAGG + Intronic
1157131195 18:45008943-45008965 CATGTCCTGCTCCACAGCCAAGG - Intronic
1160620957 18:80170319-80170341 TGTGGCATCCTCCACAGGCTTGG + Exonic
1160765516 19:805916-805938 CCGGTCATGCTGCTCAGCCTCGG - Intronic
1161067078 19:2243939-2243961 CCTGACATGCCCCACGGGCCTGG + Intronic
1161169597 19:2806223-2806245 CCCGTCCTGGTCCCCAGGCTTGG + Intronic
1162176059 19:8831535-8831557 CCAGTCATGGCCCACAGGCTGGG - Intronic
1163202797 19:15780436-15780458 CCAGTCAATCTCCACAGCCTGGG + Intergenic
1163696803 19:18768391-18768413 CCTGGCATGCTCAGCAGGCGAGG - Intronic
1163789449 19:19297894-19297916 CCTGCTGTGCTCCTCAGGCTGGG - Intronic
1164156389 19:22600075-22600097 CCTCTCAGGCTCCACAAACTTGG - Intergenic
1164476158 19:28577525-28577547 CCTGCCATCCTTCACAGGCCGGG - Intergenic
1166314245 19:41979961-41979983 CCTGTCAGGCCCCACGGGCATGG - Intronic
925091889 2:1163016-1163038 CCTGTCATGCTCCACAGGCTGGG - Intronic
925991609 2:9259422-9259444 CCTGCCAGGCTGCCCAGGCTGGG + Intronic
926445277 2:12934318-12934340 CAAGTCATTCTCCACAGGCACGG + Intergenic
927304646 2:21556544-21556566 GTAGTCATCCTCCACAGGCTTGG + Intergenic
927711635 2:25329812-25329834 CCCCTCATGCTGCACACGCTGGG + Intronic
928166591 2:28976890-28976912 CCTTTCAGGCTCTCCAGGCTGGG + Intronic
931288826 2:60854765-60854787 CCTATCATGCTTCTCAGGCAGGG + Intergenic
931636822 2:64348440-64348462 CCTGTCACACTCCACATTCTAGG + Intergenic
931670443 2:64642667-64642689 GCTGTGATGCTGCAGAGGCTGGG - Intronic
934843325 2:97645499-97645521 CCTGTCCTCCTCCCCAGGCCGGG + Intergenic
935566972 2:104619296-104619318 CCTGTCATTTTCCACAAGCCAGG - Intergenic
935627920 2:105186201-105186223 CCTGTCAGCCCCCAAAGGCTGGG - Intergenic
938279445 2:130053691-130053713 CCGGTCAAGCCCCACAGCCTAGG + Intergenic
943579329 2:189666317-189666339 TCTTTCATCTTCCACAGGCTGGG - Exonic
946899823 2:224361537-224361559 CCTATCATACTGCACAGGTTGGG - Intergenic
947708368 2:232294291-232294313 CCTGTCCTGCTCCCCATTCTAGG - Intronic
948524887 2:238565411-238565433 CAAGTCATGGTCCTCAGGCTGGG + Intergenic
1172289640 20:33766834-33766856 CCTGGCTTTCTCCACAGGGTTGG + Exonic
1172603081 20:36196907-36196929 TCTGTCATGCTGCACTGGCTGGG + Intronic
1173860490 20:46280074-46280096 GCTGTCTGGTTCCACAGGCTGGG + Intronic
1175211684 20:57361852-57361874 CCTGTTCTGGTCCACAGCCTGGG - Intronic
1175855831 20:62120538-62120560 GGTGGCATCCTCCACAGGCTTGG - Intergenic
1176244078 20:64089096-64089118 CCTGGCATGCTGAACAGCCTAGG - Intronic
1176246685 20:64100754-64100776 CCTGTGCTGCTCAACAGGCTGGG + Intergenic
1178599912 21:33986285-33986307 CCTGACCTGCTCCACATCCTGGG - Intergenic
1179991654 21:44951346-44951368 CCTGGCTTGCTGCACAGCCTGGG + Intronic
1180988384 22:19918859-19918881 CCAGTCATGCGGCACGGGCTGGG + Exonic
950406804 3:12810042-12810064 CCCCTCGTGCTCCCCAGGCTGGG + Exonic
951718554 3:25674254-25674276 CCTTTTATGCCCCCCAGGCTTGG - Intergenic
953681253 3:45039937-45039959 CCTTTGATGCCCCACAGGTTTGG - Intergenic
956311605 3:67886982-67887004 ACTGGCATGCTCCACAGGAAGGG + Intergenic
957531009 3:81440899-81440921 CCTCTCATGCTCCACAGCCAGGG + Intergenic
958985761 3:100777773-100777795 CCTGTACTGTTGCACAGGCTAGG + Intronic
959664745 3:108908532-108908554 TCTGTCATGCTCCTAAGACTTGG - Intronic
961402804 3:126658907-126658929 CCTCTCATGCTGCACAGGATAGG - Intergenic
969448598 4:7259913-7259935 TCTGTCCTGCCCAACAGGCTGGG - Intronic
971200869 4:24508082-24508104 ACAGTCATGCTCCAAAGGCAAGG + Intergenic
977728533 4:100325094-100325116 TCTTTCCTGGTCCACAGGCTAGG + Intergenic
978371240 4:108031385-108031407 CCTCACAGGCTCCTCAGGCTTGG - Intronic
982182253 4:152759576-152759598 CCTGTCATGCTCCTCTTGTTAGG - Intronic
982798099 4:159669133-159669155 GGAGTCAGGCTCCACAGGCTGGG + Intergenic
987238993 5:15973217-15973239 CCCGACATTCTCCACAGGGTAGG + Intergenic
987564360 5:19565098-19565120 CCTCTCATGTTCCACAGCCCAGG - Intronic
990211398 5:53483729-53483751 CCAGTCTTGCTCAACAGGGTAGG - Intronic
990248055 5:53882906-53882928 CCTGTCTTGTTCCCCAGCCTGGG - Intergenic
993013455 5:82509873-82509895 CTTTTCATGCCCCTCAGGCTTGG - Intergenic
993635090 5:90333356-90333378 TCTGTCAGGCTCCCCAGGTTAGG + Intergenic
994669622 5:102751566-102751588 CCTCTAATGCTCAAAAGGCTAGG - Intergenic
995785157 5:115819877-115819899 CTTGTTATGTTGCACAGGCTGGG + Intergenic
996485605 5:124030326-124030348 CCTGTCATGCTTCAAACCCTGGG + Intergenic
996879760 5:128282852-128282874 GCTGTCATGCTGCACTGGATTGG - Intronic
999282995 5:150377000-150377022 CCTGTCATGCTGCGCAGCCCAGG - Intronic
999500211 5:152139528-152139550 CCTGTCTTGCTCCAGAGCCCAGG - Intergenic
1001880903 5:175243332-175243354 CCTGTCATGTTCCCCAGGATTGG + Intergenic
1004470755 6:15926999-15927021 CATGTCATGCTGTGCAGGCTTGG - Intergenic
1006887963 6:37398012-37398034 CCTTCCATGCTCCTCAGTCTGGG - Intergenic
1007727256 6:43923993-43924015 CCTGCCATGCTCCACACAATGGG + Intergenic
1010817923 6:80381321-80381343 CCTGGCATGATCCACATTCTGGG - Intergenic
1011698053 6:89930851-89930873 CCTTTCCTTCTCCAAAGGCTTGG - Exonic
1011811317 6:91135216-91135238 GCTGTCATGGTGCACAGGCATGG + Intergenic
1014155384 6:118103528-118103550 CCTGTCAGGCTTCTCAGGCCTGG - Intronic
1015802690 6:137076728-137076750 TCTCTCATGCTCCTCAGTCTGGG + Intergenic
1018786185 6:167109810-167109832 CCTGGCATGCTCCGCAGGATGGG - Intergenic
1019332902 7:469678-469700 CCAGCCTTGGTCCACAGGCTGGG + Intergenic
1023681791 7:42694850-42694872 CCTCTCATATTTCACAGGCTGGG + Intergenic
1024101488 7:46037033-46037055 CCTGTCATCCACACCAGGCTGGG + Intergenic
1027038303 7:74942461-74942483 CCTGTCATCCCCCAGTGGCTTGG - Intergenic
1029626711 7:101724491-101724513 CCTGTGATGGGCCACACGCTGGG + Intergenic
1031982993 7:128141322-128141344 CTTGCCATGCTGCCCAGGCTGGG - Intergenic
1033388321 7:140900931-140900953 CCTCAGACGCTCCACAGGCTGGG + Intronic
1033587641 7:142786371-142786393 CCTGTCCTTGTCCACAGTCTTGG - Intergenic
1036389008 8:8308246-8308268 CCTGTCATGCTCTACAGGTGAGG + Intergenic
1039193899 8:35008489-35008511 TCTGTCATTATCCACAAGCTAGG - Intergenic
1045561245 8:103265752-103265774 CCTGTGATGTTTCACAGGCTTGG - Intergenic
1047681419 8:127258039-127258061 CATGTCAAGCTCCACAGGAAAGG - Intergenic
1052860822 9:33436834-33436856 CCTGGCACCCTCCACAGCCTAGG + Intergenic
1059382357 9:113936109-113936131 CATGTCCTGTGCCACAGGCTGGG + Intronic
1060013926 9:120069866-120069888 CCTGATTTCCTCCACAGGCTTGG - Intergenic
1060057354 9:120426247-120426269 CCTGTCATGATCCATAACCTTGG - Intronic
1060176191 9:121499256-121499278 TCTGTCCTGCCCCACAGGCAAGG + Intergenic
1062533216 9:137010698-137010720 CACATCATCCTCCACAGGCTTGG + Exonic
1062630822 9:137462386-137462408 CCTGTCCTGCGCCACGGGCCAGG - Intronic
1188370960 X:29369161-29369183 CTTCTCATGCTCCACAGCCAAGG - Intronic
1192218757 X:69182378-69182400 CCTGTCAGGCTGCAGAGGCCAGG - Intergenic
1196566373 X:117210073-117210095 CATGCTATGCTGCACAGGCTTGG - Intergenic