ID: 925093555

View in Genome Browser
Species Human (GRCh38)
Location 2:1175210-1175232
Sequence CTGGGTAATCTGCACTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925093552_925093555 -2 Left 925093552 2:1175189-1175211 CCAGTTGTCTCAACACTATTTCT 0: 1
1: 6
2: 41
3: 506
4: 4482
Right 925093555 2:1175210-1175232 CTGGGTAATCTGCACTGCCACGG 0: 1
1: 0
2: 0
3: 16
4: 127
925093551_925093555 20 Left 925093551 2:1175167-1175189 CCAGGTGCATTTTTATGGGTAAC 0: 1
1: 0
2: 2
3: 7
4: 92
Right 925093555 2:1175210-1175232 CTGGGTAATCTGCACTGCCACGG 0: 1
1: 0
2: 0
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925093555 Original CRISPR CTGGGTAATCTGCACTGCCA CGG Intronic
901137894 1:7009494-7009516 CTGATGCATCTGCACTGCCAGGG + Intronic
901212687 1:7535310-7535332 CTGGGGAAGCTGCAGTGCCCAGG + Intronic
901819293 1:11816419-11816441 CTGGGCAAGGTGCACTGACAGGG - Intronic
902305913 1:15539155-15539177 CTGGCTAATCTGCACACCCTCGG - Intronic
902412770 1:16221090-16221112 CTGGGTCATCTGCAGGGCCAGGG + Intergenic
903845601 1:26278230-26278252 CTGGGTACTCTGAACTTTCAAGG - Exonic
905592635 1:39177881-39177903 CTATGAAAGCTGCACTGCCATGG + Intronic
905787553 1:40770309-40770331 CTTGGTAATCTACACTGGCAGGG - Intronic
905925622 1:41747352-41747374 CTGGGTGACTGGCACTGCCATGG - Intronic
906710941 1:47929635-47929657 CTGGCTAGACTGCACTCCCAGGG + Intronic
907500087 1:54872610-54872632 GTGTGTCATCTTCACTGCCATGG - Intronic
909561359 1:77012549-77012571 CTATGTATTCTGCACTGACAGGG + Intronic
910207673 1:84764411-84764433 CTGGGATGTCTCCACTGCCAAGG + Intergenic
912524698 1:110272756-110272778 CTGGGAAATCTGAACTGTTAGGG - Intronic
913665882 1:121048589-121048611 CTGGGTAATCTCCAAAGCCTCGG + Intergenic
914017280 1:143831865-143831887 CTGGGTAATCTCCAAAGCCTCGG + Intergenic
914655895 1:149740405-149740427 CTGGGTAATCTCCAAAGCCTCGG + Intergenic
921122310 1:212147727-212147749 TAGATTAATCTGCACTGCCAGGG - Intergenic
922565325 1:226597837-226597859 GTGGGTCAGCTGCACTGCCAGGG + Intronic
1062997829 10:1883416-1883438 CTGTGAAAGCTGCACTGCAAGGG + Intergenic
1064909165 10:20381922-20381944 CTTGGAAGTCTGCACTCCCAAGG - Intergenic
1065856589 10:29836014-29836036 TTGGTTAATTTTCACTGCCAGGG - Intergenic
1069710249 10:70483381-70483403 CTGGGTCATCTGCACACCCATGG + Intronic
1070987274 10:80699787-80699809 CAGGGGACTCTGCACTGCTAGGG + Intergenic
1074432912 10:113408867-113408889 CTGGGTAGTCAGCTGTGCCAAGG - Intergenic
1075141103 10:119836710-119836732 TTGAGTATTTTGCACTGCCATGG - Intronic
1075278094 10:121113287-121113309 CTGGCAAATCTGCTTTGCCAAGG - Intergenic
1077354447 11:2108768-2108790 CTGGGGAATCTGCAGAGTCATGG - Intergenic
1079469403 11:20763938-20763960 CTGAGTGATGTGCACTGGCAAGG + Intronic
1080045559 11:27804123-27804145 CTGGATAACCTGGACTCCCATGG - Intergenic
1080904951 11:36534530-36534552 CTGGATATTTTCCACTGCCATGG + Intronic
1081632783 11:44701041-44701063 CTGGGAGATGTGCATTGCCACGG + Intergenic
1083597045 11:63922910-63922932 CTGGGTGCTCTGCTCTGCCAGGG + Intergenic
1083696410 11:64445766-64445788 CTGGGTCCTGCGCACTGCCACGG - Intergenic
1084177831 11:67432765-67432787 CTGGGCCATCTCCACTCCCAGGG + Exonic
1086164910 11:83766465-83766487 CAGTGGAATCTGCATTGCCATGG - Intronic
1086227856 11:84533939-84533961 CAGAGTAATTTGCACAGCCAAGG + Intronic
1087528128 11:99344732-99344754 CTTGGTGATCTGCACAGACAAGG + Intronic
1088401097 11:109423130-109423152 CTGAGTAATCTGCACCTCCGCGG + Intronic
1089300340 11:117495074-117495096 CTGGGCACTCTGCACTGAGAAGG - Intronic
1089639483 11:119838339-119838361 CTGGTTAGTGTGCACTGCAAAGG - Intergenic
1090920164 11:131199797-131199819 AAGAGTTATCTGCACTGCCATGG - Intergenic
1094763392 12:33561577-33561599 CTGGGTTCTCTCCACTCCCACGG + Intergenic
1095735256 12:45548951-45548973 CTGGTTAATTAGCACTGCCTGGG - Intergenic
1095915096 12:47470306-47470328 CTGAGTACTCTGCACTGTCCAGG - Intergenic
1100502421 12:95186740-95186762 TTGGGTAATCTGCTGTACCAAGG - Intronic
1105320328 13:19314064-19314086 CTGGTTAAGCAGCATTGCCAGGG + Intergenic
1106909123 13:34444360-34444382 CTGGGAAATCTGCAGTGCAAAGG + Intergenic
1107710926 13:43149975-43149997 CTGGGTAAGATTCAGTGCCAGGG + Intergenic
1122353606 14:101111195-101111217 CTGGGAAAACTGCCCTGCCCTGG - Intergenic
1123981535 15:25609229-25609251 CAGGGTCATCTGCCCTGCCTTGG + Intergenic
1125250525 15:37697298-37697320 CTTGTTAATCTGCACTGGCTAGG - Intergenic
1126326224 15:47480393-47480415 GTGGGTAATCTTGACTGTCAGGG - Intronic
1133023110 16:2975508-2975530 CTGGCCCATCTGCACAGCCAGGG - Exonic
1133873228 16:9709106-9709128 CTGGGTAGTGTAGACTGCCAAGG + Intergenic
1138461504 16:57151007-57151029 CCAGATAATCTGCACTGCCATGG + Intergenic
1139738881 16:69017696-69017718 CTGGCTCATCTCCACTTCCAGGG + Intronic
1140602784 16:76498667-76498689 CTGGGGCCTCTGCTCTGCCAGGG + Exonic
1142481898 17:224185-224207 CTGTGTTCTCTGCACAGCCAGGG + Intronic
1143090088 17:4444969-4444991 CTGGGCCATCTGCCCTGCCACGG + Intronic
1143783559 17:9241464-9241486 CTGGGCTCTCTGCACTGCCCGGG + Exonic
1146023204 17:29296445-29296467 CTGGGTCAACTGATCTGCCATGG - Intergenic
1146457202 17:33017340-33017362 CTGGGCCATCTACACTGGCAGGG - Intronic
1148133647 17:45277663-45277685 CTGAGTTATCTGCAGTGCCCCGG - Intronic
1151218035 17:72591314-72591336 CTGGTTAATCTGCACGCCAAGGG + Intergenic
1154205551 18:12333891-12333913 GTGGGTAAGCAGCACAGCCAGGG - Intronic
1158496563 18:57960328-57960350 CTGGGTAATCTTCACTCTCATGG - Intergenic
1160119008 18:76110315-76110337 CTAACTATTCTGCACTGCCAAGG + Intergenic
1160605982 18:80049705-80049727 CTGGGCCATCTGCATTACCAAGG - Intronic
1164843665 19:31413565-31413587 CTGGATCATCTGCCCTGTCAGGG + Intergenic
1165050632 19:33139305-33139327 CTGAGTGATCTGCACTGCCTGGG - Intronic
1165131951 19:33638294-33638316 TTGGGTAATTAACACTGCCATGG - Intronic
1165845565 19:38815911-38815933 CTTGGTGCTCTGCACCGCCACGG + Exonic
1167648335 19:50717545-50717567 CTGGGGAATCTGCCGTCCCAGGG + Intronic
925093555 2:1175210-1175232 CTGGGTAATCTGCACTGCCACGG + Intronic
925878844 2:8333707-8333729 CTGGGTGCTCTGATCTGCCAGGG + Intergenic
928237336 2:29555413-29555435 CTGGGTAATCTCCCCAGTCATGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
932467475 2:71933001-71933023 CAAGGTCATCTGCACTCCCAGGG - Intergenic
935202278 2:100868429-100868451 TTTGGTAATCTGCAGTGTCATGG + Intronic
939374508 2:141346411-141346433 CTGGAAAACCTGCACTGCCCAGG - Intronic
1172501775 20:35432873-35432895 CTGGGGAATCTGGGCTGCCAAGG - Intergenic
1172656370 20:36541139-36541161 CAGGGGAAGCTGCACTCCCACGG + Intergenic
1175541865 20:59752915-59752937 CTGGGTAAGCTGTGCTGTCACGG + Intronic
1175851626 20:62097078-62097100 CAGGGGGATCTGCACTGCCCAGG + Intergenic
1176286870 21:5023039-5023061 CTAGGAAATCAGCAGTGCCAGGG - Intronic
1179155550 21:38847920-38847942 CTGGTTTCTCTGCCCTGCCAGGG - Intergenic
1179298805 21:40088379-40088401 CTGGGTACTCTGCCCTTCCAGGG - Intronic
1179870311 21:44240436-44240458 CTAGGAAATCAGCAGTGCCAGGG + Intronic
1180875799 22:19174784-19174806 CTGGCTTCTCTGCACAGCCAGGG + Intergenic
951011017 3:17679876-17679898 CTAGGTATTCTGCAATGCAAGGG - Intronic
952526669 3:34217862-34217884 CTTTGTAAACTTCACTGCCATGG + Intergenic
954627477 3:52030458-52030480 CTGGGTTATGTCCACTGCCCTGG - Intergenic
954656396 3:52196907-52196929 CTGGGTGATGGGCACTGCCCAGG + Intergenic
956165347 3:66394362-66394384 GTGGGTTATATGCACTGCCCTGG - Intronic
957800875 3:85078871-85078893 TTAGGTAGTCTGCACTTCCAGGG + Intronic
960593104 3:119384439-119384461 CTGGGTAATTTGCAATGAAAGGG + Intronic
962069961 3:132023271-132023293 CTGGGTACACGGCACTGCAAAGG - Intronic
965306144 3:167066163-167066185 GTGTTTCATCTGCACTGCCAAGG + Intergenic
968982863 4:3860100-3860122 CTGGGCACTCAGCAATGCCAGGG - Intergenic
969471170 4:7390075-7390097 CTGGCTAAGCTGCACAGCCGTGG - Intronic
970453068 4:16191149-16191171 CTGGAGAATCTGCATTTCCAGGG - Intronic
970603065 4:17655399-17655421 CTGTGTGATCCTCACTGCCAAGG - Intronic
974008615 4:56586094-56586116 CTGGGAAATCTGTAATGCCTTGG + Intronic
976542891 4:86298162-86298184 CTGGGTAATCTGGATTGCTGTGG - Intronic
977772838 4:100880189-100880211 TTGACTAATCTGCACTGCCAAGG + Intergenic
979713618 4:123810301-123810323 CTGGGTAGGCTCCACAGCCAAGG + Intergenic
980847073 4:138336647-138336669 CTGGGTAATAGCCATTGCCATGG - Intergenic
982272564 4:153606053-153606075 CTGGGTGAACTGCATTACCAGGG - Intronic
988398122 5:30723649-30723671 CTGGGAAATCATCACAGCCAAGG - Intergenic
991976527 5:72188761-72188783 CTGGGGAATCTGCCCTTCCACGG - Intronic
998251934 5:140559254-140559276 CTAGGGAATCTGCTTTGCCAGGG - Intronic
998427240 5:142039319-142039341 CTGGGGAAACAGCAGTGCCAAGG - Intergenic
998956703 5:147446161-147446183 CAGGGTCATTTGCACTGGCAGGG + Intronic
1005265813 6:24111206-24111228 CTGGTTAGTCTGCACTGCAGAGG - Intergenic
1005865664 6:29934150-29934172 CTGGGTAATCTGAGCCGCCATGG - Intergenic
1007756809 6:44104754-44104776 CTTGGTCATCTACTCTGCCAAGG - Intergenic
1008071673 6:47104689-47104711 CAGGGCAATCTTTACTGCCAGGG + Intergenic
1010814985 6:80347427-80347449 CAGGGAACTCTGCACTGACATGG + Intergenic
1011274896 6:85621234-85621256 GAGGGTAATATGAACTGCCAGGG - Intronic
1012979801 6:105817518-105817540 CCGGGTAATCTGTACTAACAGGG - Intergenic
1013609306 6:111779247-111779269 CTGGCCCATCTGCAATGCCACGG + Intronic
1017683110 6:156883835-156883857 CTGAGTAGGCTGAACTGCCAGGG - Intronic
1018417058 6:163610840-163610862 CTGGGAACTCTGCCCTGCCTGGG + Intergenic
1019952312 7:4383568-4383590 CTGGTTACTCTGCACAGCGATGG + Intergenic
1020032618 7:4943521-4943543 CTAGGTAATGGGCACTGCTAGGG - Intronic
1020412349 7:7907099-7907121 CTAGGGAATTGGCACTGCCATGG + Intronic
1023459671 7:40381947-40381969 CTGTGTCATCAGCACTGGCATGG - Intronic
1024513474 7:50221364-50221386 CTGGGAACTTTGCACAGCCAAGG + Intergenic
1027776397 7:82470791-82470813 CTGGGTAATGAGCACTTGCAAGG - Intergenic
1036016065 8:4785985-4786007 CTGGGTAAGCTGCACTAACCTGG - Intronic
1039720630 8:40160517-40160539 CTAGGTATTCTGCAATGTCAGGG - Intergenic
1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG + Intronic
1044913188 8:97083795-97083817 CTGGGTATTCTTCACTGTAAAGG + Intronic
1048208119 8:132431713-132431735 CTGGGGATTCTTCACTGTCATGG + Intronic
1058903531 9:109462198-109462220 CTGAGTCTTCTGCACTGACAGGG + Intronic
1060425736 9:123503932-123503954 CTGAGTCATCTGTACTCCCAGGG + Intronic
1203364719 Un_KI270442v1:247653-247675 CTGGGTAACCTGCCCTCCGAAGG - Intergenic
1187693186 X:21892633-21892655 CTGGACAATATGCACTTCCATGG - Intergenic
1188440634 X:30212508-30212530 CTGGGTACTCTGCACTGGGCTGG + Intergenic
1188467884 X:30503352-30503374 CTGGCTAATATGAACTGTCAAGG + Intergenic
1193824734 X:86209615-86209637 CTGTGTTATCTGCACTGGGATGG - Intronic
1194669667 X:96715537-96715559 CTGTGTAATCAATACTGCCACGG - Intronic
1199937824 X:152593920-152593942 CTGGGTCATCTGCATTTCCATGG + Intergenic