ID: 925100034

View in Genome Browser
Species Human (GRCh38)
Location 2:1236433-1236455
Sequence GCTGCCTGCCCTCCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925100027_925100034 30 Left 925100027 2:1236380-1236402 CCAGGAGGACCAGGAAAGGTGAT 0: 1
1: 0
2: 5
3: 23
4: 224
Right 925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG 0: 1
1: 1
2: 3
3: 38
4: 390
925100029_925100034 21 Left 925100029 2:1236389-1236411 CCAGGAAAGGTGATCAGAAAGGG 0: 1
1: 0
2: 0
3: 35
4: 193
Right 925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG 0: 1
1: 1
2: 3
3: 38
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925100034 Original CRISPR GCTGCCTGCCCTCCCCATGC AGG Intronic
900302436 1:1984814-1984836 GCCTCCTGCCCTGCCCAGGCTGG + Intronic
900406130 1:2493790-2493812 GCTGCCCGCTCTCCCCAGCCTGG - Intronic
900612490 1:3550072-3550094 GCCCCCAGCCCTCCCCATCCCGG + Intronic
900745950 1:4360909-4360931 GCTGCCTGCCCTGACCACCCTGG - Intergenic
900798552 1:4724113-4724135 GCTGGGTGGCCTCCCCAGGCTGG + Intronic
900807819 1:4779298-4779320 GCCTCCTGCACTTCCCATGCTGG - Intronic
901610007 1:10490596-10490618 TCTTCCTGCTCTCCCCATTCAGG + Intronic
901758595 1:11456187-11456209 TCTGCCTTCCCTCCATATGCAGG - Intergenic
902235716 1:15056132-15056154 GCGGCATTCCCTCGCCATGCCGG + Exonic
902571210 1:17348052-17348074 GCCCCCTCCCCACCCCATGCAGG - Intronic
902796525 1:18804098-18804120 GCTGCCTGCCGCCCCCAGCCTGG + Intergenic
902936195 1:19766592-19766614 CCTGCCTGCCAGCTCCATGCTGG + Intronic
904080384 1:27868914-27868936 GCTGGAAGCCCTCCGCATGCTGG - Intergenic
904384649 1:30133322-30133344 GCTGCCTGTACTGGCCATGCTGG - Intergenic
904491018 1:30859138-30859160 GCTGCATGCCCCACCCCTGCTGG + Intergenic
904973309 1:34435671-34435693 CCTTCCTGCCATCCCCATCCTGG - Intergenic
906478667 1:46186355-46186377 GCTGCCTGCCTTTCCCACTCAGG + Intergenic
906492360 1:46278543-46278565 CCTGCCTTCCCTCCTCAAGCAGG - Exonic
907285404 1:53376557-53376579 GCTCCCGGCCCTCTCCATTCTGG - Intergenic
907353082 1:53849403-53849425 GCTGCCTGCCCACACCAGACTGG - Intergenic
907627420 1:56043743-56043765 CCTACCAGCCTTCCCCATGCTGG + Intergenic
908763662 1:67535090-67535112 GCTGACTGGCCTCCCCATCTTGG - Intergenic
909890797 1:81004225-81004247 GCTGGCTGCCAGGCCCATGCTGG - Intergenic
910081471 1:83347627-83347649 GCTGCCTGCTCTCTGCATCCTGG + Intergenic
911097094 1:94063639-94063661 ACTCCCTCGCCTCCCCATGCTGG - Intronic
912473060 1:109918913-109918935 TCTGCTTGCCCTCCAAATGCTGG - Intronic
912489591 1:110054747-110054769 GCTGCCTGCCTTTCCCATCCTGG + Intronic
912518920 1:110232265-110232287 GCTGCATGCCCTCCAACTGCTGG + Exonic
912529857 1:110312506-110312528 CCTTCCTTCCTTCCCCATGCAGG + Intergenic
912682530 1:111738569-111738591 GCTGCCAGCCCCCTCCCTGCTGG + Intronic
912711606 1:111953968-111953990 GCTCCCTGCCCTCCACAGGGAGG + Intronic
915247510 1:154567292-154567314 GCTTCCTGCCCTCCCACTGAGGG - Intergenic
915471285 1:156127043-156127065 GCTGAGTGCCGTCCCCGTGCTGG - Intronic
920435854 1:205946658-205946680 GCTTCCTGCCCTCCTCTTGTTGG - Intergenic
920452214 1:206068066-206068088 GCTGTCTGCCCTGCACTTGCAGG - Intronic
920932908 1:210405556-210405578 GCTGCTTGCCCTGCCCTTCCAGG - Intronic
921326856 1:213994028-213994050 GCTGCATCCCTGCCCCATGCTGG - Intronic
921904662 1:220484075-220484097 GTTGCCTTCCCTCTCCATGCTGG + Intergenic
922160984 1:223079027-223079049 GCTGGCTGCACTGCCCAAGCCGG - Intergenic
1063029576 10:2220231-2220253 TCCCCATGCCCTCCCCATGCAGG + Intergenic
1063365244 10:5486634-5486656 GCTGCCTCTCCTCCGCCTGCAGG - Intergenic
1063430187 10:5981377-5981399 GATGTCTGACCTCCCTATGCAGG + Intergenic
1064076484 10:12273024-12273046 GCTTCCTGCCCTCTACATGTTGG - Intergenic
1064340224 10:14478799-14478821 GCTGGCAGCCATCCCCAGGCAGG + Intergenic
1065112592 10:22454458-22454480 GTAGCCTGCCCTTCTCATGCTGG - Intergenic
1065186599 10:23174877-23174899 GCGGCCTGCCCTCCCCCTCCCGG - Intergenic
1067093866 10:43285859-43285881 GCTGCCTGTCCTCCCCAGTGAGG - Intergenic
1067224361 10:44365841-44365863 GCTGCCAGTCAGCCCCATGCTGG - Intergenic
1067839772 10:49666292-49666314 CCTGCCTGTCCTGCCCATGCTGG - Intergenic
1069514893 10:69069681-69069703 CCTGACTGCCCTTCCCAGGCAGG - Intergenic
1069827069 10:71260863-71260885 GCTGCCTGCCCGCCCCTTCCTGG - Intronic
1071246687 10:83772928-83772950 TCAGCCAGACCTCCCCATGCAGG - Intergenic
1071489626 10:86127525-86127547 GCTGCCTGGGCTCCAGATGCTGG - Intronic
1071647340 10:87367077-87367099 CCTTCCTGCCCTCCCCATTCAGG - Exonic
1072737087 10:97886382-97886404 GCTGCCTGCTGTGCCCATGAGGG - Intronic
1072797420 10:98366523-98366545 GCTCCCCGCCCTCCCCGTCCTGG - Intergenic
1073315702 10:102579262-102579284 GCTGTGTGCCCTGCCCATGTGGG + Intronic
1073490822 10:103852228-103852250 GCTGAGTGCCATCCCCATGATGG + Intronic
1075131970 10:119748163-119748185 GCTGCCTGCCCTGCCACGGCTGG - Intronic
1075622664 10:123939317-123939339 CCTGCCTGCCTTCCACCTGCTGG - Intronic
1075646566 10:124100684-124100706 GCAGACTGCCCTCCCCAGGGAGG - Intergenic
1076100065 10:127770091-127770113 GCAGCTTGCCCTCCCCATTGTGG + Intergenic
1076594567 10:131617767-131617789 GCTGCCTGCTCTTCCGAGGCAGG + Intergenic
1076634789 10:131875246-131875268 CCTGCCCGCCCTCCCCAGCCAGG + Intergenic
1077089741 11:773023-773045 GCTGCCTGTCCAGGCCATGCTGG + Intronic
1077118410 11:895850-895872 ACTGCCTGCCCCTGCCATGCTGG + Intronic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1077486256 11:2839636-2839658 GCTGCCTTCCCTCCCCCAGCTGG - Intronic
1079145253 11:17845500-17845522 GCTGACTGGCCTCTCCATCCTGG + Intronic
1079392403 11:20034006-20034028 GCTGCCTGGCCTCCCAAGCCTGG + Intronic
1080558156 11:33436476-33436498 GCAGACTGCCCTCCCCCAGCAGG - Intergenic
1080640543 11:34155898-34155920 TCCCTCTGCCCTCCCCATGCAGG + Intronic
1081811071 11:45914412-45914434 GCTGCCGTCCCTCCCGCTGCTGG + Exonic
1083224014 11:61273394-61273416 GCTGCCTGCCATCACCCTCCCGG + Intronic
1084174238 11:67415469-67415491 GCTCCGTGCCCTCCTCCTGCTGG + Intronic
1084562354 11:69911930-69911952 TCTGCCTGGCCTCCCCCTGCAGG - Intergenic
1084570393 11:69956304-69956326 GCTGCCTGCCCCGCCGATGCAGG - Intergenic
1084769188 11:71331700-71331722 GCTGTTTGCCCTTCCCATTCTGG - Intergenic
1089047535 11:115516180-115516202 GTTGCCTTCCCTCCCCAGCCTGG + Intergenic
1089339093 11:117745475-117745497 GCCCTCTGCCCTTCCCATGCAGG + Intronic
1090265796 11:125352073-125352095 GCTGCCTGCCCTTCTCCTCCTGG + Intronic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1091308800 11:134558620-134558642 GATGCCTTTCCTCCCCATCCTGG + Intergenic
1091310648 11:134573172-134573194 GCAGCCTCATCTCCCCATGCTGG - Intergenic
1091790547 12:3269607-3269629 GCTGTCTCCCATCCCTATGCAGG - Intronic
1091844658 12:3646566-3646588 CCTGCCTGCTCACCTCATGCAGG - Intronic
1092776690 12:11949947-11949969 CCTCCCTGCCCTTCCCCTGCAGG - Intergenic
1092886617 12:12929958-12929980 GCTGCAAGCCCTCCTTATGCTGG - Intergenic
1095702087 12:45201025-45201047 ACTGCCAGGGCTCCCCATGCTGG + Intergenic
1096149212 12:49298025-49298047 CCTGCCTCACCTCCCCATTCCGG - Exonic
1097156324 12:57014790-57014812 GCTGCCTGAACACCACATGCTGG - Intronic
1097924552 12:65112900-65112922 GCTCCCTTCCTTCCCCAGGCAGG + Intronic
1100012617 12:89971927-89971949 TCTGCTTGCCATCCCCATTCAGG + Intergenic
1100117640 12:91327361-91327383 GCTGTCTCCCCTCTCCATCCTGG - Intergenic
1100822335 12:98443162-98443184 GCTGCCTTCCCAAACCATGCAGG + Intergenic
1101641109 12:106586306-106586328 GTGGCCTGCGCTCCCCACGCGGG + Intronic
1102571087 12:113827463-113827485 CCTGCCTGCGCCTCCCATGCAGG - Intronic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103374243 12:120442887-120442909 GCTGCCTGGCCTCCCTTGGCTGG + Intronic
1103725799 12:122996831-122996853 CCTGGCTGCCCTCCCCCTGCTGG - Exonic
1103926821 12:124427811-124427833 CCTTCCTGTCCTTCCCATGCCGG + Intronic
1103932312 12:124457308-124457330 CCTGCAGGCCCTCCCCACGCTGG + Intronic
1104736933 12:131140761-131140783 CCTGCCTACCCTCCCCATGCAGG - Exonic
1105267645 13:18836638-18836660 TCTGCCTGGCCTCCCCATCTGGG - Intergenic
1105308523 13:19186101-19186123 GAGGCCTTTCCTCCCCATGCGGG + Intronic
1105686660 13:22789933-22789955 GATTCCTGTCCTCACCATGCTGG - Intergenic
1105949129 13:25213809-25213831 AATGCCTGCACTCACCATGCTGG - Intergenic
1106180119 13:27362850-27362872 CCTGCCTTCCCTCCCTCTGCTGG - Intergenic
1106400793 13:29428427-29428449 GCTCCCAGCCCTCCCCTGGCGGG - Intronic
1106408685 13:29496226-29496248 GCTGGCTGCTCTCCACCTGCAGG - Intronic
1109380534 13:61553175-61553197 ACTGCCTGCACTCCTGATGCAGG + Intergenic
1113289888 13:108893731-108893753 CCTGCCAGCACTCCCCATGATGG - Intronic
1113434528 13:110279858-110279880 GCAGCCAGCCCTCTCGATGCAGG - Intronic
1113448196 13:110386845-110386867 GCTGCTGGCCATCCCCATGAAGG + Intronic
1113658391 13:112085953-112085975 GCTGGCTGCCCACCTCCTGCTGG + Intergenic
1113901968 13:113802532-113802554 GCTGCCAGGCCTCCTCATGTGGG - Intronic
1115224388 14:31087995-31088017 AATGCCTGCCCTTCCCATGGAGG - Intronic
1118596768 14:67441660-67441682 GCAGACTGCCCTCTCCATGGTGG + Intergenic
1119406752 14:74403803-74403825 GCTGCCCGCCCAGCCCAAGCAGG + Intergenic
1119744324 14:77033465-77033487 GCTGCCCGCGCGCCCCAGGCTGG - Intergenic
1119940333 14:78633947-78633969 GCTGCCCTCCCTCCCCCTGCAGG + Intronic
1121338627 14:93092176-93092198 TGTGCCCACCCTCCCCATGCTGG - Intronic
1122048485 14:99039687-99039709 GATGCCTGCTCTCTCCTTGCTGG + Intergenic
1122128827 14:99593465-99593487 GCTGCCAGGCATCCCCATGGAGG - Intronic
1122436783 14:101706209-101706231 GGGGCCTGCCCCGCCCATGCAGG + Intergenic
1122636784 14:103133702-103133724 GCAGCCTGCTCTCCCTACGCTGG + Exonic
1122910009 14:104822985-104823007 GCTGGCTGCCCTCCCCACAGGGG + Intergenic
1122926717 14:104906531-104906553 GCTCCCTGCCCTGCCCGTCCCGG - Intergenic
1122926779 14:104906794-104906816 GCTCCCTGCCCTGCCCGTCCCGG - Intergenic
1123034484 14:105466365-105466387 CCTGCCTGCCCCTCCCCTGCTGG + Intronic
1123126933 14:105953602-105953624 GGTGCTTGGCATCCCCATGCAGG - Intergenic
1124387786 15:29224764-29224786 GCTGCCTGCCAGTCCCCTGCTGG + Intronic
1125472765 15:40020816-40020838 GCTGCCTCCCCTCCTGATGCTGG + Intronic
1125612343 15:40980082-40980104 CCTGCCTGTCCTTCCCCTGCTGG + Exonic
1125685694 15:41561941-41561963 CCTTCCTCCCCTCCCCCTGCTGG - Intronic
1127863462 15:63013205-63013227 GGTCCCTGCTCTTCCCATGCAGG + Intergenic
1128343133 15:66836638-66836660 GCTGCCTCCCCTGCCCAGCCTGG + Intergenic
1128345198 15:66848906-66848928 GCCGCCTACCCTCCCCAGGGAGG - Intergenic
1128864822 15:71106505-71106527 GCAGCCTGCCTGACCCATGCAGG + Intronic
1129060252 15:72855326-72855348 CCTGCCCTCCCTCCCCATGAAGG - Intergenic
1129731318 15:77934265-77934287 GCTTCCTGCCCTCCTGATGCTGG - Intergenic
1130089227 15:80805476-80805498 GCTGCCTGCCTTCCCTTTGGTGG + Intronic
1130573924 15:85073878-85073900 CCTGCCTGCTCTCCCCAGTCAGG + Intronic
1131770685 15:95734171-95734193 GCTGCCTGACCCACTCATGCAGG - Intergenic
1132275307 15:100558813-100558835 GCCGCCTGCCCACCGCCTGCAGG - Intergenic
1132669804 16:1097928-1097950 GCTCCCTGCCCACCCCACTCAGG - Intergenic
1132713725 16:1280297-1280319 CCTGACTGTCCTCCCCATACAGG - Intergenic
1132903407 16:2270294-2270316 GCCGACAGCCCTCCCCCTGCTGG + Intergenic
1132908225 16:2295129-2295151 ACTGGCTTCCCTCCCCTTGCTGG + Intronic
1133022881 16:2974589-2974611 GCTGCCAGCCCTCCCCACCGTGG + Exonic
1133025648 16:2987984-2988006 GGTGCCTGCCTGCCCCTTGCTGG + Intergenic
1133467407 16:6041111-6041133 CCTCCCTGCTCTCCCCCTGCAGG + Intronic
1135619080 16:23937820-23937842 ACTGCCTCCCCTTCCCTTGCTGG - Intronic
1136345699 16:29674325-29674347 GAAGCCAGCCCTCCCCACGCTGG + Intronic
1137378617 16:47976790-47976812 GCTGCCTCCTCTCCCCACACGGG - Intergenic
1137591459 16:49696586-49696608 CCTTCCAGCCCACCCCATGCTGG - Intronic
1137634606 16:49974964-49974986 GCTGCCTGCCCTGCCTCTCCTGG + Intergenic
1138203194 16:55105275-55105297 GCTTCCTGAGCACCCCATGCTGG - Intergenic
1139589701 16:67926798-67926820 GTTTCCTTTCCTCCCCATGCCGG + Intronic
1139709011 16:68761983-68762005 TCTGCCTCCCCTCTCCATTCTGG + Intronic
1139884159 16:70196970-70196992 GGTGCCTGCCCTTCCCGTGAAGG + Intergenic
1139924444 16:70478473-70478495 CCTGCCTGCCTCCCTCATGCTGG - Intronic
1139952986 16:70680921-70680943 TCTGCCTGCCCCTCCCCTGCTGG + Intronic
1140368359 16:74398526-74398548 GGTGCCTGCCCTTCCCGTGAAGG - Intergenic
1142029063 16:87829479-87829501 GTTGCCTTCCCACCCCGTGCTGG + Intergenic
1142196486 16:88741612-88741634 GCTCCCTGCTCTCCGCAGGCTGG - Exonic
1142239198 16:88937480-88937502 ACTCCCTGCCGTCCCCACGCTGG + Intronic
1142426927 16:90006446-90006468 GCTACCTGCGCTCCCCTTCCTGG - Exonic
1142648352 17:1329703-1329725 CCTGCCCTCCCACCCCATGCCGG - Intergenic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1144461957 17:15465823-15465845 GCTGCATGTCCTCCCCACGGTGG - Intronic
1144925475 17:18803606-18803628 GATGCCTGCCTTCCCCGAGCAGG - Intronic
1145241345 17:21242491-21242513 GCTGCAGGCCCGCCCCTTGCTGG - Exonic
1146954913 17:36931805-36931827 GCTGCCTTCCTTCCCCCTCCAGG - Intergenic
1147141844 17:38464770-38464792 GCTGCCAGCCCACCCCAGCCTGG - Intronic
1147169057 17:38607480-38607502 GCTGCCTCCCATGCCCATCCTGG - Intergenic
1147443464 17:40461275-40461297 GAAGTCTGCCCTCCCCATCCAGG - Intergenic
1147847710 17:43416701-43416723 CCTGCCTGTGCCCCCCATGCTGG + Intergenic
1147889127 17:43704732-43704754 GGCGCCTGCCCACCCCTTGCTGG + Intergenic
1148678356 17:49458242-49458264 GCAGCTTGCTCTCCCCAGGCAGG + Intronic
1148779011 17:50111355-50111377 ACTGCCTCCCCTTCACATGCAGG + Exonic
1150656034 17:67040467-67040489 GCTGCCTGCTCTCCTCCTGCAGG + Intergenic
1151448070 17:74180420-74180442 GCTGCCTGCTCTGGCCCTGCCGG + Intergenic
1151490632 17:74430874-74430896 GCTGCCTCCCCTCCCCCTCGCGG + Intronic
1151907125 17:77056076-77056098 GCAGCCTGCCCGCCCCTCGCTGG + Intergenic
1152181639 17:78825788-78825810 GCTCGCTGCACTCCCCCTGCAGG + Intronic
1152352983 17:79793598-79793620 GCGGCCCGCCCTCCCCAGGCAGG + Exonic
1152360685 17:79831922-79831944 TCCCCCTCCCCTCCCCATGCTGG + Intergenic
1152623136 17:81375872-81375894 GCTGACTGCCCTCCCCAGTGTGG + Intergenic
1152625329 17:81385560-81385582 GCTGCATCCCCTCCCCCAGCCGG + Intergenic
1152659139 17:81534456-81534478 GGTGCCTGCTGTCCCCATGCTGG + Intronic
1152752702 17:82072211-82072233 GGTGCCTTCCTTCCCCATGATGG + Intergenic
1152776322 17:82204235-82204257 GCTGCGTGCCCACCCATTGCCGG + Intronic
1153988155 18:10371583-10371605 GCTGCCTCCCCTGCCCCAGCAGG + Intergenic
1154040818 18:10854029-10854051 GCTGCCTCCACTCTCTATGCAGG + Intronic
1154375957 18:13810073-13810095 GGTGCCTGCACTCCACAGGCAGG + Intergenic
1155311985 18:24532930-24532952 GCTGCTTGTCCTCCCCACCCTGG - Intergenic
1156469609 18:37369033-37369055 CCTTCCTCCCCTCCCCATTCTGG - Intronic
1160123031 18:76147303-76147325 TCTCCCTGCCCTCCCCCTGCAGG - Intergenic
1160340196 18:78083012-78083034 GCTGCCTGCCCTTCCCCAGCTGG + Intergenic
1160492299 18:79348529-79348551 GCAGGCTGCCCTCCCCTGGCTGG + Intronic
1160691885 19:464038-464060 CCTGCCTGCCTTCACCATGCTGG - Exonic
1161123111 19:2540958-2540980 GCTGCATGCTCTCTCCCTGCTGG - Intronic
1161260548 19:3335524-3335546 GCTGCCTGCTGTCCCCAGGCAGG - Intergenic
1161723404 19:5915643-5915665 GCTCCCTGCCCCTCCCTTGCGGG + Exonic
1161772236 19:6237076-6237098 GCTGCCTGGACTCCCCACCCCGG - Intronic
1161837114 19:6655153-6655175 CCTGCCTTCCCTGCCCTTGCTGG - Intergenic
1161854961 19:6759030-6759052 GCTACGTACCCTCCTCATGCTGG - Intronic
1162519344 19:11170244-11170266 GTTCCTTGCCCTCCCCAGGCAGG - Exonic
1163013693 19:14440958-14440980 GCTTCCTGACCTCCCCAAACTGG - Intronic
1163648946 19:18506005-18506027 GCAGCCTGGGCCCCCCATGCTGG + Intronic
1163793846 19:19324255-19324277 GCTCCCTGCCCCACCCATTCAGG - Intronic
1165700576 19:37933951-37933973 ACTCCCTGGCCTCCCCCTGCAGG - Intronic
1166007075 19:39915295-39915317 GCTGCCTGCCTTCCGGGTGCTGG - Exonic
1166359703 19:42247995-42248017 CCTGCCTGCCCTGCCCCTCCAGG - Exonic
1166953745 19:46448000-46448022 GCAGCCTGGCCTGGCCATGCTGG - Intergenic
1167250945 19:48398228-48398250 GCTCCCTGTCCTCCCCATCTCGG + Intronic
1167736225 19:51296075-51296097 GCTGCTTGCTCTGCCCTTGCTGG - Intergenic
1167913278 19:52720963-52720985 GCTGCCTGGCCTCCCCGTCTGGG - Intronic
1168316318 19:55486292-55486314 GCTGCCTTCCCTTCCCATTTGGG + Intronic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
925258222 2:2507668-2507690 ACGGCCTGCCCTCCCCGTCCCGG + Intergenic
925292206 2:2755489-2755511 ACTGCCTGCCTCCACCATGCAGG + Intergenic
926213591 2:10889863-10889885 GCTGCCAGCCGTTCCCAGGCAGG + Intergenic
926218909 2:10922407-10922429 GCTCTCTGCCCTCCCAGTGCGGG + Intergenic
927204395 2:20597983-20598005 GCTGCCTGACCTACCCAGCCAGG - Intronic
927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG + Intergenic
927602282 2:24454588-24454610 GCTGAGTGCCCACCCCATGAGGG + Intergenic
928033228 2:27798952-27798974 GCCCCCTGCCCTCCCCTTGAGGG + Intronic
929122754 2:38496913-38496935 GGTGCATGCCCTCCCCACCCTGG - Intergenic
930930689 2:56878148-56878170 AATGCCTGCTCTCACCATGCCGG + Intergenic
930988191 2:57615163-57615185 GCTGCCAGCCCTCCCAGGGCTGG - Intergenic
931284059 2:60817989-60818011 GCTTCCTGCTCTCCCCACACAGG + Intergenic
932572652 2:72946079-72946101 GCTGCCATCCCTCCCCTCGCAGG + Intronic
934758355 2:96839861-96839883 GCGTGCTGCCCTCCTCATGCAGG + Intronic
934865542 2:97806904-97806926 GCTGCATGCCCGCCCTCTGCTGG - Intronic
935090477 2:99890855-99890877 GGGGCCTGCCTTCCCCAGGCTGG + Intronic
935145071 2:100390146-100390168 GCTACCTGCCCTTCCCCTCCAGG + Intergenic
935549263 2:104434640-104434662 GCTGCCTGCCTTCTACCTGCAGG + Intergenic
935814832 2:106837917-106837939 CCTCCCTGCCCTCTCCATGCAGG - Intronic
935953840 2:108354937-108354959 GCTTACTGCCCTGCCCCTGCAGG + Intergenic
937237920 2:120441910-120441932 CCTGCCTGCCCTTGCCCTGCCGG + Intergenic
937282526 2:120730180-120730202 GCTGCCTCCCCACCCCAGGACGG + Intergenic
937661187 2:124431363-124431385 GCTGCCTGGACCCCTCATGCAGG - Intronic
937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG + Intronic
938050039 2:128161077-128161099 GCTGCCTGCACTCAGCAAGCTGG - Intronic
938214107 2:129493426-129493448 GTTGACTGCTCTCCCCATCCCGG - Intergenic
940241748 2:151570529-151570551 GCTGGATGCCATCCCCATCCAGG - Exonic
940273434 2:151915485-151915507 GCTGGCTGCCCCTCCCCTGCGGG + Intronic
941751587 2:169140508-169140530 TCAACCTGCCCCCCCCATGCAGG - Exonic
942249275 2:174033853-174033875 CCTGCCTGTCCTCTCCATCCTGG - Intergenic
942763695 2:179429250-179429272 GCTGCCTGGCATCCCCAAACAGG - Intergenic
942966708 2:181902968-181902990 GGTCCCTATCCTCCCCATGCAGG - Intronic
943351864 2:186805863-186805885 GCTGCCTGCAGTCCCCAGCCAGG + Intergenic
943676132 2:190717956-190717978 GCTGCCAGCCCTGGCCAGGCAGG + Intergenic
943947880 2:194090671-194090693 CCGGCCTGCCCTCCCAGTGCAGG + Intergenic
945023237 2:205595051-205595073 ACTGCCTTTCCTCCCCTTGCAGG - Intronic
945984769 2:216344733-216344755 GCTCCCTCCCCTCTGCATGCAGG - Intronic
946408784 2:219506400-219506422 GCTGCCTGCTATCACCATCCTGG + Exonic
946419701 2:219557891-219557913 GCTGCAGGCCCAGCCCATGCAGG - Exonic
947445522 2:230159936-230159958 GCTGCCGGCCATCCCCAGGCGGG + Intergenic
947870738 2:233436482-233436504 GCTCCCTACCGTGCCCATGCGGG + Intronic
948579358 2:238973493-238973515 GCTGCATTCCATCCCCATCCCGG + Intergenic
948654526 2:239468598-239468620 GTTCCCTCCCCACCCCATGCAGG - Intergenic
948666861 2:239540439-239540461 GCTGCCTTCCCTCCTCTCGCTGG + Intergenic
948709841 2:239818790-239818812 GCTCCCTGCTCTTCCCATGGGGG - Intergenic
948999073 2:241601999-241602021 GCTGACTGCCCTTCCCTTGCAGG - Exonic
949019903 2:241735147-241735169 GCTCCCTGCCCTTCCCCTCCGGG + Exonic
1170454051 20:16516248-16516270 TCTCCCTGCCCTCTCCATCCTGG - Intronic
1170885951 20:20340060-20340082 GAGCCCTGCCCTCACCATGCAGG + Intronic
1171343064 20:24445554-24445576 GCTTCCTGCCCTCCGCTTGAAGG - Intergenic
1172192409 20:33069866-33069888 TCTGCCTGCTTTGCCCATGCAGG + Exonic
1173434510 20:43020640-43020662 GCGGCCTGCCCTAAGCATGCTGG + Intronic
1174575418 20:51533641-51533663 GCTGTCTGCCTTCCCCAGACGGG + Intronic
1175277452 20:57781950-57781972 CCTGCCTGCCCTAACCAGGCGGG - Intergenic
1175327807 20:58141958-58141980 GCTCTCTGCCCTGGCCATGCTGG - Intergenic
1175419435 20:58822092-58822114 GCTGCCTGCCTTCCTCCTGGTGG - Intergenic
1175943571 20:62548779-62548801 CCTGCCTGCCGTCTCCAGGCAGG - Intergenic
1176212464 20:63931663-63931685 CCTGCCTGCCCTGGCCTTGCTGG + Exonic
1176797115 21:13379179-13379201 TCTGCCTGGCCACCCCATCCAGG + Intergenic
1178159840 21:29899366-29899388 GCTGCCTTCCATGCCTATGCAGG + Intronic
1179887961 21:44322463-44322485 GCTGCCTGGCCTGGCCAGGCAGG - Intronic
1179995635 21:44972804-44972826 GCAGCCTGCCCTGGCCAGGCAGG + Intronic
1180559146 22:16601745-16601767 GCGGCCCGCCCTCCCCGCGCCGG + Intergenic
1180625376 22:17190533-17190555 GCTGCCTGCCTTGCCCCTGTAGG - Intronic
1181749122 22:24976684-24976706 CCTGCCTGCTCCCCACATGCTGG + Intronic
1182309630 22:29395405-29395427 GCTGCCTGCCCTCAGCAAGCAGG - Intronic
1182485574 22:30636693-30636715 GCTGTCGGCCCTGCACATGCTGG + Exonic
1182828093 22:33283022-33283044 TCTCCCTCCTCTCCCCATGCCGG - Intronic
1183736963 22:39649601-39649623 GCCGCCGGCCGTCCTCATGCTGG - Exonic
1184273548 22:43398113-43398135 TCTTCCTGGCCTCCCCAGGCCGG + Intergenic
1184753632 22:46503408-46503430 CCTCCCTGCCATCCCCATGGTGG + Intronic
1184796407 22:46735976-46735998 GCAGCCTGCCCTCTCCACCCAGG - Intronic
1184867748 22:47210883-47210905 CCTCCCTGCCCTGCCCCTGCAGG - Intergenic
950332435 3:12167168-12167190 GTTGCATGCCCTCCTCTTGCTGG + Intronic
950445267 3:13033808-13033830 GCCGACTGCCCTCCCCAGGCTGG - Intronic
950547213 3:13645659-13645681 TCTGCCTGCCCTTCCCCTTCAGG - Intergenic
950628884 3:14268137-14268159 TCTGCCTGCCCTTCCCCAGCAGG + Intergenic
954036163 3:47852368-47852390 GCGCCCCCCCCTCCCCATGCAGG - Exonic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955482291 3:59402007-59402029 GGTGCCTGGACTCCCCATTCTGG + Intergenic
956129405 3:66039404-66039426 CCTGCCTGCCCTGCGCTTGCGGG + Intergenic
957476722 3:80734848-80734870 TCTGGCTGCACTGCCCATGCAGG + Intergenic
958406070 3:93760609-93760631 TCTGCCTGGCCTCCCCATCTGGG - Intergenic
958636919 3:96756682-96756704 TCTGCCAGCACTCCCCATGAGGG - Intergenic
960227465 3:115184858-115184880 GCTGCCTGCCAGTCCCGTGCTGG + Intergenic
961956971 3:130814812-130814834 GCTGCCTGCCAGTCCCGTGCGGG + Intergenic
962163468 3:133023977-133023999 GCTGCCTGCCCTTACCCTACAGG + Intergenic
965078067 3:164003358-164003380 GCTGCCTGCCAGTCCCGTGCCGG - Intergenic
965757389 3:172040187-172040209 GCCGCCCGCCCTCCCCCTCCTGG - Intronic
966837476 3:184060036-184060058 GCTGGCTTCCCTCACCAGGCAGG - Exonic
966849615 3:184156359-184156381 GCTGCCTGCCCTCTCCTTTGTGG + Intronic
967942805 3:194779319-194779341 GTTCCCTGCCCTCCACATGCTGG - Intergenic
968191413 3:196670460-196670482 TCTCTCTGCCCTCCCCATGCCGG - Intronic
968448901 4:665980-666002 GCTGCCTGTCCTTCCCCTGTGGG - Intronic
968652791 4:1766839-1766861 GCCGCCTGCCCTCACCCTCCTGG + Intergenic
968838220 4:2980983-2981005 GCTGCCTGCCCTGCCACAGCTGG - Intronic
968914673 4:3492242-3492264 GCCCCCTGCCCTCACCATGCTGG - Intronic
968986162 4:3875673-3875695 TCCCCCTGCCCTGCCCATGCTGG + Intergenic
969338824 4:6527872-6527894 GCTGCCCGCTCTCCTCCTGCTGG - Intronic
969428807 4:7140994-7141016 GCTGCCGGCCCACCCCACCCAGG - Intergenic
969721258 4:8894076-8894098 GCTCCCTGCCCTCCCCGTGCAGG - Intergenic
971290254 4:25331101-25331123 GCTGCCAGCTCTCCACAGGCAGG + Intronic
973931100 4:55793785-55793807 GCTGCGGGCCCTCTCCATCCGGG + Intergenic
981136807 4:141220233-141220255 TTTTCCTGCCCTCCCCCTGCAGG - Intergenic
984908145 4:184649014-184649036 GCTGCCTGGCCTCCCCGGCCCGG + Intronic
985382190 4:189406301-189406323 GCTGCCCTCCCTCCCTATGGCGG + Intergenic
985664320 5:1174031-1174053 GCTGCTTCCCCTCCCTCTGCTGG + Intergenic
986041824 5:4001178-4001200 GCTGCATGACCTGCCCATTCCGG + Intergenic
986182237 5:5404060-5404082 GCTGCCTGACCTTCACAGGCTGG + Intergenic
986603797 5:9501612-9501634 GCTCCCTTCCCTCCTCCTGCTGG + Intronic
986717217 5:10533254-10533276 CCTTCCTGCCCTCCCTATCCTGG + Intergenic
987113343 5:14707620-14707642 GCTCCCAGGCCTCCCCATCCTGG + Exonic
987537803 5:19209716-19209738 GCTGCCTGCCCTGCCACAGCTGG + Intergenic
987568474 5:19624691-19624713 GCTGAATGCACTCCCCATGCTGG + Intronic
987635305 5:20531731-20531753 GCAGCCTGCCCTCCCCCAACAGG - Intronic
988999535 5:36745581-36745603 CCTGGCTGCCCACCCCAAGCTGG - Intergenic
990517283 5:56542003-56542025 GCTGCCTGCCCACCCCACATAGG - Intronic
991080566 5:62594527-62594549 GCAGTTTGCCCTCCCCATGTGGG - Intronic
992203563 5:74407544-74407566 GCTGCCTGACGTACCCAAGCTGG - Intergenic
992635174 5:78719858-78719880 GCTTCCTTCCCTCTCCATGTTGG + Intronic
996847989 5:127921769-127921791 GCTGCCTTCTCTCTCCATACTGG + Intergenic
997196507 5:131983849-131983871 GATGTCTGCCCTCCCCAGCCAGG + Intronic
997264171 5:132485481-132485503 CCTGCCTTCCCTTCCCATGGTGG + Intronic
997460285 5:134047235-134047257 GGTTCCTGCCCTCCCCCAGCAGG - Intergenic
999443369 5:151620073-151620095 CCTGCCTGCCCTCCTGCTGCTGG - Intergenic
1000245038 5:159442140-159442162 GGTCCCTGCCCTCCCCGTTCCGG + Intergenic
1000347152 5:160323761-160323783 GCTGACTGCCCTCCCCAGTGTGG + Intronic
1001193957 5:169654919-169654941 GCTCACTCCCCTCCCCAAGCTGG + Intronic
1001476988 5:172057546-172057568 TCTGCCTGGCCTCCTCATGCTGG + Intronic
1001678217 5:173536136-173536158 GCTGGCTTCCTTCCCCATCCTGG + Intergenic
1002044050 5:176532274-176532296 GCTGCCTTCCCTCCCCATGGGGG - Intronic
1002194437 5:177494589-177494611 GCTTCCTGCCCTCCTCACTCTGG - Intronic
1002466512 5:179411436-179411458 CCTGCCTGCCCTCCCAGAGCTGG - Intergenic
1003176295 6:3754046-3754068 CCTGCCTGCCCTCCTCTTCCTGG - Intergenic
1003537166 6:6985459-6985481 TCTGCTTGCCCTCACCATACTGG - Intergenic
1003828537 6:9978755-9978777 ACTGCCTCCTCTCCACATGCTGG - Intronic
1003961341 6:11211899-11211921 CCCTCCTGCCCTCCCCATCCTGG - Intronic
1006544938 6:34772768-34772790 TCTGCCTGCCCTCCCCTCCCTGG + Intronic
1007351330 6:41275689-41275711 GCATCCTGCTCGCCCCATGCTGG - Exonic
1007630633 6:43271178-43271200 GCCTCCTCCCCTCCCCATACAGG - Intronic
1009642999 6:66362119-66362141 GCTGCCTGCCCCACCAAAGCTGG - Intergenic
1014048096 6:116917439-116917461 GCTGCCTCCCCTCCCCTTTTGGG - Intronic
1015376665 6:132517458-132517480 GCTTCATGCCATCCCCATGTTGG + Intergenic
1018064629 6:160116580-160116602 GCTGCTTCCCATCCACATGCAGG + Intergenic
1018067847 6:160136117-160136139 GCAGCCTGCCCTCCCCACGTTGG - Intronic
1019404525 7:876714-876736 GCAGCTTGCCCTCCACACGCTGG - Exonic
1019429511 7:992219-992241 GCAGCCTGCCCACCCCAGGAGGG - Intergenic
1019909306 7:4089529-4089551 GCTTCCTGCCTTCCCCATCGTGG + Intronic
1022208309 7:28183761-28183783 GCTGTCTGTCCTCCACATACAGG + Intergenic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1027298958 7:76809867-76809889 GCTGCCTGCTCTCTGCATCCTGG + Intergenic
1029168966 7:98617587-98617609 GCTGCCCGCGATGCCCATGCAGG + Exonic
1029706338 7:102278228-102278250 GCTAGCTGCCCTCCCTAAGCCGG + Intronic
1029788857 7:102821292-102821314 GCTGGCTGCCCTACCCCTGCAGG + Intronic
1029895467 7:103978883-103978905 GCTTCCTACCCTCCCCACCCTGG + Intronic
1031070372 7:117155005-117155027 CATGTCTCCCCTCCCCATGCTGG - Intronic
1032438260 7:131920187-131920209 GCTGCCCACCCTTCCCATGCAGG + Intergenic
1033286800 7:140048337-140048359 GCTGCCTGCCCTGTCTTTGCTGG + Intronic
1034618140 7:152436184-152436206 GCGGCCGGCCCTCCCCGCGCCGG - Intergenic
1034637807 7:152581165-152581187 GCTTCCTGGACTCCCCACGCTGG - Intergenic
1035831774 8:2702642-2702664 GCGGAGTGCCCTACCCATGCTGG + Intergenic
1037528362 8:19749879-19749901 GCTCCCTGGCCTCCCACTGCAGG - Intronic
1037877508 8:22555169-22555191 TCAGCCTGCTCTCCCCAAGCGGG - Intronic
1038347518 8:26745833-26745855 GCTGCTTGCCATCCACATGAAGG - Intergenic
1039835170 8:41250119-41250141 GCTGCCTGGCCTCCCACAGCCGG + Intergenic
1039961866 8:42254682-42254704 TCTGCCTGGCCTCCCCATCTGGG + Intergenic
1041636884 8:60154992-60155014 GCTGCCTGCTGTCCCCATTTAGG + Intergenic
1043348876 8:79334913-79334935 GCTTCCAGCCCTCTCTATGCAGG + Intergenic
1043926306 8:86040836-86040858 GCTGCCTCCCCTCCACATGGAGG - Intronic
1044693864 8:94903875-94903897 GCTGCCTGCCCCACACATCCTGG - Intronic
1046868525 8:119177541-119177563 GCTGCCTGCCCTCTCCACTTGGG + Intronic
1047517415 8:125567219-125567241 GCTCACTCCTCTCCCCATGCGGG - Intergenic
1048451860 8:134540530-134540552 GCTGCCTGCCTGCAGCATGCAGG + Intronic
1048969067 8:139634335-139634357 GATGCCTGCCTTTCCCATGAGGG - Intronic
1049218886 8:141419970-141419992 CCTGCCTGCCCTCCACACCCTGG - Intronic
1049551372 8:143261479-143261501 GCTCCCTGCCGGCCCCATCCCGG - Intronic
1049750339 8:144280142-144280164 GCTGCCTGACTCCCCCATGGGGG + Intronic
1051336344 9:16069875-16069897 GCTGTCAGCCCTTCCCAAGCTGG + Intergenic
1052070748 9:24078852-24078874 CCTGTCTTCCCTTCCCATGCTGG - Intergenic
1053445163 9:38147008-38147030 GCTGCCTGCCCTGCCGCAGCTGG + Intergenic
1055435553 9:76288594-76288616 ACTGGCTGCCCTGGCCATGCTGG - Intronic
1057187061 9:93062885-93062907 GCTGCCTGCCTGCCCCATCCTGG + Intronic
1057212299 9:93206745-93206767 TCTGGCTGCCCTCCCCAAGAGGG - Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057724235 9:97556883-97556905 GGGGCCTGCCCTCCCCAGCCCGG - Intronic
1057792088 9:98131059-98131081 CCTGCCTCCCCTTCCCCTGCAGG - Exonic
1058001328 9:99869084-99869106 GATGCTGGCCATCCCCATGCTGG + Intergenic
1059149578 9:111937418-111937440 GCTGCCTGCACACCCCATTGCGG + Intergenic
1059409831 9:114124889-114124911 GCTCCCTGCCCTCCCCACTCTGG + Intergenic
1059432128 9:114256625-114256647 GCTGCCTGCTCTCGCAAGGCAGG - Intronic
1060781386 9:126415898-126415920 GCTGGCTTCCCTCCCCAGTCAGG - Intronic
1061133628 9:128721547-128721569 GAGCCCTTCCCTCCCCATGCCGG + Intronic
1062030389 9:134359559-134359581 CCTTCCAGCCCTCCCCAGGCGGG - Intronic
1062037361 9:134388733-134388755 GATGACTCCCCTCCCCATCCAGG - Intronic
1062041237 9:134405211-134405233 CCCGCCTGGCCTCCCCATCCTGG + Intronic
1062250570 9:135591801-135591823 CCTGCCCTCCCTCCCCAGGCAGG + Intergenic
1062416679 9:136454725-136454747 GCTGCCTACCAGCACCATGCTGG + Intronic
1062529852 9:136995067-136995089 GCTGCGCGCCCTCGCCAGGCTGG - Exonic
1062718141 9:138021446-138021468 GCAGCCGGCCCACCCCAGGCAGG - Intronic
1186347355 X:8707771-8707793 TCTGCCTCCCCTCCCCACCCCGG - Intronic
1189323152 X:40098074-40098096 GCCGCCTCCCCTCCCCCCGCAGG + Intronic
1189338007 X:40182431-40182453 GTAGCCTTCCCTCCCCAGGCTGG + Intergenic
1189380623 X:40500050-40500072 GCTGGCTTCACTCCCCATTCTGG + Intergenic
1190292357 X:49001322-49001344 AGTTCCTCCCCTCCCCATGCAGG + Intronic
1190380702 X:49837263-49837285 TCTGCCTGCACTCCTCAGGCAGG + Intergenic
1192250871 X:69412467-69412489 GGTGGATGCCCTCCCCATGGTGG + Intergenic
1192664120 X:73069692-73069714 TCTGCCTGGCCTCCCCATCTGGG + Intergenic
1193774787 X:85628354-85628376 GCTGCCTGCCATCCCCATGCAGG - Intergenic
1199711687 X:150474087-150474109 GCTGCCTTTCCAGCCCATGCTGG + Intronic
1200214313 X:154360678-154360700 GCTTCCTGCCCTCACCAAACAGG + Intronic
1200698672 Y:6383673-6383695 GCTGCCTGCACTCCACATTGTGG - Intergenic
1201035442 Y:9781026-9781048 GCTGCCTGCACTCCACATTGTGG + Intergenic