ID: 925092946

View in Genome Browser
Species Human (GRCh38)
Location 2:1169645-1169667
Sequence CCGGAGCCTGCAGGTTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925092946_925092954 23 Left 925092946 2:1169645-1169667 CCACTAAAACCTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 925092954 2:1169691-1169713 ACTTCAATGAGCGTTGCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925092946 Original CRISPR CCGGAGCCTGCAGGTTTTAG TGG (reversed) Intronic
900648339 1:3718928-3718950 CAGTGGCCTGCAGGTGTTAGTGG - Intronic
901045684 1:6394091-6394113 CCGCCGCCTGCAGCTTTTACTGG + Intronic
902155971 1:14486718-14486740 CCCAAGCCTGAAGGTGTTAGTGG - Intergenic
906147873 1:43570617-43570639 CAGGGGCCTGCAGGCTTCAGAGG + Intronic
920290683 1:204921077-204921099 CAGGAGCATCCAGGTTGTAGAGG - Intronic
923591990 1:235327826-235327848 CCCGGGCCTGCTGGTTTTGGGGG - Exonic
1065963144 10:30750481-30750503 CCGGATCCTGCAGGCTGAAGGGG + Intergenic
1072400625 10:95095903-95095925 CTGAAGCCTGCAAGTTTCAGAGG + Intergenic
1076139552 10:128068497-128068519 CCGGAGCCTCCTGGCTTTGGTGG - Intronic
1078907027 11:15697178-15697200 CAGGGGCCTGCATGTTTGAGTGG - Intergenic
1090263612 11:125340425-125340447 CCAGAGTCTGCAGGTTTAACTGG - Intronic
1094167261 12:27455531-27455553 CCACAGCATGCAGGTTTTAATGG - Intergenic
1096521757 12:52188451-52188473 CCAGAGGCTGCAGGTCTTACAGG + Intronic
1099956060 12:89353537-89353559 CCGCAGCCTGCAGGTCTTGCGGG - Intergenic
1101772190 12:107761417-107761439 CCTGAGTCTGCGGGATTTAGGGG - Intergenic
1108692160 13:52869254-52869276 CCAGAGCCTGCAGGTGTTCTGGG - Intergenic
1110566014 13:76958288-76958310 CATGAGCCTCAAGGTTTTAGAGG + Exonic
1111887153 13:94036554-94036576 CCCGAGCCTTGAGATTTTAGTGG - Intronic
1113840756 13:113359658-113359680 CTGGAGCCTGCAAGTCATAGCGG - Intronic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1123888256 15:24748998-24749020 CCTGAGCCTGCAGGGGTAAGGGG - Intergenic
1127127462 15:55825880-55825902 CCGGAGTCTGCAGTGATTAGGGG + Intergenic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1129142814 15:73616541-73616563 GAGGAGGCAGCAGGTTTTAGTGG - Intronic
1129781377 15:78274184-78274206 CCTGACCCTGCAGGTGTTGGTGG + Exonic
1132299022 15:100765170-100765192 CCTCATCCTGCAGGGTTTAGAGG - Intergenic
1133209501 16:4255539-4255561 CAGGAGTCTGCAGGTTTTCTTGG - Intergenic
1133916596 16:10114540-10114562 CCGGTGCCTGCGGGTTTCTGGGG - Intronic
1134204593 16:12226875-12226897 ACTGAGCCTTCAGGTTTTGGTGG + Intronic
1136289678 16:29264144-29264166 CAGGAGCATGGAGGATTTAGGGG - Intergenic
1139848957 16:69939413-69939435 GGTGAGCCTGCTGGTTTTAGTGG + Exonic
1142095414 16:88237124-88237146 CAGGAGCATGGAGGATTTAGGGG - Intergenic
1148586647 17:48785978-48786000 CAGGAGCCGGCATCTTTTAGAGG - Intronic
1151308589 17:73279832-73279854 CCCGAGGCTGCAGGCTTGAGAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156596078 18:38549753-38549775 CCTGAGACTACAGGTTTTTGTGG + Intergenic
1157523353 18:48360661-48360683 GGGGAGCCTGCAGGTTTGAGTGG + Intronic
1157675110 18:49562746-49562768 CCTGAACCTGGAGGTTTGAGAGG + Intronic
1161660147 19:5540794-5540816 ACAGAGCCTGGAGGTCTTAGTGG + Intergenic
1162053488 19:8049556-8049578 CCAGAGCCTGCAGGGTTGGGTGG - Intronic
1162572780 19:11482446-11482468 CCGGAGCCGGCAGGTTTCCATGG - Intronic
1163804722 19:19388485-19388507 CAGGAGCCTGGAGGATTTTGTGG + Intronic
1164402837 19:27913473-27913495 CTGGAGCCTGCAGGTGGCAGAGG + Intergenic
1167943021 19:52962766-52962788 CCGGAACCTGCAGGTCTGTGGGG + Exonic
925092946 2:1169645-1169667 CCGGAGCCTGCAGGTTTTAGTGG - Intronic
926203327 2:10817002-10817024 CAGGAGGCAGTAGGTTTTAGGGG - Intronic
928107161 2:28477971-28477993 CCTGTGCCTCCAGGGTTTAGGGG - Intronic
932205114 2:69873587-69873609 CCTGAGCATGCTGCTTTTAGAGG - Intronic
932238927 2:70142333-70142355 CCGGGGCCCGCAGGTTTTACAGG - Intergenic
933165440 2:79070058-79070080 CCTGAGCCTGGAGTTTTTATGGG - Intergenic
936349703 2:111703425-111703447 CCGGAGCCTGAAGGTTCTTAGGG - Intergenic
942451138 2:176108451-176108473 CCGGAGCCTCCTGCTTTTAAGGG + Intronic
945508545 2:210671829-210671851 CTGGTGTCTGCAGGTCTTAGAGG + Intronic
946426669 2:219602062-219602084 CAGGAGCCTCCAGGCATTAGAGG + Exonic
947545903 2:231010101-231010123 GCTGAGCCTGCAAGTTATAGGGG + Intronic
1173894697 20:46541873-46541895 CCGGAGCCAGCTGGTTGAAGAGG + Exonic
1179793583 21:43769506-43769528 CCTGTGCCTGCAGGTTTTGCTGG - Intergenic
1180961672 22:19765201-19765223 CCACAGCCTGCAGGTCTAAGCGG - Intronic
1182048349 22:27294374-27294396 CCAGATCCTGCAGATTCTAGTGG + Intergenic
1184191668 22:42899085-42899107 CCAGAGTCTGAAGGTATTAGGGG - Intronic
1185175410 22:49323782-49323804 TCCGAGGCTGCAGGCTTTAGGGG - Intergenic
1185181149 22:49364133-49364155 CCAAAGCCTGAAGGTTTTGGGGG + Intergenic
954104470 3:48402520-48402542 CAGGCCCCTGCAGGTTTTAGGGG - Intergenic
954334944 3:49910837-49910859 CCGGAGCCCGCTGGTGCTAGTGG - Exonic
966574826 3:181488436-181488458 CCTGAGCCTGGTGATTTTAGTGG + Intergenic
969340684 4:6538997-6539019 CTGCAGCATGCAGATTTTAGGGG - Intronic
969351350 4:6599811-6599833 CCAGAGCCTGCAGGTTGGATGGG - Intronic
981358740 4:143822835-143822857 ACAGATCCTGCAGATTTTAGCGG - Intergenic
984589358 4:181600297-181600319 CTGGAGCCCTCAGATTTTAGAGG - Intergenic
985695289 5:1336753-1336775 CCCCAGCCTGCAGGTTGTATAGG + Intronic
996146651 5:119985308-119985330 CCGGGGCCTGCAGGGGGTAGGGG - Intergenic
997382231 5:133446135-133446157 CGAGAGCCTGCAGGTTTTGGTGG - Intronic
1000442249 5:161277758-161277780 CCAGACGCTGCAGGATTTAGGGG + Intergenic
1011633820 6:89352539-89352561 CCGGACTCTTCAGGTTGTAGCGG + Exonic
1015101494 6:129486976-129486998 CTGGAGCCAGCAGGCTTTGGCGG + Intronic
1015982551 6:138853737-138853759 CAGGCGCATGCAGGGTTTAGGGG - Intronic
1019916848 7:4138949-4138971 CCGGAGCCTGCTAGGTTTTGAGG + Intronic
1024809826 7:53195741-53195763 CCGGAGCCTGCACCTTCCAGTGG - Intergenic
1029926245 7:104321833-104321855 CCTGAGTCTGCAGATCTTAGTGG + Intergenic
1032546891 7:132751314-132751336 CTGGAGCCTGCACATTTCAGGGG + Intergenic
1035403881 7:158586601-158586623 CCGGGGACTGGAGGTTTTATGGG + Intronic
1039093549 8:33858044-33858066 GCTGAGCCTCCAGGTGTTAGAGG - Intergenic
1042964767 8:74338619-74338641 GCGGAGGCTGCAGGTTGCAGAGG - Intronic
1043876605 8:85492977-85492999 CAGGAGCCTGCAGGTGCAAGTGG + Intergenic
1045773096 8:105768425-105768447 CAGGAACCTACAAGTTTTAGGGG + Intronic
1049021728 8:139961664-139961686 CCTGAGCCTGCAGGGATGAGGGG - Intronic
1049103940 8:140599506-140599528 CCTGGAGCTGCAGGTTTTAGGGG - Intronic
1049616265 8:143577029-143577051 CTGGAGACAGCAGGGTTTAGAGG + Intronic
1056806870 9:89735805-89735827 CTGGGACCTGGAGGTTTTAGGGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057130018 9:92648593-92648615 TCAGAGGCTGCAGCTTTTAGAGG - Intronic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1062065962 9:134526349-134526371 CAGGAGCCTTCAGGGTTTGGTGG + Intergenic
1062320941 9:135990295-135990317 CAGGAGCCTGCAGGGTGTGGGGG - Intergenic
1189066720 X:37817855-37817877 CAGGAACCTCCACGTTTTAGAGG + Intronic
1192511565 X:71723200-71723222 GCGGAGCCTTCTGGTTCTAGGGG + Intergenic
1192515132 X:71758305-71758327 GCGGAGCCTTCTGGTTCTAGGGG - Intergenic
1194205127 X:91002899-91002921 CCTGAGCCTGCAGGGATGAGGGG + Intergenic
1198821241 X:140650590-140650612 CCCTAGCCTGCAGGTTCAAGAGG - Intergenic
1199737858 X:150701625-150701647 CCAGAGCCTGTATGTGTTAGAGG - Intronic
1200550946 Y:4578020-4578042 CCTGAGCCTGCAGGGATGAGGGG + Intergenic