ID: 925098483

View in Genome Browser
Species Human (GRCh38)
Location 2:1226431-1226453
Sequence CTGTATTCCCAGTTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925098483_925098494 23 Left 925098483 2:1226431-1226453 CCCAGCACCAACTGGGAATACAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 925098494 2:1226477-1226499 CCATCAGTATGGAAAGACACAGG 0: 1
1: 0
2: 0
3: 14
4: 143
925098483_925098490 12 Left 925098483 2:1226431-1226453 CCCAGCACCAACTGGGAATACAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 925098490 2:1226466-1226488 TTGGAATCACCCCATCAGTATGG 0: 1
1: 0
2: 0
3: 2
4: 84
925098483_925098488 -7 Left 925098483 2:1226431-1226453 CCCAGCACCAACTGGGAATACAG 0: 1
1: 0
2: 1
3: 21
4: 235
Right 925098488 2:1226447-1226469 AATACAGGCGGCATTTCCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925098483 Original CRISPR CTGTATTCCCAGTTGGTGCT GGG (reversed) Intronic
901008271 1:6182190-6182212 CTGTAGTCCCAGCTGCTACTGGG - Intronic
901575290 1:10195887-10195909 CTGTAGTCCCAGCTGCTTCTTGG - Intergenic
903629844 1:24759829-24759851 CTGTATTCCCAGTTGCTTGGGGG + Intronic
903998561 1:27323856-27323878 CTGTGTTCCCAGATAGTTCTAGG + Intronic
904023106 1:27483511-27483533 CTGTAATCCCAGCTGCTACTAGG + Intronic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
905615950 1:39398889-39398911 CAGTACTCCCAGCTGGTGCAAGG - Intronic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
906147059 1:43566417-43566439 CAGTTTTCCCAGTTGTTGATGGG + Intronic
908687527 1:66738833-66738855 ATGTATTCCTAGTGTGTGCTAGG + Intronic
911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG + Intronic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
914750039 1:150528705-150528727 CTGTAGTCCCAGTTACTACTCGG - Intergenic
917209482 1:172616722-172616744 CTCCCTTCCCAGTTGGGGCTGGG + Intergenic
917519943 1:175739879-175739901 CAGTATTCCAAGTTGGTGGTTGG - Intronic
918311641 1:183289462-183289484 CTGTATTCCCCATTGGGGCCTGG - Intronic
919644541 1:200081118-200081140 CTGTTTTTCCACTTGTTGCTTGG + Intronic
920650079 1:207831155-207831177 CGGGAGTCCCTGTTGGTGCTGGG - Intergenic
920709079 1:208277902-208277924 TTGTATTTTCATTTGGTGCTTGG + Intergenic
922974166 1:229769757-229769779 CTGTCTCCCCAGCTGCTGCTTGG - Intergenic
924645070 1:245870051-245870073 CTGTATTCCCAGTGCCTGCAAGG + Intronic
1063467768 10:6258799-6258821 CTCTCTTCCCACTTGGTGGTAGG + Intergenic
1063492584 10:6478490-6478512 CTGCATTCCCACTCGGTGTTGGG - Intronic
1063507048 10:6609106-6609128 CTGTATTTCTAGTTGGTGTGAGG + Intergenic
1063642332 10:7842280-7842302 CTGTGATCCCAGCTGGTGGTAGG - Intronic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1065421470 10:25549389-25549411 TTGTATTCCAAGTTTGAGCTCGG - Intronic
1066068436 10:31779423-31779445 CTGTAATCCCAGTTACTACTTGG + Intergenic
1068085442 10:52368230-52368252 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1069637164 10:69931921-69931943 CTGTATTCTCATCTGGAGCTAGG + Intronic
1071108569 10:82127653-82127675 CCTTCTTCCCAGTTGGTGCCAGG + Intronic
1073509587 10:104034817-104034839 CTGAATTCCCAGCCTGTGCTCGG + Intronic
1076118460 10:127917547-127917569 CTGTAGTCCCAGTTGCTCCGGGG + Intronic
1078772599 11:14364762-14364784 CTCTATTTCCAGGTGATGCTGGG - Intergenic
1079727344 11:23892181-23892203 CTGCCTTCCCAGTTGGTGACCGG + Intergenic
1080684327 11:34502778-34502800 CTGTTTTCTCAGTGGGTGGTGGG + Intronic
1083864744 11:65447521-65447543 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1085659571 11:78351414-78351436 CTGGATTCCCAGGTGGCCCTGGG + Intronic
1087634090 11:100683892-100683914 CTGTAATCCCAGCAGGTACTAGG - Intergenic
1088851184 11:113704822-113704844 CTGAATTCCCACTTTGTGCCAGG - Intronic
1089210287 11:116795827-116795849 CTATATTCTGAGTTAGTGCTTGG + Intergenic
1089281897 11:117380615-117380637 TTCTATTCCCAGTGGTTGCTGGG - Exonic
1089650585 11:119910307-119910329 CTGTGTTCCCAGTGTCTGCTTGG + Intergenic
1089837384 11:121383133-121383155 CTAGAATCCCAGTTGGAGCTTGG + Intergenic
1091569319 12:1670632-1670654 ATGTGTTCCCAGATGGTGCCTGG + Intergenic
1095122901 12:38440522-38440544 TTGTATTCACATTTTGTGCTTGG + Intergenic
1097455691 12:59796183-59796205 CATTATTCCCCGCTGGTGCTGGG + Intergenic
1098970424 12:76849184-76849206 CTGTAATCCCAGCTGCTGGTGGG + Intronic
1101438140 12:104681724-104681746 CCGTAGTCCCAGTTGCTACTTGG + Intronic
1101982982 12:109423600-109423622 CAGTATTTCCAGTGGCTGCTGGG - Intronic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1102284252 12:111642447-111642469 CTGTTTTCCCAGGTGGTGGTGGG + Exonic
1103232978 12:119347674-119347696 CTATATTCCCAGTACATGCTGGG + Intronic
1105340608 13:19521054-19521076 CTGTATACTCTGTTGTTGCTGGG + Intronic
1105386731 13:19937251-19937273 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1109858126 13:68160454-68160476 CCCTATTTCCATTTGGTGCTGGG - Intergenic
1112317794 13:98379895-98379917 CTGTATACCCAGTACATGCTAGG + Intronic
1113245122 13:108386633-108386655 CACTATTCCCAGTGAGTGCTCGG + Intergenic
1116159384 14:41249488-41249510 CTGTAATCCCAGCTGCTACTTGG + Intergenic
1118758470 14:68862916-68862938 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1119352201 14:73975276-73975298 ATGTGATCCCAGTTGGGGCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119892969 14:78196899-78196921 CTATATTCCCAGCTTGAGCTAGG - Intergenic
1121270385 14:92633663-92633685 TTGTATACCCAGTTGGTGTCTGG + Intronic
1121895031 14:97638928-97638950 CTGTACTTCCATTTGGAGCTTGG + Intergenic
1122260533 14:100517719-100517741 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1124249536 15:28097765-28097787 GGGGATTCCCAGTTGGTGATGGG - Intronic
1124369854 15:29098438-29098460 CTCTATTCCGAGTTGGTTTTTGG + Intronic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1125827168 15:42686167-42686189 CTCTATTGCCAGTTGGCCCTAGG + Exonic
1125893934 15:43286390-43286412 CAGTATTCTCAGTTGTTCCTTGG - Intronic
1127028994 15:54840773-54840795 CTGTGTTCCCAGTGTGAGCTAGG - Intergenic
1131157805 15:90085509-90085531 CTGTCCTCCCAGTTGCAGCTGGG - Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1135400692 16:22164434-22164456 CTGTATTCCCAGCTGCTTGTGGG + Intergenic
1136272537 16:29157078-29157100 CTTTATCCCCAGGTGGTCCTCGG + Intergenic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1137665670 16:50247485-50247507 CTGTAATCCCAGCTGCTACTCGG - Intronic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1141164746 16:81652925-81652947 TTGAATTCCCAGATGGTGCCTGG - Intronic
1143039422 17:4022550-4022572 CTGTATTCCCTGTTGGAAATAGG - Intronic
1143474185 17:7193471-7193493 CTGTGTTCCCCGTGAGTGCTGGG - Exonic
1145007017 17:19343847-19343869 CTGTGTTCCCAGCTGGTTCATGG - Exonic
1146668700 17:34722075-34722097 CTGTATTCTCAGTTGCAGGTGGG - Intergenic
1147504519 17:41002315-41002337 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1149852063 17:60043661-60043683 CTGTGTCTCCAGTTGGTGCCTGG + Exonic
1151310297 17:73288648-73288670 CTGGACTTCCAGTGGGTGCTTGG - Intronic
1151598881 17:75094275-75094297 CTGTCTTCCCTGGAGGTGCTGGG + Intronic
1152682076 17:81673677-81673699 CTCAGTTCCCAGATGGTGCTGGG - Exonic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1153840882 18:9006692-9006714 CTGTAATCCCAGCTGCTACTGGG - Intergenic
1155771029 18:29699067-29699089 ATGTATTCCCAGATTGTTCTAGG + Intergenic
1156552431 18:38031702-38031724 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1157081007 18:44525168-44525190 CTGGATTCCCAGTTCCTTCTAGG - Intergenic
1160125252 18:76165717-76165739 CTGTGTTCCAAGTGGGAGCTGGG + Intergenic
1160920580 19:1518382-1518404 CTGTATCTCCATTAGGTGCTGGG - Intergenic
1161540682 19:4849430-4849452 CTGTAGTCCCAGTTGCTATTTGG - Intronic
1163029334 19:14533953-14533975 CTGTTTTTCCAGTTGCTGCTGGG - Intronic
1163091138 19:15021266-15021288 CTCTATTCTCAGGTGGTGGTGGG - Intronic
1164550685 19:29209713-29209735 CTGTAATCCCAGGTAGTGCTAGG - Intronic
1167416356 19:49375077-49375099 CTTTATTTCCATATGGTGCTTGG - Exonic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
1168597858 19:57693654-57693676 GTGTATTTCCAGGTTGTGCTGGG - Intronic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
925567951 2:5276991-5277013 CTGCATTCGCAGATGGTGTTAGG - Intergenic
926225138 2:10961753-10961775 CTGTGTTCGAAGTGGGTGCTGGG - Intergenic
927902218 2:26828730-26828752 CTGTAATCCCAGCTAGTACTCGG + Intergenic
929991153 2:46788062-46788084 CTGTAGTCCCAGTTGCTACTTGG + Intergenic
930021354 2:47003920-47003942 CTGTATTCCTAGTTGGCTCAGGG + Intronic
930942355 2:57028123-57028145 CTGGATTCTCCCTTGGTGCTGGG - Intergenic
931315832 2:61130232-61130254 CTGTAATCCCAGTTGTTGCCTGG - Intronic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934662400 2:96150171-96150193 CTGTGTTCCCAGATGGGCCTGGG + Intergenic
935402221 2:102671981-102672003 CTGTAATCCCAGCTGCTACTTGG + Intronic
939452625 2:142393739-142393761 CTGCATTTCCAGCTGGTGGTTGG - Intergenic
940316401 2:152331999-152332021 CTGTCTTCCTAGCTGCTGCTAGG - Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
941985695 2:171509422-171509444 CTGCATTCCCAGTCTATGCTTGG - Intergenic
943332123 2:186572286-186572308 CTGTAGTCCCAGCTGCTACTTGG + Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
943780908 2:191822771-191822793 TTGTATTTCCAGTTGCTGCTTGG - Intergenic
945360393 2:208889294-208889316 CTGCATTGCCAGTTGATGTTAGG - Intergenic
1168758103 20:329764-329786 CTGTTTTCCCAGTAGGAGCCAGG + Exonic
1169105178 20:2988370-2988392 GGGTATTTCCTGTTGGTGCTTGG - Exonic
1169650505 20:7861434-7861456 TTGTAGTCCCAGCTGCTGCTTGG + Intergenic
1170333028 20:15236502-15236524 CTGAACTCCCACTTGGTGCCAGG + Intronic
1170649755 20:18228517-18228539 CTGTAGTCCCAGTTGATGGCGGG - Intergenic
1173579729 20:44138502-44138524 CTGTAGTCCCAGGTGCTGTTCGG - Intronic
1173926721 20:46786413-46786435 CAGTATTCCCAGTTGGGTATTGG + Intergenic
1175103510 20:56596981-56597003 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175413360 20:58785815-58785837 CTGTATGCCCAGCTCATGCTAGG + Intergenic
1176118046 20:63441729-63441751 CTGTCTTCCCAGTCGGGGCTTGG - Intronic
1177688951 21:24478167-24478189 CTGCAATGCCAGATGGTGCTTGG - Intergenic
1178242629 21:30920345-30920367 CTGCATTCCCAGTTGGTGATTGG + Intergenic
1178579678 21:33827887-33827909 ATGTAAGCCCAGTTGGAGCTGGG - Intronic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1180062382 21:45392321-45392343 CTGAGTTTCCAGTCGGTGCTGGG + Intergenic
1181481361 22:23201263-23201285 CTGCATTCCCTGCTGGGGCTTGG + Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1184232790 22:43167651-43167673 CTGTGTTTCCAGGGGGTGCTGGG - Exonic
1184848306 22:47102470-47102492 CTGTTTTCCCACTGAGTGCTGGG + Intronic
1185253796 22:49820476-49820498 CTGTATTCCCAGCTGAGGCTGGG + Intronic
953129864 3:40127638-40127660 CTGCATTCCCGGTTGGGGGTGGG + Intronic
953441798 3:42924801-42924823 CTCTCCTCCCAGTTGGGGCTGGG - Intronic
953918570 3:46936438-46936460 CTGTTTGCCCAGCTAGTGCTGGG - Intronic
956090649 3:65663047-65663069 TTGAATTCCCAGTATGTGCTAGG - Intronic
957895807 3:86420376-86420398 CCGTCTTCCCAGATGGTGCTCGG + Intergenic
958667979 3:97164227-97164249 TTGTATTGCCAGATTGTGCTAGG + Intronic
959699536 3:109285740-109285762 CTGTAGTCCCAGCTGCTCCTAGG - Intergenic
967467173 3:189821297-189821319 CTGTATTCTGAGTTAGTGCAAGG - Intronic
969105637 4:4805281-4805303 CTGTGTGCCCATTTTGTGCTAGG + Intergenic
970074461 4:12201678-12201700 CTGTAGTCCCAGTTACTGGTGGG + Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
973152095 4:46900741-46900763 CTGTATTCTCACATGGTGGTAGG - Intronic
973766901 4:54170978-54171000 CTGTTTTCCAAGATGTTGCTTGG + Intronic
973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG + Intronic
975978003 4:80121148-80121170 CTGTAGTCCCAGCTGCTACTCGG + Intronic
978490210 4:109303447-109303469 CTGTATTCCTAGTCTGTACTAGG + Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
979927212 4:126582739-126582761 CTGCAATCCTAGTGGGTGCTGGG - Intergenic
981949613 4:150390474-150390496 CTTTATTCACAGTTAGTGGTAGG - Intronic
983584619 4:169341781-169341803 CTGTATTCTCACTTTGTGGTGGG - Intergenic
985663456 5:1169168-1169190 CTCTAGTCCCAGTAGGTGCTGGG - Intergenic
985874777 5:2586373-2586395 CTTTCTTCCCAGTTGGTGGTTGG + Intergenic
986301733 5:6482949-6482971 CAGTTTTCCCACTTGGAGCTGGG - Intronic
986496024 5:8342666-8342688 CTGTATACCCTGTTGTTGTTGGG - Intergenic
988363672 5:30268229-30268251 CTGTATTCCCAGATCTTGCTCGG - Intergenic
989419096 5:41214993-41215015 CTAGATTCTTAGTTGGTGCTGGG - Intronic
989505314 5:42219896-42219918 CAGTATTGCCAGATAGTGCTGGG - Intergenic
991058519 5:62345422-62345444 CTGTAATCCCAGCTGCTACTTGG + Intronic
992782131 5:80137514-80137536 CTGTAGTCCCAGCTGCTACTCGG + Intronic
995347021 5:111133107-111133129 CTATGTTCCCACTTGGTTCTAGG + Intergenic
996191948 5:120555487-120555509 CTGTATTCTCACATGGTGGTGGG + Intronic
997978470 5:138454180-138454202 CTGTGTTTCCAGGGGGTGCTGGG - Intergenic
998400549 5:141846570-141846592 CTATTTTCCCAGTGGGTTCTGGG - Intergenic
999282388 5:150374251-150374273 CTGCCTTCCCAGGGGGTGCTGGG - Exonic
999282489 5:150374694-150374716 CTGTCTTCCCAGGGGGCGCTGGG - Exonic
999282581 5:150375031-150375053 CTGTTTTCCTAGGAGGTGCTGGG - Exonic
999283392 5:150379609-150379631 CTGTCTTCCCAGGAGGTGTTGGG - Exonic
999368531 5:151038688-151038710 CTGTCTTCCCATCTGGTGGTGGG - Intronic
1002799270 6:505603-505625 CTGCATTCCCAGGTGCTGCCTGG + Intronic
1003150728 6:3546667-3546689 CTGTATACCTAGTTGGTTCTAGG + Intergenic
1004292046 6:14376373-14376395 CTGAAGTCCTAGTAGGTGCTGGG + Intergenic
1004590585 6:17047538-17047560 ATGTATTCCAAGTTGGTGACAGG + Intergenic
1005155040 6:22794785-22794807 CTGTATTCCCAGCTGCTTATGGG + Intergenic
1007017264 6:38481360-38481382 TTGTATTCCCAGTTGATACTTGG + Intronic
1007316579 6:40994058-40994080 CTGAAGTCCCATTTAGTGCTAGG - Intergenic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1011061632 6:83276198-83276220 CTGTATTCAAAGTTGGTTCTTGG - Intronic
1013066119 6:106685842-106685864 CTGTATTTTCAGTTTCTGCTAGG + Intergenic
1014102139 6:117523112-117523134 CTACAGTCCCAGTTGGTGATAGG + Intronic
1014184500 6:118419809-118419831 CTCTATTTCCAATTTGTGCTAGG + Intergenic
1014726879 6:124981903-124981925 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1015551000 6:134412375-134412397 ATGTGTTCCCAGATGATGCTGGG + Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1018408652 6:163517222-163517244 TTGTAAACCCAGTTGGTGTTTGG + Intronic
1020394634 7:7700466-7700488 CTGTAATCCCAGTTTGTGGGAGG + Intronic
1023975543 7:45027152-45027174 CTCCATTCCCAGGTGGGGCTTGG - Intronic
1026044348 7:66895634-66895656 TTGTATTCCCAGTTAGGGGTAGG + Intergenic
1026485220 7:70812379-70812401 CTGTATTCCCAATTGAAGCCAGG - Intergenic
1029369871 7:100142456-100142478 CTGTAATCCCAGCAGGTGGTAGG + Intergenic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1031323792 7:120366360-120366382 CTGTATTCTCAGCTGCTACTTGG + Intronic
1031916352 7:127566413-127566435 CTGTAATTCCAGTTGGGGTTTGG - Intergenic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1038328222 8:26588392-26588414 CTGTATTCGAATCTGGTGCTTGG + Intronic
1039311249 8:36320836-36320858 CTCACTTCCCAGATGGTGCTGGG + Intergenic
1039400715 8:37266556-37266578 CTGTTTTTCCAATTGTTGCTTGG - Intergenic
1040372172 8:46787974-46787996 CTGCATTCCCATTTGCTGGTGGG + Intergenic
1040380692 8:46868876-46868898 CTGCATTCCCATTTGCTGGTGGG - Intergenic
1041789052 8:61671040-61671062 CTGTATTTCCCATTGTTGCTGGG - Intronic
1043571685 8:81610900-81610922 CTGTGTTCCCTGTGGGTCCTTGG - Intergenic
1044562885 8:93630641-93630663 CTGTATTCCCAGTGTCTGGTAGG - Intergenic
1046803395 8:118453641-118453663 CTGTAGTCCCAGTTGCTTGTGGG - Intronic
1050461539 9:5881514-5881536 ATGTCCTCCCAGGTGGTGCTGGG + Intergenic
1051873673 9:21768089-21768111 CTGTTTACCCAGTTGGGTCTGGG + Intergenic
1052107774 9:24541174-24541196 CTGTATTACCTGTTGCTGGTGGG + Intergenic
1052169397 9:25375004-25375026 CTGTTTTCCTTGTTGGGGCTTGG + Intergenic
1052233386 9:26182271-26182293 CTGTAATCCCAGTAAGTGCTTGG + Intergenic
1057080996 9:92174634-92174656 CTGTTCTCCCAGATGGTGCACGG - Intergenic
1057341409 9:94205136-94205158 CTGTATTCCCAGCTACTACTTGG + Intergenic
1058315590 9:103561386-103561408 CTGTAGTCCCAGCTGCTCCTCGG - Intergenic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1058737376 9:107906262-107906284 CTGAGTTCCCAGTTGGTGGCTGG - Intergenic
1062479288 9:136744032-136744054 CTTTATTCTGAGCTGGTGCTGGG + Exonic
1186110721 X:6253055-6253077 CAGTATTTCAACTTGGTGCTGGG - Intergenic
1186159517 X:6762067-6762089 CTGTAGTCCCAGTTGCTCCAGGG + Intergenic
1186901186 X:14058548-14058570 CAGTATTACAAGTTGGTGGTGGG + Intergenic
1187520512 X:20009733-20009755 CTGTAATCCCAGTAAGTACTTGG + Intronic
1188645616 X:32563215-32563237 CTGTAGTCCCAGCTGCTACTTGG + Intronic
1191674674 X:63782433-63782455 CTGCAATGCCAGTTTGTGCTGGG - Intronic
1191767851 X:64719913-64719935 CTTTATTCCCAGGAGATGCTGGG + Intergenic
1195304339 X:103564634-103564656 CAGTATTCCCTGTTTTTGCTTGG - Intergenic
1196206141 X:112942233-112942255 CTGTATTCTCAGTGGGAGATGGG - Intergenic
1197317509 X:124985922-124985944 CTGCAGTGCCAGTTGGTGGTGGG + Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1198410878 X:136366462-136366484 CTGTATTCGTAGTTAGAGCTTGG - Intronic
1198986522 X:142460660-142460682 CTGTATTCTCACTTGGTGAAAGG + Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1200823156 Y:7609172-7609194 AGGTATTCACAGTGGGTGCTAGG + Intergenic
1200847987 Y:7851238-7851260 CTGCATTCCCATTTGCTGGTGGG - Intergenic
1202236899 Y:22721923-22721945 AGGTATTCACAGTGGGTGCTAGG - Intergenic
1202269067 Y:23053159-23053181 CTGCATTCCCACTTGCTGGTGGG + Intergenic
1202306268 Y:23474245-23474267 AGGTATTCACAGTGGGTGCTAGG + Intergenic
1202422059 Y:24686899-24686921 CTGCATTCCCACTTGCTGGTGGG + Intergenic
1202448727 Y:24983179-24983201 CTGCATTCCCACTTGCTGGTGGG - Intergenic
1202564541 Y:26196344-26196366 AGGTATTCACAGTGGGTGCTAGG - Intergenic
1202591564 Y:26489523-26489545 CTGTATACTCTGTTGTTGCTGGG - Intergenic