ID: 925101487

View in Genome Browser
Species Human (GRCh38)
Location 2:1250166-1250188
Sequence CAGAGGAAGGGGCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1908
Summary {0: 1, 1: 2, 2: 25, 3: 212, 4: 1668}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925101487_925101499 23 Left 925101487 2:1250166-1250188 CCAGCCTCCTGCCCCTTCCTCTG 0: 1
1: 2
2: 25
3: 212
4: 1668
Right 925101499 2:1250212-1250234 TCCGCCACCTGGCTTTGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 107
925101487_925101498 12 Left 925101487 2:1250166-1250188 CCAGCCTCCTGCCCCTTCCTCTG 0: 1
1: 2
2: 25
3: 212
4: 1668
Right 925101498 2:1250201-1250223 CGTGCTCTGTCTCCGCCACCTGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925101487 Original CRISPR CAGAGGAAGGGGCAGGAGGC TGG (reversed) Intronic
900093814 1:932291-932313 CGGAGGAGGGGGCTGCAGGCAGG - Intronic
900105529 1:979334-979356 CAGAGGGAGGGGGGCGAGGCAGG + Exonic
900116521 1:1031543-1031565 CAGGGGAAGGGGAACCAGGCAGG - Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900315086 1:2052365-2052387 AAGAGGAAGGGGTGGGAGCCTGG - Intronic
900366317 1:2313293-2313315 GGGAGGTAGGGGCTGGAGGCAGG + Intergenic
900439368 1:2645698-2645720 AGCAGGAAGGGGCAGGAAGCTGG - Intronic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900496890 1:2979784-2979806 CAGAGGTGGAAGCAGGAGGCTGG - Intergenic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900789075 1:4667355-4667377 GAGGGGCAGGGGCAGGTGGCTGG - Intronic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
901063078 1:6482439-6482461 CAGAGAAAGTGACAGGAGGGAGG + Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901188322 1:7389041-7389063 GAGAGGGAGGGGGAGGAGGAAGG + Intronic
901195559 1:7438105-7438127 CGGAGGCAGAGGCAGAAGGCAGG + Intronic
901373138 1:8817533-8817555 AAAAGGACGGGGGAGGAGGCGGG + Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
901860277 1:12069974-12069996 TAGAGGAACAGGAAGGAGGCCGG + Intronic
901932934 1:12608557-12608579 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
902038607 1:13475816-13475838 GAGAGTAAGAGGCAGGAGGGAGG + Exonic
902040088 1:13486201-13486223 CAGAGGGAGAGGCTGGAGGGAGG - Intronic
902328549 1:15718660-15718682 CAGAGGAGGGGGCAGGGTGGGGG + Intronic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902376781 1:16033582-16033604 CAGAGAAAGGGGGTGGAGGTGGG - Intronic
902392750 1:16115827-16115849 CAGTGGCGCGGGCAGGAGGCAGG + Intergenic
902446523 1:16469025-16469047 CAGGGGAGAGGGCAGGGGGCAGG + Intergenic
902605675 1:17567955-17567977 AAGAGGAAGGGGCTGGGTGCAGG + Intronic
902614680 1:17617394-17617416 CAGAGGAATGGACTGGAGCCTGG - Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902628302 1:17689470-17689492 GGGAGGTAGGGGAAGGAGGCAGG - Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902714024 1:18260238-18260260 CGAGGGAAGGGGCAGGTGGCTGG + Intronic
902782534 1:18713791-18713813 TAAAGGAAGGGGTAGGAGGTTGG + Intronic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
902799259 1:18819339-18819361 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
902922828 1:19677427-19677449 AGGAGGAAGGGGTAGGAGGGAGG - Intronic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903149745 1:21398319-21398341 TCTAGGAAGGGTCAGGAGGCCGG - Intergenic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
903192268 1:21663402-21663424 CAGGGGAAGACGCAAGAGGCTGG + Intronic
903212132 1:21824277-21824299 GAGAGGAAGGGCCAGGTGCCAGG + Exonic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903314714 1:22493628-22493650 AAGTGGAAGGGGCAGGAGAGAGG - Intronic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903578168 1:24351985-24352007 TAGAGGAACAAGCAGGAGGCAGG - Intronic
903654785 1:24942632-24942654 CAGAGGAGTGGGGAGAAGGCAGG - Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903811792 1:26038782-26038804 CTGAGAATGGGGCATGAGGCAGG + Exonic
903867916 1:26411839-26411861 CCTGGGAAGGGGCAGGGGGCAGG + Intronic
903879916 1:26501240-26501262 GAGGGGAAGGGGGAGGAGACAGG + Intergenic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
903911720 1:26731615-26731637 CACAGGGAAGGGCAGGAGGCAGG - Intronic
903978854 1:27170737-27170759 CAGGGGATCGGGCAGGAAGCTGG + Intergenic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
904036138 1:27559776-27559798 CAGACAAATGGGCAGGAAGCAGG - Intronic
904053551 1:27655718-27655740 CAGAGGAGGAGACAGGAGGCAGG + Intergenic
904086967 1:27916183-27916205 AAGGGGAGGGGGCAGGAGGGAGG - Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904376268 1:30084348-30084370 CAGAGGAGGGAGCAGAAGGTGGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904712908 1:32444478-32444500 TAGAGGAAGGTGCAGGTGACGGG + Intergenic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
904836107 1:33338006-33338028 CAGCGAAAGAGGCAGGAGGTGGG - Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904955858 1:34283394-34283416 CAGAGGAAGGGCCAAAAAGCAGG - Intergenic
905002899 1:34687186-34687208 GAATGGAAGGGGCAGGAGGAAGG - Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905022703 1:34828704-34828726 CAGAGGATGGGGCAGCAGAAGGG - Intronic
905108350 1:35577156-35577178 AAGGGGAAGGGGCAGGAGCCGGG + Intronic
905395115 1:37661728-37661750 CAGAGGGAGGGGCTGAGGGCCGG + Intergenic
905805614 1:40874979-40875001 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905907090 1:41626364-41626386 CACAGGCAGAGGCAGGAGCCAGG + Intronic
906151991 1:43592822-43592844 CGGGAGGAGGGGCAGGAGGCTGG - Intronic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906323300 1:44829550-44829572 GATAGGAGGGGGCAGGAGGAGGG + Intronic
906407148 1:45551019-45551041 CGGAGGGAGGGGCAGGGGCCGGG - Exonic
906489244 1:46255094-46255116 GAGTGGAAGGGGCAGAAGACAGG + Intronic
906532943 1:46533758-46533780 CAGAGGCAGAGGCAGGGGGCTGG - Intergenic
906543599 1:46606366-46606388 CAGAGGAAGAGGCAGCAGAATGG + Intronic
906707933 1:47908597-47908619 CAGAGGAGGTGGCAAGAGACAGG - Intronic
906869091 1:49456720-49456742 CAGAGGAAAGGGTAGGAGCGGGG - Intronic
906999337 1:50834024-50834046 TAGAGGAAGGGCCTGGTGGCAGG + Intronic
907046768 1:51304462-51304484 CAGAGAAAAGGGGATGAGGCTGG + Intronic
907158675 1:52356133-52356155 GGCAGGGAGGGGCAGGAGGCTGG - Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
907900906 1:58740838-58740860 CAGAGGCACAGGCAGGAGTCAGG - Intergenic
907908683 1:58808426-58808448 AAGAGGCAGGGGAAGGAGGGCGG + Intergenic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
908798502 1:67854879-67854901 GGGAGGAATGGGCAGGAGGTAGG - Intergenic
908992512 1:70110138-70110160 GAGAGGCAGAGGCAGGAGGATGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910288854 1:85581084-85581106 CAGGGGAAGGGGCTGGAGAGCGG - Intronic
911002330 1:93179814-93179836 CGGAGGAAAGGGGAGAAGGCGGG + Intronic
911205779 1:95090382-95090404 CAGTGATAGGGACAGGAGGCAGG - Intergenic
911504696 1:98734061-98734083 CAGAAGAATGGACAAGAGGCTGG - Intronic
911609947 1:99949818-99949840 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912640673 1:111342623-111342645 CAGAGGCAAAGGGAGGAGGCAGG - Intergenic
912724932 1:112050650-112050672 GAGAGGAAGAGGAAGGAGACGGG - Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913090631 1:115474442-115474464 CAGAGGAAGAGACAGCAGGAAGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913203507 1:116515332-116515354 CAGACCACGGGGGAGGAGGCCGG - Intronic
913230468 1:116736778-116736800 CAGAGGAAATGGCAGAAGCCAGG - Intergenic
913403067 1:118457313-118457335 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
913527568 1:119708780-119708802 CAGAGGAAGGGAGAGAAGGAGGG + Intronic
913590951 1:120324080-120324102 CAGGGAAAGGGACATGAGGCAGG + Intergenic
913652417 1:120931023-120931045 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914168691 1:145198027-145198049 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914523812 1:148441986-148442008 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914599862 1:149193862-149193884 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914642593 1:149625154-149625176 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915279080 1:154810153-154810175 CATAGGAACGGGCAGAAGGAGGG + Intronic
915282637 1:154833085-154833107 CAGAGGCAAGGGCTGGAGGGAGG - Intronic
915513923 1:156401845-156401867 CAGAGGGAAGGGGAGGAGGTGGG + Intergenic
915570735 1:156743893-156743915 CAGAGGAAGTGGGCTGAGGCTGG + Intronic
915785570 1:158607509-158607531 CAGGGGGAAGGGCAAGAGGCAGG - Intergenic
916021674 1:160798128-160798150 CAGTGGAGGGGGCAGGATGTGGG - Intronic
916109105 1:161449616-161449638 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916112278 1:161464407-161464429 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916332090 1:163628376-163628398 GAGGGGAAGGGGGAGGAGGGGGG - Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916872668 1:168933990-168934012 CAGAGGAAAGGGCGGGAGGTCGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917152876 1:171963603-171963625 CATATGCAGGGGCAGGAGGTGGG + Intronic
917663470 1:177200507-177200529 TAGAGGAATGGCCAGGAGGCTGG - Intronic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918214619 1:182382618-182382640 CAAAGGAAGGGGGAGGAGTGGGG + Exonic
918650159 1:186952696-186952718 GAGGGGACGGGGCAGGAGACAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919772505 1:201171378-201171400 CCCAGGGAGGGGCAGGAGGCTGG + Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
919905457 1:202075507-202075529 CTGGGGTAGGGGCAGGAGCCAGG - Intergenic
920029124 1:203026244-203026266 CAGAGGGAGGGGCAGAATGTGGG + Intergenic
920106301 1:203555912-203555934 GAGAGGAGGGGGCAGTGGGCTGG + Intergenic
920136290 1:203771791-203771813 CAGAGGATGGGGCAGGGAGGAGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920364157 1:205439344-205439366 CAAAGGAAGGGGTTGGAGGATGG + Intronic
920376835 1:205513319-205513341 CAGAGCAAGGGGCAAGGGCCAGG - Intronic
921055734 1:211541244-211541266 CTCAGGCAGGGGCTGGAGGCAGG - Intergenic
921067608 1:211633606-211633628 CATAGGGAGGGGCAGGAGGAGGG + Intergenic
921148640 1:212382665-212382687 CATAGGCAGTGGCAGGAGGCAGG + Intronic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921257660 1:213357009-213357031 CACAGGGAGGGGCAGAAAGCAGG + Intergenic
921267797 1:213439579-213439601 GAAAGGAAGGGGCAGGAAGCAGG + Intergenic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
922698629 1:227744903-227744925 CAGGGATAGGGGCAGGAGGGAGG + Intronic
922907646 1:229186738-229186760 GAAGGGATGGGGCAGGAGGCAGG - Intergenic
923152694 1:231247834-231247856 AAGAGGAATGGTCATGAGGCAGG + Intronic
923554467 1:234989909-234989931 CAGGGGAGGAGGCAGGATGCAGG + Intergenic
923687012 1:236160490-236160512 GACAGGGAGAGGCAGGAGGCAGG - Intronic
923732003 1:236560615-236560637 CAGTGGAAGGGGCAGGACAGTGG + Intronic
923983014 1:239347046-239347068 CAGAGGAAGGGACAGAAAGTGGG - Intergenic
924378087 1:243434276-243434298 CTGAGGTGGTGGCAGGAGGCAGG - Intronic
924532345 1:244904078-244904100 CAGAGGCTGAGGCAGGAGGAAGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063173820 10:3533864-3533886 CGGAGGAAGGTGCAGGAAGGTGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1063511268 10:6647220-6647242 CAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1063978212 10:11433723-11433745 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1063978220 10:11433755-11433777 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1063981215 10:11453325-11453347 AAGAGGCTGGGGCAGGAGGCTGG + Intergenic
1064013598 10:11755787-11755809 CAGAGGAACAGGCAGGCGGTCGG - Intronic
1064263839 10:13808675-13808697 CAGGGGAAAGGGCAGGTGTCAGG - Intronic
1064380483 10:14837858-14837880 CTGACGCAGGGCCAGGAGGCCGG - Exonic
1064757582 10:18585634-18585656 CAGAGGCTGGGGGAGGAGGGAGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1065565200 10:27001237-27001259 CAGAGTTAGGGGCTGGAGTCTGG + Intronic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1066350477 10:34632347-34632369 CAGAGGATGGGGCTGGATTCTGG - Intronic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1067060682 10:43076676-43076698 CAGCGGAAAGGGCAAAAGGCAGG + Intergenic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1067690521 10:48498557-48498579 CAAAGGATAGGGCAGGGGGCCGG - Intronic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1067839943 10:49667505-49667527 CTGAGGAAGAGGCTGGAAGCTGG + Intergenic
1068316522 10:55350994-55351016 GAGAGGGAGGGGGAGGAGACAGG - Intronic
1068863536 10:61870698-61870720 GAGAGGCAGGGCCCGGAGGCAGG + Intergenic
1069377121 10:67804463-67804485 AAGAGGCTGAGGCAGGAGGCTGG - Intronic
1069588984 10:69630389-69630411 CAGAGGCTGGGGCTGGCGGCCGG + Intronic
1069634334 10:69916323-69916345 TGGAGGAAGTGGCAGCAGGCTGG + Intronic
1069816025 10:71195080-71195102 AGGTGGAGGGGGCAGGAGGCTGG - Intergenic
1069829038 10:71271535-71271557 CAGAGGAAGGGTCTGGAGGGAGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069993469 10:72328903-72328925 CTGAGGAGGTGGCAGGAGGTTGG + Intergenic
1070083986 10:73216944-73216966 GATAGGCAAGGGCAGGAGGCAGG - Intronic
1070150276 10:73800986-73801008 CAGGGGGAGGGGCATGAGACGGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070781138 10:79138054-79138076 CAGCGGGAGGGGCAGGCGGCGGG + Intronic
1071275760 10:84053563-84053585 AGGAAGAAGGGGCAGCAGGCTGG + Intergenic
1071315527 10:84392186-84392208 TACTGGAAGGGGCAGGAGGGAGG + Intronic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071982146 10:91014228-91014250 AAGAAGAAAGGGCAGGAGCCTGG + Intergenic
1071997783 10:91163747-91163769 GGCAGGGAGGGGCAGGAGGCAGG + Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072400003 10:95087849-95087871 CAGAGGTAGGGGCAAGAGATGGG + Intergenic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1072645074 10:97247634-97247656 GAAAGGAAGGGAGAGGAGGCAGG + Intronic
1072696765 10:97609630-97609652 TATAGCCAGGGGCAGGAGGCAGG - Intronic
1072766302 10:98097567-98097589 CAGGGGATGGGGAAGCAGGCTGG - Intergenic
1072796281 10:98357242-98357264 CAGAGGCAGGGACCAGAGGCAGG + Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1072873681 10:99148864-99148886 CAGAGGGAAGGGCAAGAGGCAGG + Intronic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073502142 10:103949870-103949892 CAGTGGAAGGGGCAGGGGAAAGG + Intergenic
1073632412 10:105161991-105162013 CAGGGGCAGGGGCGGGAGGAGGG - Intronic
1074162652 10:110846880-110846902 AGGAGGAAGGGGCAGCAGGAAGG - Intergenic
1074221896 10:111446067-111446089 CAGAGGGAGGGTTAGAAGGCTGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074384592 10:113006891-113006913 AAGTGGGAAGGGCAGGAGGCTGG - Intronic
1074487393 10:113899107-113899129 AAGAGGAAGGGGCAGCGGGTTGG - Intronic
1074527924 10:114277851-114277873 AAGATGAGGGGGCAGGAGGAGGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074742340 10:116497403-116497425 CAGTGGAAGGGCCAGCAGGTTGG + Intergenic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1074899105 10:117801518-117801540 CAGAGGAAAGGGCAGCAGGGGGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075129444 10:119725911-119725933 CGGAGGAAAGGGCAGGAAGCGGG + Intergenic
1075148041 10:119899985-119900007 AGGAGGAAGGGGCAGGAGAAAGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075936931 10:126350919-126350941 CAGGGGAAGGGGCAGGGCTCCGG - Intronic
1075946834 10:126440503-126440525 GAGAGGAACCGGCAGTAGGCAGG - Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076371818 10:129960132-129960154 CTGGGGGAGGGGCGGGAGGCTGG + Intronic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076812923 10:132898565-132898587 CAGAGGGCAGGGCAGGGGGCGGG - Intronic
1076846590 10:133072248-133072270 CTGAGGAAGGGGCAGAAGCCTGG + Intronic
1076895013 10:133306681-133306703 CAGAGGCTGGGGCAGGAGAATGG + Intronic
1077063415 11:627294-627316 CGGCGGAGGGGGCGGGAGGCCGG - Intergenic
1077164795 11:1130175-1130197 CAGATGAAGGGGCCGGGGGAGGG + Intergenic
1077211657 11:1373904-1373926 CTCAGGAAGGGACAGGAGGGAGG + Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077353758 11:2105198-2105220 CAGAGGCAGGGGGTGGAGACTGG + Intergenic
1077648067 11:3944147-3944169 TAGAGGAAGGGGCCTTAGGCTGG + Intronic
1077874681 11:6294117-6294139 CAGGGGAAGGGGCAGGGGTGGGG + Intergenic
1078020855 11:7654962-7654984 GAGAAGGAGGGGCAGGAGGGAGG + Intronic
1078063250 11:8061698-8061720 TAGGGGCAGCGGCAGGAGGCAGG - Intronic
1078089584 11:8256457-8256479 CAGGGGAAGGGACAGGAGGGAGG + Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078391430 11:10938607-10938629 AAGAGGAAGGGGAAGGAGATGGG - Intergenic
1078622913 11:12925442-12925464 CAGAGGAGGGGCCTGGTGGCAGG - Intronic
1078932204 11:15921271-15921293 CAGAGGGGTGGGCAGAAGGCTGG - Intergenic
1078934668 11:15940525-15940547 CAGAGGAGGTGGCATGGGGCTGG + Intergenic
1079086797 11:17451894-17451916 CAGAAGAAGGGACAAGAGGAGGG - Intronic
1079089603 11:17471321-17471343 CAGAGGAGGTGGCACCAGGCTGG + Intronic
1079182271 11:18204320-18204342 CAGTGGCAGTGGCATGAGGCAGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079927887 11:26519075-26519097 CATAGGATGGGGCAGGATGAAGG - Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081539093 11:44017161-44017183 CAGAGGAAGGGACAGCAAGGTGG + Intergenic
1081660785 11:44887189-44887211 CAGAGGTTGGGGCATGGGGCAGG - Intronic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1081811474 11:45916614-45916636 GAGAGAAAGGGCCAGGAGGTGGG - Intronic
1082162526 11:48900684-48900706 GGGAGGCAGGCGCAGGAGGCAGG - Intergenic
1082238897 11:49852052-49852074 GGGAGGCAGGCGCAGGAGGCGGG + Intergenic
1082243246 11:49892278-49892300 GGGAGGCAGGCGCAGGAGGCGGG - Intergenic
1083196844 11:61093317-61093339 GAGGGCAAGGGGCAGGGGGCAGG + Intergenic
1083303123 11:61749088-61749110 CAGAGGCTGGGGCAGGAAGGTGG - Intergenic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083544477 11:63538336-63538358 GAGTGGCAGGGACAGGAGGCAGG + Intronic
1083605440 11:63975911-63975933 TAAAGGAAGGGACAGGAAGCAGG - Intronic
1083616367 11:64028482-64028504 GGAAGGAAGGAGCAGGAGGCAGG + Intronic
1083648369 11:64186140-64186162 GCGAGGAAGGGGCGGGAGCCGGG + Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1083770367 11:64863771-64863793 CAGAGTCAGTGGCAGGGGGCGGG - Intronic
1083812790 11:65115086-65115108 GTCAGGAAGGGGCAGCAGGCTGG + Intronic
1083903421 11:65654848-65654870 CAGGGGCAGGGGCTGGAGCCTGG + Exonic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1083976419 11:66125189-66125211 CGGGTGAAAGGGCAGGAGGCAGG + Intronic
1084025009 11:66442582-66442604 AAGATCAAGGGGCAGCAGGCGGG - Intronic
1084051504 11:66603166-66603188 CACAGGCAGGGGCAATAGGCAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084363951 11:68685708-68685730 CAGGCGGAGGGGCAGGAGCCAGG - Intronic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1084483414 11:69434795-69434817 CAAAGGCAAAGGCAGGAGGCTGG + Intergenic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084495453 11:69500760-69500782 CAGAGGCAGGGCCAGGAGGGTGG - Intergenic
1084548244 11:69825234-69825256 CAGAGCCAGAGGCAGGAAGCTGG - Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084728173 11:70955631-70955653 CATAGGACAGGGCAGCAGGCTGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085276208 11:75301881-75301903 CCCAGGAGGGGGAAGGAGGCAGG + Intronic
1085304581 11:75477824-75477846 CAGGGGAAGGGTGAGGAGTCAGG + Intronic
1085311012 11:75516622-75516644 TGAAGGAAGGGGCAGGAGGCAGG + Intronic
1085318798 11:75562085-75562107 CAGAGGGAGGGGCCGGGGGCCGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086045253 11:82524820-82524842 GTGAGGAAGTGGCAGGAGGGAGG - Intergenic
1086143383 11:83523823-83523845 CAATGGCAGGGGCAGGGGGCGGG + Intronic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1086455480 11:86955543-86955565 CGGAGGAGGGGGCCGGAGGGCGG - Intergenic
1086697671 11:89864101-89864123 GGGAGGCAGGCGCAGGAGGCGGG - Intergenic
1086708488 11:89980387-89980409 AGGAGGCAGGCGCAGGAGGCGGG + Intergenic
1086728865 11:90223143-90223165 CGGAGGTAGCGGCGGGAGGCTGG + Exonic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087236738 11:95727706-95727728 GAAAGCAGGGGGCAGGAGGCAGG + Intergenic
1087822400 11:102727250-102727272 CTGCCGAAGGGGCAGGAGGGAGG - Intergenic
1088084910 11:105965807-105965829 CAGAGGAAGGGGCTGCAGGATGG + Intronic
1088254667 11:107891969-107891991 CAGAGGCTGAGGCAGGAGACTGG - Intronic
1088582727 11:111331302-111331324 GGGAGGGAGGGGCAGGAGGAGGG - Intergenic
1088916362 11:114230907-114230929 TGGAGGCAGAGGCAGGAGGCAGG - Intronic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089173725 11:116533775-116533797 CTGGGGGAGAGGCAGGAGGCTGG - Intergenic
1089194804 11:116688018-116688040 CATGGGCAGGGGCAGGAGGGAGG + Intergenic
1089209238 11:116789425-116789447 CAGAGGGAGGGGCTGGAGATGGG + Exonic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089614293 11:119686595-119686617 GAGAGGAAGTGGCTGGAGGTTGG - Intronic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1089689860 11:120180584-120180606 CAGAGCTTGGGGCAGGAGCCTGG + Intronic
1089747617 11:120628222-120628244 CAGATGAAGGGCCAGGTGACAGG - Intronic
1089876800 11:121730227-121730249 GAGAAGAAGGGACAGGAGGAGGG - Intergenic
1089943221 11:122440952-122440974 CTGAGGAAGAGCCAGGAGGGGGG - Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090429972 11:126637474-126637496 CAGAGGCTTGAGCAGGAGGCTGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090460312 11:126885720-126885742 CAGAGCAGAGGGCAGCAGGCTGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090880410 11:130827721-130827743 CAGAGAAACAGGCAGGAAGCAGG - Intergenic
1090908331 11:131096632-131096654 CAGTGGCAGAGGCAGGAGCCTGG + Intergenic
1091063888 11:132490712-132490734 GAGAGGCTGGGGCAGGAGGATGG + Intronic
1091218868 11:133919192-133919214 CTGAGGAGGGGGCTGGAGTCCGG + Intronic
1091401206 12:181871-181893 TAGAGCAGGGGGCAGCAGGCGGG + Intergenic
1091410387 12:235267-235289 AAGCAGCAGGGGCAGGAGGCAGG + Intronic
1091410392 12:235280-235302 AGGAGGCAGGGGCAGGAGGCAGG + Intronic
1091454688 12:598345-598367 CAGAGGGAGGGCAAGGAGGAGGG - Intronic
1091490384 12:927380-927402 CAGGGGCACGGGCAGAAGGCTGG + Intronic
1091583236 12:1801159-1801181 CTGAGGCAGGGGCAGGGGGTGGG - Intronic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091729099 12:2866597-2866619 CAGTGGGAGGGGCCTGAGGCTGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091771709 12:3156361-3156383 GAGAGGGAGGGGCAGCAGGTGGG + Intronic
1091941913 12:4493229-4493251 CAGAGGAATGGGCAGAAGAATGG + Intronic
1092125935 12:6075115-6075137 CGGAGGCAGGGGCAGGACACGGG + Intronic
1092201101 12:6583385-6583407 CAGAGGGAGGGCCAGGACTCAGG + Intronic
1092204581 12:6607214-6607236 CTGAGGAAGGGGCGGGTGACGGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1092746501 12:11677274-11677296 CAGAGAGAGAGGCAGGAGGAGGG - Intronic
1092766390 12:11856653-11856675 GAGAGGAAGTAGCTGGAGGCAGG - Intronic
1092881714 12:12892072-12892094 AAGGGGCAGGGGCAGGAGGGAGG + Intronic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1095766488 12:45901273-45901295 CAGAGGATGAGGCAGGAGAATGG - Intronic
1095810984 12:46372911-46372933 CAGAGGGAGGGGCAGGGAGGCGG - Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096476205 12:51910783-51910805 CTGCGGGAGGGGCAAGAGGCAGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096572924 12:52534009-52534031 AAGAGAAAGGGGCAGGCTGCAGG + Intergenic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1096977794 12:55709290-55709312 CACAGGAAGAGGAAGGAGGTAGG - Intronic
1096984722 12:55748766-55748788 CAGGGGGAGGGGGCGGAGGCCGG + Exonic
1097040988 12:56155792-56155814 CAGAGGAAAAGGGATGAGGCGGG + Intronic
1097192528 12:57226303-57226325 CAGGGGCAGGGGCCGGGGGCAGG - Exonic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1098167151 12:67710342-67710364 CGCAGGAAAGGGCAAGAGGCTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098428294 12:70391045-70391067 TAGAGGAAGGGTGAGGGGGCTGG - Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1099547272 12:84000248-84000270 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
1100013423 12:89980481-89980503 GAGAGGAAGTTGGAGGAGGCTGG - Intergenic
1100982179 12:100170536-100170558 CAGGGGATGGGGCAGGCGGTTGG + Intergenic
1101357661 12:103995547-103995569 CAGAGGATTGGGGTGGAGGCAGG - Intronic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101911229 12:108861517-108861539 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102045254 12:109825807-109825829 GAGTGGATGGGGCAGGAGTCGGG + Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102225679 12:111226753-111226775 CAGAGGAATGGGCTGGCGTCTGG + Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1102484520 12:113246863-113246885 CAGAGGAAGGGGCTGGACTGGGG + Intronic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102720519 12:115012365-115012387 GAGAGGAAGGGGCTGGAGTTGGG - Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102991980 12:117322251-117322273 AAGAGGAAGGGAAAGGAGGGAGG - Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103126085 12:118423728-118423750 CAGAGGCAGGGGCTTGAGACAGG + Intergenic
1103437530 12:120938237-120938259 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103567256 12:121822997-121823019 CAGGGGAAGGGGCAGAGGGAGGG - Exonic
1103583911 12:121936919-121936941 AAGAGCAGGTGGCAGGAGGCAGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103845757 12:123901080-123901102 CAGAAGCATGGGCTGGAGGCTGG - Intronic
1103846268 12:123903797-123903819 CAGAGGCAGTGGGCGGAGGCTGG - Intronic
1103975635 12:124700948-124700970 AAGGGGAGCGGGCAGGAGGCTGG + Intergenic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104557357 12:129813002-129813024 AAGTGGAAGGCGCAGGAGTCGGG - Intronic
1104658008 12:130588202-130588224 CATGAGAAGGGGCTGGAGGCTGG - Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104771885 12:131368897-131368919 CAGAGGAAGGGGCATGGAGGAGG + Intergenic
1104786716 12:131455062-131455084 CAGGGGTGGGGGCAGGAGCCAGG - Intergenic
1104831881 12:131758015-131758037 CAGAGGGGCAGGCAGGAGGCTGG + Intronic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104846737 12:131850805-131850827 CAGCGGAAGGGGCTCGAGTCGGG - Intronic
1104861822 12:131928022-131928044 CAGTGCAAGAGCCAGGAGGCAGG - Intergenic
1105237276 13:18568508-18568530 CAGAGGCAGAGGCAGGAGAATGG + Intergenic
1105446577 13:20462200-20462222 GGGAGGAGGGGGCAGGAGGAGGG + Intronic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105834622 13:24198338-24198360 TACAGGAGTGGGCAGGAGGCTGG - Intronic
1105988530 13:25593672-25593694 GAGAGGAATGGGTAGGAGGAGGG + Intronic
1106079009 13:26485069-26485091 CAGAGGCAGAGGCAGGAGAATGG + Intergenic
1106079491 13:26488344-26488366 CAGAGGATGGGGGAGAAGTCAGG + Intergenic
1106208716 13:27621695-27621717 CGGCGGGAGGGGCAGGGGGCGGG - Exonic
1106593388 13:31116937-31116959 CAGAGGGAGAGGGAGGAGGGAGG + Intergenic
1106625881 13:31420670-31420692 GTGAGGAATAGGCAGGAGGCTGG - Intergenic
1106717852 13:32409666-32409688 GAGAGAAAGGGTCAGGAGCCGGG + Intronic
1106994943 13:35470739-35470761 CGGAGGAGGGCGCGGGAGGCAGG + Intronic
1107015811 13:35706882-35706904 GAGAGGAAGGGCCAGGGGACAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108830994 13:54478051-54478073 CAGAGGAAGGGATTTGAGGCAGG + Intergenic
1109346169 13:61117235-61117257 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1109912118 13:68927419-68927441 CAGAGGCTGAGGCAGGAGGACGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110830582 13:80026039-80026061 CAGAGGAAGGGGCATGCATCAGG - Intergenic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111011418 13:82320162-82320184 CAGGGGCAGGGGCAGGGGGGAGG - Intergenic
1112568018 13:100567973-100567995 CAAAGGAGGTGGCATGAGGCAGG + Intronic
1112682970 13:101788165-101788187 TGGAGGAGGGGGCAGGGGGCAGG - Intronic
1112759089 13:102672731-102672753 AAGAGGAGGGGGAAGGAGGGTGG + Intronic
1113105574 13:106768602-106768624 CACAGGAAGGGGCTGATGGCAGG - Intergenic
1113108421 13:106796348-106796370 CAGAGGAGGCGGCAGCAGGGAGG - Intergenic
1113439228 13:110314834-110314856 CACAGGGACGGGCAGGTGGCAGG + Intronic
1113499229 13:110760176-110760198 CAGAGGAGGAAGCAGCAGGCAGG + Intergenic
1113522663 13:110951628-110951650 TAACGGAAGAGGCAGGAGGCAGG - Intergenic
1113543084 13:111123878-111123900 CAGCCGCAGGGGCAGGGGGCGGG - Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113636605 13:111923293-111923315 CTGAGGAAGGGCCAGGGTGCCGG + Intergenic
1113727919 13:112618780-112618802 AAGAGCAAGGGGCCTGAGGCCGG + Intergenic
1113733511 13:112658965-112658987 GACAGGGAGGGGCAGGAGGTGGG - Intronic
1113765917 13:112881210-112881232 CAAGGGGAGCGGCAGGAGGCCGG - Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1113944431 13:114035900-114035922 CAGAGGCTGTAGCAGGAGGCTGG + Intronic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114236042 14:20824613-20824635 TAGAGGAAGGTGCAGGTGGTGGG + Intergenic
1114408808 14:22481504-22481526 AAGACGAAGGGGGAGGAGGAAGG + Intergenic
1114614933 14:24063272-24063294 CAGAGGAATGGGGAGAAAGCAGG - Intronic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115167461 14:30464873-30464895 GAGAAGGAGGGGCAGGAGGCAGG + Intergenic
1115591859 14:34873686-34873708 AAGAGGAAGGGGGAAGAAGCAGG - Intronic
1117029355 14:51652327-51652349 CAGCGGCGGGGGCGGGAGGCTGG + Intronic
1117376523 14:55123032-55123054 CAGAGGGACAGGTAGGAGGCAGG + Intergenic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117634887 14:57731438-57731460 CAGTGGAAAGGGCAGGTGTCTGG - Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1117763843 14:59059708-59059730 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117763853 14:59059727-59059749 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1120382305 14:83796267-83796289 CCGAGGAAGGGTGAAGAGGCAGG - Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120515639 14:85466221-85466243 CAGAGGCTGGGGCAGGGGGAGGG + Intergenic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121209782 14:92199600-92199622 CTGAGGAAGGGGGAGAAGCCTGG - Intergenic
1121301252 14:92873021-92873043 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121559356 14:94863035-94863057 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1121667839 14:95686285-95686307 AGGAGGAAGGGGGAGGAGGGAGG - Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122624653 14:103078195-103078217 CAGAGGAAGGGGAGGAAGGGAGG + Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122779585 14:104138158-104138180 CCGAGGAAGGGGCGGGACCCCGG - Intergenic
1122790651 14:104182918-104182940 CAGAGGGATGGGGAGGGGGCAGG - Intergenic
1122802885 14:104240510-104240532 CAGGGGGAGGGGAATGAGGCTGG - Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122889019 14:104724163-104724185 CAGGGGGCGGGGCAGGGGGCGGG - Intergenic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122971770 14:105155111-105155133 CAGAGGAAGGGGCTGCTGGCAGG - Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1123033686 14:105463135-105463157 AGCAGGAAGGGGCAGGAGGCAGG - Intronic
1123072649 14:105649232-105649254 GAGGGGAAGGGGTAGGGGGCAGG + Intergenic
1123098235 14:105776459-105776481 GAGGGGAAGGGGTAGGGGGCAGG + Intergenic
1202856922 14_GL000225v1_random:57772-57794 AAGAGGAAGGGGCAGGGCGAAGG - Intergenic
1123409768 15:20048509-20048531 CCCAGGGAGGGGCAGGAGGTGGG + Intergenic
1123519100 15:21055217-21055239 CCCAGGGAGGGGCAGGAGGTGGG + Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1123990172 15:25677639-25677661 CAGAGGAGGTGGCATCAGGCTGG + Exonic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124393473 15:29280490-29280512 AAGAGGAAGAGGCAGGATACAGG + Intronic
1124480515 15:30075191-30075213 AAGAGGAAGGGGCACCAGGTAGG - Intergenic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124583501 15:30983921-30983943 GATAGGATGGGGCAGGAGGAAGG + Intronic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1124619322 15:31265019-31265041 CACAGGGAAAGGCAGGAGGCAGG - Intergenic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125385940 15:39136504-39136526 CAGGGGAAGGGGGAGCATGCTGG - Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1126142813 15:45451488-45451510 CTGAGCCAGGGCCAGGAGGCAGG + Intergenic
1126427125 15:48539761-48539783 CAGAGAAAGTGTCAGGAGACAGG - Intronic
1126695701 15:51323669-51323691 CAGAGGAGGAGGCAGGGTGCTGG - Intronic
1126785777 15:52176952-52176974 CTGAGGAAGAGTGAGGAGGCAGG - Intronic
1127129180 15:55844190-55844212 GAGAGGAAGGGAAAGAAGGCAGG + Intronic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127877174 15:63121787-63121809 CGGAGGGAAGGGCAGGGGGCGGG - Exonic
1127901764 15:63346277-63346299 CTCAGGATGGGGCAGGAGACCGG - Intronic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1127960648 15:63887927-63887949 CAGGGGTAGGGTCAGGAGGAAGG - Intergenic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128061525 15:64738620-64738642 CACAGGCAGGGGCTGAAGGCTGG + Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128157663 15:65401997-65402019 GAGAGAAAGGGGCAGGGAGCAGG + Intronic
1128182225 15:65613985-65614007 GAGAGGAAGGGGCTGGAGCTTGG - Intronic
1128243279 15:66116025-66116047 CAGCGGGAGGTGCAGGTGGCTGG - Intronic
1128249104 15:66152376-66152398 GAGAGGAAGGGTGAGGAGGAGGG - Intronic
1128252418 15:66172470-66172492 CGGAGGGAGGGGCGTGAGGCTGG + Intronic
1128389252 15:67172203-67172225 CCGAGGAAGGGGCAGTAGGGAGG - Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128758013 15:70196375-70196397 CTGAGGAAGGGACAGCAGCCCGG + Intergenic
1128826031 15:70718242-70718264 CAGAGGAACGGGGGGGAGGGAGG + Intronic
1128961096 15:72005622-72005644 CAGAGGAAGAGGCAGGGGAAGGG - Intronic
1128997400 15:72306983-72307005 GAGAGGAAGGGTAAGGAAGCGGG + Intronic
1129187936 15:73921984-73922006 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
1129247256 15:74287034-74287056 TAGAGGAAAGGGCAGGGGACAGG + Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129288157 15:74541770-74541792 CAGGGGAATGGTCAGCAGGCCGG + Intronic
1129612345 15:77070854-77070876 CAGAGCGAGGGGCCGGCGGCGGG - Intronic
1129682154 15:77663970-77663992 CAGAGGCTGGGGCAGGACCCGGG + Intronic
1129878332 15:78991649-78991671 CTGAGGAAGCGGGGGGAGGCGGG + Intronic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130104200 15:80917278-80917300 AAGAGCTATGGGCAGGAGGCAGG + Intronic
1130112469 15:80977110-80977132 CAGAGGGAGAGGCAGCAGGAAGG - Exonic
1130426502 15:83806286-83806308 CAGAGAAAGGGCCACCAGGCTGG - Intronic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1130661356 15:85833722-85833744 AACAGGAAGGGGAAGGAGGGTGG + Intergenic
1130686360 15:86041210-86041232 AGGAGGAAGGGGCAGCAGGTGGG + Intergenic
1130721079 15:86386211-86386233 AGGAGGAAGGGGGAGGAGGGAGG - Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130841249 15:87703298-87703320 AAGAGGAAGGGTCGGGGGGCAGG - Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131694076 15:94856409-94856431 CAGGGCGAGGGGCCGGAGGCTGG + Intergenic
1132078598 15:98845404-98845426 AAGAGGGAGGGGGAGGAGGAGGG - Intronic
1132296358 15:100737549-100737571 CGGAGGCAGGGCCTGGAGGCTGG + Intergenic
1132371154 15:101300134-101300156 CCGAGGCAGGGACAGGGGGCAGG - Intronic
1132372023 15:101306063-101306085 CGGAGGACGGGCCTGGAGGCAGG + Intronic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132767623 16:1542419-1542441 TTGAGGAAGGGGCAGGACCCAGG - Intronic
1132786320 16:1658725-1658747 CATAGGAAGGGTCATGAGGTGGG + Intronic
1132788328 16:1670585-1670607 CAGCGGAAGGGTCCTGAGGCTGG - Intronic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1132890105 16:2199606-2199628 CAGAGGAAGGGGCTGCGGGCTGG - Intergenic
1133032593 16:3018304-3018326 CAGAGGGGGGCGCTGGAGGCTGG + Exonic
1133206468 16:4237173-4237195 CGGAGGCAGAGGCAGGAGGATGG - Intronic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1133897610 16:9944414-9944436 CAGAGGAAGGGGGAGGGAGGTGG - Intronic
1133907626 16:10036543-10036565 CAGAGGATGAGGCAGGAGAATGG - Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134057802 16:11181296-11181318 CAGAGGAAGAGCCAGGAGTGTGG + Exonic
1134279320 16:12803722-12803744 CAGAGCCAGGGGCAGGACCCTGG - Exonic
1134309394 16:13061957-13061979 CAGAGGAAAGGAGAGCAGGCCGG + Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134476871 16:14581621-14581643 TATAAGAAGGGTCAGGAGGCTGG + Intronic
1135120212 16:19759876-19759898 AAGAGGCTGAGGCAGGAGGCAGG + Intronic
1135340072 16:21637721-21637743 GAGAGGCACGGGCAGGAGCCGGG - Intronic
1135506301 16:23039775-23039797 AAGTAGAAGGGGCAGGTGGCAGG + Intergenic
1135615413 16:23907378-23907400 CAGAGGCTGAGGCAGGAGGATGG - Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1135892128 16:26366668-26366690 CAGAGGGAGAGGGAGGAGGGTGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135938051 16:26797764-26797786 AAGAGGCAGAGGCAGGAAGCTGG + Intergenic
1136060556 16:27723475-27723497 AAGCGCAAGGGGCAGGGGGCAGG - Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136165003 16:28447957-28447979 GAGAGGAAGGGGGAGGGGGAGGG - Intergenic
1136197964 16:28667023-28667045 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136214309 16:28781200-28781222 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136227554 16:28869228-28869250 CAGAGGGAGGGTCATGGGGCGGG - Exonic
1136259031 16:29061045-29061067 GAGAGGAAGGGGGAGGGGGAGGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136287866 16:29254731-29254753 CTGAGGGAGGGACTGGAGGCCGG - Intergenic
1136293489 16:29289494-29289516 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136450772 16:30353331-30353353 CAGAGGAGGGGGCAGTGGGTAGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137291583 16:47055377-47055399 CAGGAGCAGGGACAGGAGGCTGG + Intergenic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137444770 16:48525017-48525039 CAGAGGGAGGGGCAGGAGTGGGG - Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137759577 16:50929272-50929294 CAATGGAAGTGGGAGGAGGCAGG - Intergenic
1137811785 16:51359465-51359487 GAGAGGAAGGGTGAGGAAGCAGG + Intergenic
1137977809 16:53045906-53045928 CAGAGGCAGGGGCAGAAAGGGGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1138106457 16:54289534-54289556 GCGAGGAGGGGGCAGGAAGCGGG - Intergenic
1138201714 16:55093438-55093460 CAGAGGGGTGGGCAGGAGCCAGG + Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138437780 16:57015223-57015245 CACAAGAAGAGGCTGGAGGCCGG - Intronic
1138475060 16:57265729-57265751 TAAAGGACAGGGCAGGAGGCCGG + Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138583553 16:57956797-57956819 ACCAGGAAGGGGCTGGAGGCAGG - Intronic
1138608658 16:58105730-58105752 CAGAGGAGGGGCCAGGCTGCTGG - Intergenic
1138657333 16:58499045-58499067 CAGAGGAGGGGGCCCAAGGCTGG - Intronic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139250280 16:65488834-65488856 CAGAGGAAAGGACAGGTGGGAGG - Intergenic
1139352015 16:66342832-66342854 AAGAGGAACGGGGAGGTGGCGGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139425004 16:66873897-66873919 AGGAGGAGGGGGCAGGAGGAAGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1140354896 16:74297157-74297179 CTGGGGCAGGGGCGGGAGGCTGG - Intronic
1140481126 16:75263466-75263488 CAGAGGAAGGGGCACTGAGCAGG + Intronic
1141033079 16:80606554-80606576 CAGAGGAAGTGGCAAGAGTGAGG - Intronic
1141125098 16:81395505-81395527 CAGAGGACGGGAGAGGAGGGAGG - Intergenic
1141187056 16:81795625-81795647 CAGAGGATGGCTCAGGAGGTTGG + Intronic
1141202812 16:81910729-81910751 CTGAGGGTGGAGCAGGAGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141282802 16:82644331-82644353 CAGAGGGAGACGCAGAAGGCAGG - Intronic
1141326857 16:83068576-83068598 CAGAAGAATGGTCAGGTGGCTGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141440936 16:84029179-84029201 CAGAGGAAGGGACAGGTCCCGGG + Intronic
1141657207 16:85422611-85422633 GAGAGAAAGGGGCAGGAGAGAGG + Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141900400 16:86987036-86987058 CAGAGGAGGGGGCTGGGGCCAGG - Intergenic
1141930845 16:87201770-87201792 CACAGGCAGGGGCAGGAGCTTGG - Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142093519 16:88227434-88227456 CTGAGGGAGGGACTGGAGGCCGG - Intergenic
1142099369 16:88263500-88263522 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142157524 16:88539432-88539454 CAGAGGAAGGGGCCTCAGGAGGG - Intergenic
1142169001 16:88610542-88610564 CCGAGGGAGGGGCAGCAGGGAGG + Intronic
1142213395 16:88819195-88819217 AAGAGGCTGGGGCAGGTGGCCGG - Intronic
1142227204 16:88883360-88883382 CACAGGCAGAGACAGGAGGCGGG - Intronic
1142247420 16:88976396-88976418 CAGAGGCAGATGCTGGAGGCCGG - Intronic
1142248177 16:88979210-88979232 CAGAGGTGGGGGCAGCAGGAGGG + Intergenic
1142251140 16:88992628-88992650 CAGAGGAAGGCCAAGCAGGCCGG - Intergenic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1142466428 17:140017-140039 CAGAGGCAGCGGTATGAGGCGGG + Intergenic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142640222 17:1281089-1281111 CCCAGGAAGGGGCATGGGGCCGG + Intronic
1142665558 17:1461392-1461414 GAGAGGAAAGGGAAGAAGGCTGG - Intronic
1142666263 17:1465577-1465599 GAGAGGGATGGGCAGGAGGTGGG + Exonic
1142681843 17:1554494-1554516 CGGAGGCTGAGGCAGGAGGCAGG - Intronic
1142717941 17:1757344-1757366 CAGGGGAAGAGGCAGCAGCCCGG + Intergenic
1142864469 17:2782268-2782290 GGGAGGATGGGGCTGGAGGCTGG - Intronic
1142866989 17:2797249-2797271 CAGAGGGCCAGGCAGGAGGCTGG - Intronic
1142962379 17:3558855-3558877 CTGGGGAGGAGGCAGGAGGCAGG + Intergenic
1143177974 17:4967501-4967523 CGGGAGAAGAGGCAGGAGGCTGG + Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143399844 17:6637098-6637120 CAGAGGATGAGACAGGAGGTGGG - Intronic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143476751 17:7207524-7207546 CGGAGGTAGGGGGAGGAGGCGGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143614177 17:8039641-8039663 CACAGGAAGGGGTAGGGGACTGG + Intronic
1143622408 17:8088046-8088068 GAGAGGAATGGCCTGGAGGCTGG - Intergenic
1143679678 17:8467103-8467125 CAGACGGAGGGGCACGGGGCTGG - Exonic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143805709 17:9424454-9424476 CAGAGAGAGGGCCTGGAGGCAGG - Intronic
1143948416 17:10614434-10614456 GAGTGGAAGGGGCACGATGCAGG + Intergenic
1144221626 17:13105088-13105110 AAGAGGGAGGGGCAGGACGAAGG - Intergenic
1144298791 17:13903762-13903784 GAGGGGAAGGGACTGGAGGCTGG - Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144501117 17:15787135-15787157 GGGAGGCTGGGGCAGGAGGCTGG - Intergenic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144632603 17:16881739-16881761 CTGAGGTGAGGGCAGGAGGCAGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145077882 17:19870138-19870160 AAGAAGTGGGGGCAGGAGGCAGG + Intergenic
1146178115 17:30679608-30679630 CAGAGGAGGGGGGAGGACGGGGG + Intergenic
1146415250 17:32625864-32625886 CAAAGGGAGGGGCAGGTAGCAGG + Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146581257 17:34040287-34040309 CGGATTAAGGGGCCGGAGGCAGG - Intronic
1146926689 17:36750499-36750521 CTGAGGACGGGGCATGAGGCAGG - Intergenic
1147176197 17:38657701-38657723 CTGAGGTGGCGGCAGGAGGCTGG + Intergenic
1147378151 17:40035230-40035252 CTGCGGGAGGGGCTGGAGGCCGG - Exonic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147584704 17:41647635-41647657 CAGAGGCAGGGACAGGAAGCAGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147668126 17:42161578-42161600 CAGATGCAGGGGCAGGGGACAGG - Intronic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1147818825 17:43229607-43229629 CAGAGGCTGAGGCAGGAGGGTGG + Intergenic
1147832108 17:43304309-43304331 CAGAGGCTGAGGCAGGAGGGTGG + Intergenic
1147907588 17:43833036-43833058 CGGCGGGAGGGGCGGGAGGCCGG - Intronic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148528551 17:48366445-48366467 GAGAGGAAGGGGCAGAGGACGGG + Intronic
1148563542 17:48619961-48619983 CCCAGGATGGGGCAGGAGCCTGG + Intronic
1148592346 17:48825850-48825872 CACAGGATGAGGCAGGAGGTTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148698394 17:49574685-49574707 CAGATGGTGGGGGAGGAGGCTGG + Intergenic
1148778642 17:50109749-50109771 GAGAGGGAGGGGGAGGAGGCTGG - Intronic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1148857855 17:50588748-50588770 CAGAGTCAGGGCCAGCAGGCAGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149067414 17:52496613-52496635 TAGTGGTAGGGACAGGAGGCAGG - Intergenic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149519606 17:57308703-57308725 CAGAGGAAGAGAGAGCAGGCTGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150004676 17:61462484-61462506 AAGAGGGAGGGACAGGAGGACGG + Intronic
1150108499 17:62478850-62478872 CGGATTAAGGGGCCGGAGGCGGG + Intronic
1150129000 17:62656607-62656629 CAGAGGAGGTGCCTGGAGGCTGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150249046 17:63696118-63696140 GGGTGGAAGGGGCAGGAGGGTGG - Exonic
1150264313 17:63822013-63822035 CAGAGGAGCTGGCAGGAGTCAGG - Exonic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150485036 17:65537534-65537556 CCGAGGAGGGGGCAGGCGCCCGG + Exonic
1150583638 17:66498137-66498159 CGGGGCAGGGGGCAGGAGGCGGG - Intronic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150821198 17:68435812-68435834 CAGAGGAAGAGACAGGGAGCTGG - Intronic
1150932552 17:69601084-69601106 CAGAGGCAGAGGCAGGAGAATGG - Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151383257 17:73739963-73739985 CAGAGCCAGGGTCAGGAGGGTGG - Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151694509 17:75707328-75707350 CAGAGGAAGGGTGGGGTGGCAGG - Exonic
1151713514 17:75819836-75819858 CAGAGCAAGGGGCCTGAGCCAGG - Intronic
1151785206 17:76271988-76272010 CAGAGGGCGAGGCAGGAGGACGG - Intergenic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1151990721 17:77572371-77572393 CAGATGGAGGGGCAGGAGGAGGG - Intergenic
1152029339 17:77831996-77832018 ACGAGGCGGGGGCAGGAGGCGGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152112558 17:78365382-78365404 TAGAGGCAAGGGGAGGAGGCAGG + Intergenic
1152344273 17:79742004-79742026 CAGGGGCAGGGGCAGGGGGCCGG - Exonic
1152354070 17:79798174-79798196 CAGAGGATGGGGCGAGCGGCTGG + Intronic
1152356864 17:79811709-79811731 CAGAGGAAGGTGGTGGAAGCGGG + Intergenic
1152408255 17:80109442-80109464 CAGAGGAGGAGGTGGGAGGCAGG + Intergenic
1152534164 17:80940874-80940896 CAGAGGAAGAGGCAGGGTCCCGG - Intronic
1152587222 17:81194478-81194500 AGGCGGATGGGGCAGGAGGCTGG - Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152913077 17:83016606-83016628 AAGAGGAGGGGGGAGGAGGGAGG + Intronic
1152920566 17:83064490-83064512 CAGAGGGAGGGATCGGAGGCTGG + Intergenic
1152971590 18:167168-167190 GGGAGGCAGAGGCAGGAGGCAGG + Intronic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1154193270 18:12247656-12247678 CTGAGGACGGGGCAGGAGAGGGG + Intergenic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1155150402 18:23118347-23118369 CATTGGCATGGGCAGGAGGCTGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155930034 18:31697389-31697411 TAGAGGAAGGGGGAAGAGGGAGG + Intergenic
1156229690 18:35141233-35141255 AAGAGGAAGAGGAATGAGGCAGG - Exonic
1156626015 18:38909920-38909942 CGAAGGAAGGGGAAAGAGGCAGG + Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157302233 18:46487340-46487362 GAGGGAAAGGGGCAGGATGCAGG + Intronic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157468203 18:47966719-47966741 CAGAGGAAGGGCCTGGTGGGAGG + Intergenic
1157600772 18:48891937-48891959 GGGAGGAGGGGGCAGGAGGCCGG + Intergenic
1157773924 18:50375284-50375306 GGGAGGACGGGGCTGGAGGCTGG + Intronic
1157833967 18:50882101-50882123 CAGAGGCTGAGGCAGGAGGATGG - Intronic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158404790 18:57151522-57151544 CAAAGGAAGGCGCAGGAGAGAGG + Intergenic
1158525499 18:58209336-58209358 AGGAGGAGGGGGCAGGAGGAGGG - Intronic
1158618881 18:59013127-59013149 CGGGAGAAGGGGCAGGAGGGTGG - Intergenic
1159202591 18:65206629-65206651 CAGTGGAAGGGTGAGGAGGACGG - Intergenic
1159247278 18:65823822-65823844 CAGAAGTAGATGCAGGAGGCAGG + Intronic
1159676109 18:71286126-71286148 CACAGGATGGGACAGGAGGTCGG - Intergenic
1160153413 18:76412605-76412627 TAGAGGAAGGGAGGGGAGGCCGG + Intronic
1160211274 18:76882188-76882210 CAGAGGAAGAGGTAGAAGGAAGG - Intronic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160495514 18:79372179-79372201 GGGACGAGGGGGCAGGAGGCAGG - Intronic
1160495523 18:79372201-79372223 GGGACGAGGGGGCAGGAGGCAGG - Intronic
1160495532 18:79372223-79372245 GGGACGAGGGGGCAGGAGGCAGG - Intronic
1160495541 18:79372245-79372267 GTGACGAGGGGGCAGGAGGCAGG - Intronic
1160580905 18:79884245-79884267 CACAGGGAGGGGCGGGAGGAGGG - Intronic
1160608059 18:80066982-80067004 CAGAGGAGGGTGCTGGAGGGAGG + Intronic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160972119 19:1774175-1774197 TAGGGGCAGGAGCAGGAGGCAGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161273170 19:3401402-3401424 CAGAGGAGGGGGCAGAATCCAGG + Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161458279 19:4381026-4381048 CAGAGAGAGGGAGAGGAGGCCGG - Intronic
1161473193 19:4471597-4471619 TAGAGGAAGGGGCAGGCTCCGGG - Intergenic
1161572530 19:5038337-5038359 CAGAGGAGGGAACATGAGGCTGG + Intronic
1161644677 19:5445726-5445748 CAGAGGAGGAGGGAGGAGGGAGG + Intergenic
1161710055 19:5842700-5842722 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1161957949 19:7506691-7506713 CAGAGAAAGGGGGAGGAGCTTGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162180766 19:8867305-8867327 CAGATGAATAGGCAGGAGGATGG + Intronic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162211057 19:9092496-9092518 GAGAGGCTGTGGCAGGAGGCTGG + Intergenic
1162300714 19:9843289-9843311 CAGAAGGAGGGGCTAGAGGCTGG - Intronic
1162338141 19:10074208-10074230 CAGGGGAAGAGGGAGGAGACAGG - Intergenic
1162403718 19:10461325-10461347 GGGATGAACGGGCAGGAGGCGGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162747153 19:12805221-12805243 CTGAGGAAGGGGCATGAGCCTGG + Intronic
1162796884 19:13091706-13091728 GAGAGGAAGGGACAGCAGGCGGG + Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1162958978 19:14114980-14115002 CAGGGGCAGGGGCAGTAGCCAGG - Intronic
1163039612 19:14592563-14592585 GAGAGGAAGGGTCAGGAGATTGG + Intronic
1163047469 19:14654800-14654822 GACAGGGAGGGGCAGGAGGGAGG - Intronic
1163160505 19:15461389-15461411 CAGAGGCAGGGGCTGGAGGGAGG - Intronic
1163525779 19:17820551-17820573 CAGAGGCTGAGGCAGGAGGATGG + Intronic
1163566151 19:18052320-18052342 CAGAGGTGGGGGCTGGGGGCGGG + Intergenic
1163633911 19:18429802-18429824 CTGGGGGAGGGGCTGGAGGCGGG - Intronic
1163668449 19:18613819-18613841 CATGGGGAGGGGCAGGAGGAGGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1163879809 19:19908736-19908758 CAGAGGCTGAGGCAGGAGGATGG + Intronic
1164394441 19:27850990-27851012 CAGAGGAGCGGCCAGCAGGCCGG - Intergenic
1164426030 19:28142634-28142656 AAGAGGAAGGGAGAGAAGGCAGG + Intergenic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1165737020 19:38183337-38183359 CAGACGAAGGGGCGGGAGCAGGG + Intronic
1165794579 19:38511531-38511553 AAGAGAAAGGGACAGAAGGCAGG - Intronic
1165795804 19:38518494-38518516 CAGGGTAAGGGGCCAGAGGCTGG + Intronic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1165960866 19:39533196-39533218 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1166119031 19:40673880-40673902 GACAGAAAGGGGCAGGAAGCTGG - Intronic
1166260900 19:41640177-41640199 CTGAGGAATGGCCAGCAGGCAGG + Intronic
1166294862 19:41883987-41884009 CAAAGGAAGGGGCTGGGGGTGGG + Intronic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166371886 19:42306541-42306563 GGGAGGCAGAGGCAGGAGGCTGG - Intronic
1166546047 19:43635470-43635492 GGGAGGAAGGGGCTGGAGGCGGG - Intronic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167102817 19:47414724-47414746 GGGAGGCTGGGGCAGGAGGCTGG + Exonic
1167112323 19:47469703-47469725 GAGAGGGAGAGGCAGGAGCCAGG - Intronic
1167154734 19:47731036-47731058 GAGAGGAAGGGGTAAGAGGAAGG + Intronic
1167158773 19:47754775-47754797 CAGGGCGAGGGGCCGGAGGCTGG + Exonic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167295333 19:48646195-48646217 GAGAGGGAGGGGGAGGAGGGAGG - Exonic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167602899 19:50464946-50464968 GAGAGGCAGGGGCAGGTGGGTGG - Intronic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167611135 19:50508191-50508213 CAGAGGAAGGGACTGGCGGAGGG - Intronic
1167660773 19:50794821-50794843 GAGAGGCAGGGGCAGGTGGGCGG - Exonic
1167679214 19:50909222-50909244 CAGAGGTAGGGGGAGTGGGCAGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1167793819 19:51696205-51696227 CAGAGGGAGAGTCTGGAGGCCGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168100348 19:54138118-54138140 CAGAGGCGGCGGCAGGGGGCAGG - Intronic
1168110326 19:54188667-54188689 AGGAGGAAGGGGCTGGAGTCTGG - Intronic
1168252615 19:55149093-55149115 TGGGGGAGGGGGCAGGAGGCAGG - Intronic
1168334290 19:55588367-55588389 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925022192 2:580150-580172 CAGAGGGATGTGCAGAAGGCCGG + Intergenic
925027075 2:618535-618557 CAGAGGCAGGGGCTGGACACCGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925308909 2:2868131-2868153 CACGGGGAGGCGCAGGAGGCAGG - Intergenic
925360668 2:3278244-3278266 CAGCTGATGGGGCAGGATGCAGG - Intronic
925375656 2:3382817-3382839 CAGAGGCTGAGGCAGGAGGATGG + Intronic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
925931497 2:8711858-8711880 AAGAGGGAGAGGCTGGAGGCAGG + Intergenic
925948909 2:8893051-8893073 CAGAGGCAGGGGGAGGGGGTGGG + Intronic
926011959 2:9415651-9415673 CTGAGGAAGTGGCAGTAGGGAGG + Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926434939 2:12827993-12828015 CAGAGGAATAGGCAGGCAGCTGG - Intergenic
926633858 2:15160591-15160613 GAGGGGGGGGGGCAGGAGGCTGG + Intergenic
926704291 2:15825909-15825931 CATGGGAGGGGGCAGGAGGTGGG + Intergenic
927190199 2:20512156-20512178 CAGAGGCAGGGGCTGGAAACTGG - Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927282055 2:21317677-21317699 AGGAGGAAGGGGCAGAAGACAGG - Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927497775 2:23562348-23562370 CACGGGCAGCGGCAGGAGGCCGG - Exonic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
927842899 2:26456749-26456771 CAGAGGTAGGGGCAAGGGCCTGG - Intergenic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928124317 2:28605386-28605408 CAGATGAAGAGGCTGGAGTCAGG + Intronic
928245450 2:29622716-29622738 CAGAGGAGGGGTGAGGGGGCTGG - Intronic
928432166 2:31229189-31229211 AAGGAGAAGGGGCAGGAGACAGG + Intronic
928697001 2:33859454-33859476 CAGAGGAAGGGCCTGGTGGGAGG - Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929533586 2:42767157-42767179 CAGAGGAATGGGCAGGAGCGGGG + Exonic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
931671717 2:64653829-64653851 CGGAGGAGGAAGCAGGAGGCGGG + Exonic
931690859 2:64833837-64833859 CAGAGGAAGGGATAGGGGTCTGG + Intergenic
932002242 2:67895667-67895689 CAGAGGAAGGGGTTGGGGGTTGG - Intergenic
932143109 2:69296955-69296977 CAGAGGAGGGGGTACCAGGCCGG - Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
932323408 2:70838276-70838298 CATAGGAAGGGGCTGGAGCAGGG + Intergenic
932544070 2:72688540-72688562 CAGGGGCAGGGGCAGGGGGCAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
933837309 2:86256418-86256440 CAGAGGCAGTGGCTGGAGCCTGG - Intronic
933881130 2:86671062-86671084 TATAGGAATGGGCAAGAGGCTGG + Intronic
933949905 2:87319976-87319998 CAGAGGAAGAGGCAGGCTGTGGG + Intergenic
934052079 2:88219539-88219561 CAGAGGCATGGGCAGCAGCCTGG + Intergenic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934557895 2:95297042-95297064 CAGAGAAAGAGGCAGCGGGCAGG + Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934588553 2:95526794-95526816 GGGAGGCAGGCGCAGGAGGCGGG + Intergenic
934663203 2:96154041-96154063 CAGGGGCAGGGGCAGGACTCAGG + Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934949163 2:98564545-98564567 CAGAGGAAGGGGGCGGTGGGGGG + Intronic
935032511 2:99336397-99336419 CAGAGGAAGGGGCGGGCGGTCGG + Exonic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935161506 2:100533415-100533437 GGGCGGCAGGGGCAGGAGGCAGG - Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
935571432 2:104664976-104664998 AAGAGAAAGAGGCAGGGGGCCGG + Intergenic
935702570 2:105825086-105825108 GAGAGGAGGAGGCAGGAGCCAGG - Intronic
936092909 2:109512402-109512424 CTCAGGAGGGGGCAGGAGGGTGG - Intergenic
936330287 2:111541621-111541643 CAGAGGAAGAGGCAGGCTGTGGG - Intergenic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936518708 2:113198666-113198688 CACAGGAGGGGGCGGGAGGAGGG + Intronic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937132465 2:119523893-119523915 CAGAGGAAGGGGTCGGTGGTGGG + Intronic
937208755 2:120253494-120253516 GAAAGGAAAGGGGAGGAGGCTGG - Intronic
937287495 2:120762511-120762533 CACAGGAAGGGGCAGGTCCCAGG + Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937457576 2:122055769-122055791 GAAAGGAGGGGGCAGGGGGCGGG - Intergenic
937989867 2:127656328-127656350 CAGAGGCTGGGCCAGGAGGCTGG - Intronic
938145723 2:128833514-128833536 CAGAGGAAGGCGTGGGAGGAGGG + Intergenic
938425372 2:131182075-131182097 AAGAGGAGGGGGGAGGAGGGAGG + Intronic
938512501 2:131966005-131966027 CAGAGGCAGAGGCAGGAGAATGG - Intergenic
938763542 2:134445436-134445458 CAAGGGAAGGGGCAGGAGGGAGG + Intronic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
940011538 2:149060032-149060054 AGGAGGAGGGGGCAGGAGTCAGG + Intronic
940125203 2:150315068-150315090 CAGAGGATGAGGCAGGAGAATGG - Intergenic
940141769 2:150499376-150499398 CAGGGGAAAGGGTGGGAGGCAGG - Intronic
940418965 2:153456106-153456128 CACATGATGGGGCAGGGGGCGGG + Intergenic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
941003168 2:160222047-160222069 CAGAGCCAGGGGGAGTAGGCAGG - Intronic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941597605 2:167497220-167497242 CAGAGGAAGGGAAATGAGGGGGG + Intergenic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942217752 2:173738738-173738760 TAGGGGAAATGGCAGGAGGCAGG + Intergenic
942299629 2:174548906-174548928 GAGAGGCAGGGGCAGGAACCGGG - Intergenic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
942761513 2:179404108-179404130 CAGAGGAAGGGGTAGGATATGGG - Intergenic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944183961 2:196927051-196927073 CGGGGGATTGGGCAGGAGGCGGG + Intronic
944547449 2:200812047-200812069 CAGAGGGAGAGGGAGGCGGCGGG + Intronic
944748342 2:202681753-202681775 CAGTGATAGGGACAGGAGGCAGG + Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
945061794 2:205915805-205915827 TGGAGGAAGGGGCAGGAGCCAGG - Intergenic
945273196 2:207962209-207962231 TCCAGGAAGGGGAAGGAGGCTGG + Intronic
945976802 2:216277489-216277511 GATGGGAAGGGGGAGGAGGCAGG - Intronic
945984671 2:216344005-216344027 CAGAGGATGGGGCAGGGGAGAGG + Intronic
946006998 2:216533781-216533803 CCCAAGCAGGGGCAGGAGGCTGG - Intronic
946164139 2:217853582-217853604 AAGAGGAATGGGCAGGACACTGG - Intronic
946226486 2:218266595-218266617 GGGAGGAAGGGGCAGCAGGGAGG + Intronic
946373857 2:219296717-219296739 CAGAGGTGGGGGCTGGAGTCAGG + Intronic
946416866 2:219544117-219544139 AAGGGGAAGGCGCAGGAGCCGGG - Intronic
946492935 2:220167649-220167671 GAGAGGCTGGGGCAGGAGGATGG - Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947550760 2:231044401-231044423 CAGAGGCTGAGGCAGGAGGATGG + Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947619552 2:231580809-231580831 TGGAGGAAGGGGGAGGACGCGGG + Intergenic
947713562 2:232329151-232329173 CAGAGGACAGGGCAGGAGTGGGG - Intronic
947745012 2:232502971-232502993 CAGAGGCGGGGGCGGGAGGGAGG + Intergenic
947947687 2:234120570-234120592 CAAAGGAAGGGGGAGGCTGCTGG + Intergenic
947956630 2:234197636-234197658 AAGAGGAAGGGACTTGAGGCTGG + Intergenic
948229954 2:236342284-236342306 CAGAGGCCGGGGCAGGTGGGAGG + Intronic
948310404 2:236981538-236981560 CAGAGGATGGGGCCCGTGGCTGG - Intergenic
948423419 2:237874187-237874209 GAGAGGAAGGCCCAGTAGGCTGG + Intronic
948448571 2:238053784-238053806 GACAGGAATGGGCAGGAGGAGGG + Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948598876 2:239096940-239096962 CAGGGCAGGAGGCAGGAGGCAGG + Intronic
948662002 2:239513349-239513371 CAGGCGAAGGGGGAGCAGGCAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948702631 2:239769801-239769823 CAGAGGCAGGGGCAGAGTGCAGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948887700 2:240892353-240892375 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
948983835 2:241508374-241508396 CAGAGGGAGGGGCCCGGGGCGGG - Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169110539 20:3030214-3030236 GAGAGTAAAGGGCAGGGGGCAGG + Intronic
1169210792 20:3765305-3765327 CACAGGAGGAGGCTGGAGGCAGG - Intronic
1169277829 20:4245446-4245468 AAGAGGAAGGGACAGGAGGAGGG + Intronic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169486493 20:6038568-6038590 CAGAGAAGGGGGCATGTGGCTGG + Exonic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170714100 20:18817287-18817309 GAGATGGAGGGGCAGGAGCCTGG + Intronic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171184834 20:23117868-23117890 CTGGGGAGGGGTCAGGAGGCAGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171347879 20:24479515-24479537 CAGAGGAAGGGGCATGGGAAGGG - Intronic
1171451147 20:25237063-25237085 CTGAGGAGGGCCCAGGAGGCAGG + Intergenic
1171484356 20:25476663-25476685 CTGAGGAGGCGGCAGGAGCCGGG - Exonic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172021804 20:31919938-31919960 GGGAGGAAGGGGGAAGAGGCAGG - Intronic
1172094621 20:32454599-32454621 CCGAGGCAGGGGCAGGAGACAGG - Intronic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172766619 20:37354583-37354605 CAGGGGCAGGGGCAGGGGCCGGG + Intronic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172925049 20:38526353-38526375 AAGAGAAAGAGGCAGGAGGAAGG - Intronic
1172950858 20:38722820-38722842 GGGAGGAGGTGGCAGGAGGCGGG + Intergenic
1172974030 20:38893568-38893590 GGGAGGAAGTGGGAGGAGGCGGG + Intronic
1173192573 20:40887534-40887556 GAGAGGAAGGGGCAGGGGTGGGG - Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173470560 20:43320367-43320389 CAGACAGAAGGGCAGGAGGCAGG - Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173748115 20:45453530-45453552 GAGAGGAGGGGGTAGGAGGTAGG + Intergenic
1173791940 20:45833768-45833790 GAGCGGGCGGGGCAGGAGGCGGG + Intergenic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1173928451 20:46798508-46798530 CTGAGAGAGAGGCAGGAGGCAGG - Intergenic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174124075 20:48289781-48289803 CAGAGGAGGGGCCGGGAGTCGGG + Intergenic
1174147004 20:48459084-48459106 CAGGGGAAGGGCCAGGGGACAGG + Intergenic
1174266508 20:49335856-49335878 CACCGGAAGTGGCAGGAGTCCGG - Intergenic
1174452671 20:50629540-50629562 CACAGGACGGGGCAGCAGGCAGG + Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174524329 20:51159192-51159214 CAGTGAAAGGGGCTGGATGCAGG - Intergenic
1174634878 20:51990357-51990379 CAGAGGAAGACCCAGGAAGCTGG - Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175745204 20:61451706-61451728 AGGAGGAGGGGGTAGGAGGCTGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175773089 20:61635864-61635886 CAGAGCAGGGGGCAGGACACAGG + Intronic
1175795406 20:61767511-61767533 CAGAGAGAGGGGCAGGAGCAGGG + Intronic
1175815834 20:61882819-61882841 GATAGGAAGGGGCGGGGGGCTGG - Intronic
1175867083 20:62184625-62184647 TGGAGGCAGGAGCAGGAGGCCGG - Intronic
1175956245 20:62610902-62610924 GGGTGGGAGGGGCAGGAGGCTGG + Intergenic
1176038619 20:63052527-63052549 CAGAGGAAGAGGCAGAAAGGAGG + Intergenic
1176090533 20:63316475-63316497 GGGAGGAAGGGGCAGGAGCGGGG - Intronic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176178004 20:63737707-63737729 CGCGGGAAGGGGCTGGAGGCAGG + Intronic
1176195576 20:63835226-63835248 CAGAGGGAGAGGCAGAGGGCAGG + Intergenic
1176285391 21:5016571-5016593 CAGAGGAAAGGACAGGACTCTGG - Intergenic
1176513682 21:7767407-7767429 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1176781262 21:13196790-13196812 CAGAGGCAGAGGCAGGAGAATGG + Intergenic
1177329310 21:19635656-19635678 CAGGGGAAGGGGTACGAGGTGGG + Intergenic
1177482567 21:21709748-21709770 GAGAGAAAGGGTCAGAAGGCAGG + Intergenic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178374321 21:32054459-32054481 CAGAGGAAGAGACAGGAGTGAGG - Intergenic
1178647795 21:34397931-34397953 GAGAGGGAGGGGGAGGGGGCAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178931114 21:36820132-36820154 CAAAGGAAGGGGCAGGGCCCAGG + Intronic
1179068149 21:38045855-38045877 CAGAGGAAGGGGCTGAACTCAGG + Intronic
1179266440 21:39807607-39807629 CAGAGTGTGGGGCAGCAGGCTGG + Intergenic
1179478753 21:41664773-41664795 CAGAGGAGGTGACAAGAGGCCGG + Intergenic
1179627290 21:42655864-42655886 CACAGCAAGGGGCAGAGGGCGGG - Intronic
1179649293 21:42796406-42796428 AAGAGGCAGGGGCTGGAGGGAGG + Intergenic
1179653548 21:42830964-42830986 CACAGGAAGGTGCTGGAGCCAGG - Intergenic
1179715137 21:43282481-43282503 GAGAGGTGGGGGCAGCAGGCAGG + Intergenic
1179727792 21:43350136-43350158 GAGAGGAGGGGGGAGGGGGCGGG - Intergenic
1179871790 21:44246904-44246926 CAGAGGAAAGGACAGGACTCTGG + Intronic
1179987118 21:44928065-44928087 CAGAGGAAGGCAGAGGAGGGAGG - Intronic
1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG + Intronic
1180007860 21:45031566-45031588 CAGAGGACGGGGTCAGAGGCTGG + Intergenic
1180010930 21:45050707-45050729 CAGGGGACGGGGCGGGAGCCAGG + Intergenic
1180042329 21:45287193-45287215 CAGGGGCAGGGGCAGGGGCCGGG - Intronic
1180235618 21:46458012-46458034 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1181023618 22:20115854-20115876 CAAAGGAGGGGTCAGGAGCCTGG - Intronic
1181171735 22:21013920-21013942 CCGAGGAGAGGGCAGGGGGCTGG + Intronic
1181412987 22:22738001-22738023 TGGAGGATGGTGCAGGAGGCGGG + Intronic
1181508999 22:23380545-23380567 GAGGGGCAGGGGCAGGAGGAGGG - Intergenic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181539593 22:23566272-23566294 GAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1181732839 22:24859936-24859958 CAGAGGAGGGGGCAGAAGCAGGG - Intronic
1181999890 22:26911629-26911651 GAGAGGAAGGGCCAGAAGGATGG - Intergenic
1182010852 22:26999548-26999570 AAAAGGCAGGGGCAGGAGGCAGG - Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182457541 22:30461484-30461506 CAGGGGGAGGGGGAGGAGACAGG + Intronic
1182659321 22:31914159-31914181 CACAGGAAGGGGCAAGTGACAGG - Intergenic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183092054 22:35529137-35529159 CAGAGGAAAGGGCAGCAGAGGGG - Intergenic
1183095430 22:35549147-35549169 CCGGGGCAGGGGCAGGAGCCTGG - Intronic
1183277884 22:36912594-36912616 CAGGAGAAAGGGCAGCAGGCAGG - Intergenic
1183508178 22:38220749-38220771 AGGGGGAAGGGGCATGAGGCAGG + Exonic
1183520878 22:38295408-38295430 CACAGGGAAGGGCAGGGGGCTGG + Intronic
1183546661 22:38457767-38457789 AGGAGGAAGGGGCAGGAAGGAGG + Intergenic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183650289 22:39149707-39149729 CAGGGGAGGGGGCAAAAGGCAGG + Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183688658 22:39376048-39376070 CAGAGGAAAGCCCAGAAGGCTGG - Exonic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183924238 22:41194508-41194530 GAGAGGCAGAGGCAGGAGGATGG + Intergenic
1183985619 22:41568683-41568705 CTCAGGCAGGGGCAGGAGACAGG - Intronic
1184189552 22:42885736-42885758 AGGAGAAAGGGGCAGGAGTCAGG - Intronic
1184254691 22:43280412-43280434 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184254739 22:43280535-43280557 GAGGGGAAGGGACAGGAGGATGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184417186 22:44359206-44359228 CAGAGCCAGGGGGAGGTGGCGGG + Intergenic
1184422822 22:44391723-44391745 GAGAGGAAGGGGCTGCAGGTGGG - Intergenic
1184429615 22:44434229-44434251 GAATGGAAGAGGCAGGAGGCAGG - Intergenic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184523948 22:45010363-45010385 CAGAGGGAGGCGGAGGAGGGGGG - Intergenic
1184545910 22:45167460-45167482 TAGTGGAAGGGGCAGGAGTTGGG - Intronic
1184552476 22:45211923-45211945 CAGACGCAGGGGCAGGGGCCGGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184631550 22:45784590-45784612 CGGGAGAAGGGACAGGAGGCTGG + Intronic
1184723725 22:46331099-46331121 AAGAGGATGGGCGAGGAGGCCGG + Intronic
1184751049 22:46487008-46487030 AAGTGGAGGGGGCAGGGGGCGGG - Intronic
1184844354 22:47072126-47072148 CAGAGGCATGGCCAGGACGCTGG + Intronic
1184935318 22:47716579-47716601 CAGAGGAAGGGCCTTGATGCCGG - Intergenic
1184992733 22:48181798-48181820 AACAGGAAGGGACTGGAGGCCGG - Intergenic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
1185085796 22:48740373-48740395 CACAGGGAGGGGCCGGAGTCTGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185143591 22:49117278-49117300 CAGGGGCAGGGGCAGGGGTCGGG + Intergenic
1185243008 22:49756430-49756452 AACAGGAAGGGGCCGGGGGCTGG - Intergenic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185270232 22:49926592-49926614 GGGAGGGAGGGGCAAGAGGCAGG - Intronic
949128368 3:472615-472637 CAAATGAAGGGGCAGCAAGCAGG - Intergenic
949930568 3:9074977-9074999 CAGAGGAAGAGACAGGTGGGGGG + Intronic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950032174 3:9860490-9860512 GGGAGGAAGGGGGAGGTGGCAGG - Intergenic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950279829 3:11697203-11697225 CAGAGGCTGAGGCAGGAGGATGG - Intronic
950530281 3:13549065-13549087 CAGGGGAGGGGGCCGGGGGCCGG + Intergenic
950536864 3:13583841-13583863 TAGAGGACGGGGCTGGAAGCAGG - Intronic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
950779775 3:15381388-15381410 GAGAGGAAGGGGGAAGAGGGAGG + Exonic
951425103 3:22535495-22535517 AGGAGGAAGGGGCAGGAAGCAGG + Intergenic
951441767 3:22731715-22731737 GAGAGGTGGGGGCAGGAGACAGG + Intergenic
951535184 3:23734156-23734178 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
951896144 3:27611647-27611669 CATAGGAAGAGGCAGCAGGCAGG + Intergenic
951923906 3:27886494-27886516 CAGGGGTGGGGGCAGGAGGGAGG - Intergenic
952312157 3:32199957-32199979 AAGAGGAAGGGGAAGGAGAGAGG + Intergenic
952331336 3:32367032-32367054 CAGAGGAAGGGGTAGGGGAAAGG - Intronic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
952612396 3:35226606-35226628 CAGAGGAACGATCAGGCGGCAGG + Intergenic
952963470 3:38607136-38607158 CAGAGGAAGAGACATGAGCCAGG - Intronic
952981474 3:38739417-38739439 GAGAGGAAGGGGGAGCTGGCTGG + Intronic
953365436 3:42340485-42340507 GAGGGGAAGGGGGAGGAGGGGGG + Intergenic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953737734 3:45510692-45510714 CAGAGGGAGTGGCAGGGGACAGG + Intronic
953827904 3:46270194-46270216 TAGAGGAGGGGTCAAGAGGCAGG - Intergenic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954133391 3:48571058-48571080 CAGTTGTAGGGGCAGCAGGCCGG - Intronic
954218223 3:49136159-49136181 CAGGTGAAGGGCCAGGAGGCTGG - Intergenic
954331279 3:49891710-49891732 CAGAGGGAGGGGCCTCAGGCTGG - Intronic
954394718 3:50287447-50287469 CACAGGAGGAGCCAGGAGGCTGG - Exonic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
954619212 3:51986178-51986200 CACAGGCAGGGCCAGCAGGCTGG - Intronic
954659424 3:52219040-52219062 CAGGGGCAGGGACAGGAAGCTGG - Intergenic
954712522 3:52512226-52512248 CAGAGCAAGGGGCAGGGGCTGGG + Intronic
954714401 3:52519948-52519970 TCGAAGCAGGGGCAGGAGGCCGG - Exonic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
956084139 3:65591739-65591761 CAGAGGAACAGCAAGGAGGCCGG - Intronic
956345245 3:68271128-68271150 GAGAGGAAGGGGGAAGGGGCAGG - Intronic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
958822285 3:98989173-98989195 CAGTGGCAGGGTCAGGAGGGAGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959344952 3:105182298-105182320 CAGAGGATGAGGCAGGAGAATGG - Intergenic
960120817 3:113947742-113947764 AGGAGGCAGGGGCAGGAGGTGGG - Intergenic
960248759 3:115428777-115428799 GAGAGGAAGGGGGAAGAGGGAGG - Intergenic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
960641319 3:119826432-119826454 TTGTGGAAGGGGCATGAGGCAGG + Intronic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960706368 3:120485940-120485962 CAGAGGCTGGGGCAGGAGAAGGG - Intergenic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961000569 3:123371544-123371566 CAGGGGAAGTGGCACGCGGCCGG + Intronic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961463841 3:127069752-127069774 GAGAGGGAGAGGCAGAAGGCAGG + Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961525218 3:127492513-127492535 CAGTGGAAGGGGCTGAAGACTGG + Intergenic
961528818 3:127526920-127526942 CAGAGGAGGAGCCTGGAGGCTGG - Intergenic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962367647 3:134796623-134796645 CGGGGGAAGGGGCGGGAGGCGGG - Intronic
962478441 3:135778120-135778142 CACAGGAAGGGGTAGGAGATGGG + Intergenic
962495889 3:135938415-135938437 CAGAGCAAGGGCTAGCAGGCTGG - Intergenic
962676237 3:137760671-137760693 GAGAGGAGGGGGCCGGAGGGTGG + Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
962868353 3:139466508-139466530 CAGAGGAACTGGCAAGAGGCTGG + Intronic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963533231 3:146497300-146497322 GAGAGGCACGGGCAGGAGCCAGG + Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
964480398 3:157133349-157133371 AAGAGGAGGGGGCAGGTGCCAGG + Intergenic
964669580 3:159210058-159210080 CAGAGGAAGGGACAGTTGGGTGG + Intronic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
966439643 3:179929687-179929709 CAGGGGCAGGGGCATTAGGCAGG - Intronic
966831845 3:184017137-184017159 CAGACGGAGAGGCTGGAGGCAGG - Intronic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
966944149 3:184765882-184765904 CAGAGGAGGTGGCTGGTGGCAGG + Intergenic
967069752 3:185952475-185952497 CAGAGAAAGGGAGAAGAGGCGGG + Intergenic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967279241 3:187806253-187806275 GAGACAGAGGGGCAGGAGGCAGG - Intergenic
967406463 3:189120902-189120924 CAGAGGAATGTGCAGGAAGTGGG + Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
968006708 3:195247962-195247984 CAGAGGAAGGGCCTGGTGGGAGG - Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968554301 4:1239492-1239514 CAGCGGATGGGGCGGGAGACTGG - Intronic
968565555 4:1310805-1310827 CGAAAGCAGGGGCAGGAGGCGGG - Intronic
968591994 4:1463985-1464007 CAGAGGCAGTGGCAGGAGTGAGG - Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968654513 4:1772773-1772795 CAGAGGGAGGGGCATGGGGTGGG - Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968740723 4:2330526-2330548 CAGAGGAAGGGACAGCATGGAGG + Intronic
968762877 4:2451413-2451435 CAGAGGAGGGGCCTGGGGGCTGG + Intronic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969078353 4:4598811-4598833 GTGAGGAGTGGGCAGGAGGCTGG + Intergenic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969457455 4:7308293-7308315 CAGCAGAAGGGGCAGGGGGTTGG - Intronic
969465088 4:7351636-7351658 GAGAGGAAGGGATAGGAGGAGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969575128 4:8032299-8032321 CACGTGGAGGGGCAGGAGGCAGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
970092555 4:12426887-12426909 AAGAGGAAGGTGCAGGCGGTGGG + Intergenic
970150595 4:13085550-13085572 CAGATGATGAGGCAGGAAGCAGG - Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971465024 4:26948332-26948354 CACAGGGAGGGGCTGGAGGTAGG - Intronic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
971839565 4:31834007-31834029 CAGAGGCTGAGGCAGGAGACTGG - Intergenic
971917371 4:32890350-32890372 CATAGACAGGGGCAGGAGGTCGG + Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972731694 4:41801205-41801227 CTGAGGAAGTGGCAGAACGCAGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
973058215 4:45687050-45687072 CGGAGGAAGGGGGAAGAAGCAGG + Intergenic
974292783 4:59955172-59955194 CAGAGGCTGGGACTGGAGGCAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974395798 4:61333699-61333721 CAGAGGCTGAGGCAGGAGGATGG - Intronic
975669471 4:76766427-76766449 CAGAGGATGAGGTGGGAGGCAGG + Intronic
975836648 4:78429358-78429380 CATAGAAATGGGCAGGAGGAAGG - Intronic
976096637 4:81515341-81515363 CAGAGGGGAGGGCAGGAGCCAGG + Intronic
976384111 4:84435281-84435303 TAGATGAAGGGGTAGAAGGCTGG + Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
977709990 4:100113912-100113934 GAGAAGAATGGGCAGGAGACAGG - Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978153960 4:105468650-105468672 GAGATGAATGGGTAGGAGGCTGG + Intronic
978314224 4:107418001-107418023 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
978436212 4:108687188-108687210 GAGAGGAAAGGCCATGAGGCAGG - Intergenic
978577171 4:110199016-110199038 CAGAGGTAGGGCGAGGAGGTGGG - Intronic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
981170284 4:141615511-141615533 GAGAGGTGGGGGCGGGAGGCAGG + Intergenic
981615254 4:146638493-146638515 AAGCGGGAGGGGCTGGAGGCTGG + Intergenic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
982701684 4:158664667-158664689 CAGTGGAAGGGCCAGCAGGTCGG - Intergenic
982806911 4:159777401-159777423 CAGAGGTGGGGGCAAGAAGCAGG - Intergenic
983249460 4:165327793-165327815 GCGAGGAAGGGGGAGCAGGCGGG + Intronic
983648082 4:170011989-170012011 CAGAGGAGGGGGAAGTAGGTTGG + Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
983946259 4:173589082-173589104 CAGAGGCAGGGGCAGAAGGAAGG - Intergenic
984159844 4:176238427-176238449 CAGAGGAAAGGGTAGTTGGCAGG + Intronic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985273838 4:188219021-188219043 CAGAAGAAGGTGCAAGCGGCTGG - Intergenic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985423149 4:189804115-189804137 CACAGGAAGGTACATGAGGCAGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985628318 5:1001632-1001654 CCATGGACGGGGCAGGAGGCAGG + Intergenic
985652172 5:1112300-1112322 CAGCAGGAGGGGCAGGGGGCTGG - Intergenic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985790916 5:1926459-1926481 CAGGGGAAGGGGCAGGCGTAGGG - Intergenic
985844507 5:2334402-2334424 CAGCGGAACGTGCAGAAGGCAGG + Intergenic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
986250014 5:6046679-6046701 GAGAGGAAGGGGTTGGGGGCTGG - Intergenic
986679799 5:10222337-10222359 AAGAGGCGGGGGTAGGAGGCAGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
986963562 5:13244206-13244228 GAGAGGCACGGGCAGGAAGCGGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
987823957 5:23004096-23004118 AAGAGAAAAGGGCATGAGGCAGG - Intergenic
988798874 5:34677983-34678005 GATAGGAAGATGCAGGAGGCCGG - Intronic
989398470 5:40983820-40983842 CACAGGAAAGGGCAGGAAGATGG - Intergenic
989536739 5:42572865-42572887 GAGAGGTGGGGGTAGGAGGCAGG + Intronic
989984685 5:50684801-50684823 CAGGGAAAGGGACATGAGGCAGG - Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990130658 5:52579118-52579140 AAGAGGAGGGGGCAGGAAGAAGG - Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
990527288 5:56640473-56640495 CAGCAGAAGAGGCAAGAGGCTGG + Intergenic
990978579 5:61580844-61580866 CAAAGGAAGGGCCAAGTGGCAGG - Intergenic
991240098 5:64448551-64448573 CAAAGGAATGGGGAGGAGGAAGG - Intergenic
991530017 5:67604668-67604690 CACATGAAGGGGCAAGAGGAAGG - Intergenic
992074263 5:73176448-73176470 AAGAGGAGAGGGCAGGAGGGAGG + Intergenic
992217282 5:74538422-74538444 TAGAGCAAGGGTCAGGAGACAGG + Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992557241 5:77915868-77915890 CAGAGGTTGGGGGAGGATGCAGG + Intergenic
992821724 5:80504623-80504645 CAGAGGCTGAGGCAGGAGGATGG - Intronic
992881402 5:81113968-81113990 AAAAGGAAGGGTGAGGAGGCAGG - Intronic
992954522 5:81893521-81893543 AAAAGGAAGGGAAAGGAGGCTGG + Intergenic
993611586 5:90060869-90060891 CAGAGGAAGAGGCAGGTAGCAGG - Intergenic
993797104 5:92281431-92281453 CAGAGGAAGGGGCGGAAGTGGGG + Intergenic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
994440976 5:99802204-99802226 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
994651485 5:102534593-102534615 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
995054630 5:107745547-107745569 GAGAGGAACTGGCAGGAGCCAGG + Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995309264 5:110692512-110692534 CACAGGAAGCGCAAGGAGGCAGG + Intronic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996406638 5:123111768-123111790 CAAGGGAAGAGGCAGGAAGCGGG - Intronic
996427016 5:123324782-123324804 CAGAGGGAAGGGCAGTAGGGGGG - Intergenic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
996737902 5:126774735-126774757 CGGAGGCTGAGGCAGGAGGCAGG - Intergenic
996750382 5:126882624-126882646 AACAGGAAGAGGCAGAAGGCAGG + Intronic
996793830 5:127322330-127322352 CAGAGGAAAGGCAAAGAGGCAGG - Intronic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
997105955 5:131019602-131019624 AGGAGGAAGGGGCAGTGGGCAGG + Intergenic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997284302 5:132667527-132667549 CAGGGGAGAGGGCAGGCGGCGGG - Intergenic
997294798 5:132762656-132762678 CAGGGGAGGGGACAGCAGGCTGG + Intronic
997298111 5:132782256-132782278 CTGAGGAAGGGGCAGAACTCAGG + Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997510053 5:134447888-134447910 CCTCGGATGGGGCAGGAGGCAGG + Intergenic
997529872 5:134575418-134575440 CAGAGAAACTGGAAGGAGGCTGG + Intronic
997614462 5:135237008-135237030 GAGAGGAAGGGGCCGAGGGCTGG + Intronic
997733727 5:136198680-136198702 TAGAGGAAGGGGCGGGTGCCAGG + Intergenic
997786110 5:136715500-136715522 GAGGGGAAGGGGCAGGAGCAGGG - Intergenic
997871052 5:137505434-137505456 GAGTGGAGGGGGCAGGATGCTGG - Intronic
998099468 5:139419972-139419994 GAGAGGAGGGATCAGGAGGCTGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998678272 5:144434968-144434990 AAGAGGAAGGCGCATGAGGAAGG + Intronic
999311598 5:150555186-150555208 CGGAGGAAGGGACAGGAACCTGG - Exonic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999330072 5:150667478-150667500 CAGAGGAATTGGCACCAGGCAGG - Intronic
999377017 5:151093977-151093999 AAGAGGAAAGGGCAGCAGGTAGG - Intergenic
999391869 5:151199178-151199200 CAGAGGAAGGGTTAGGACTCTGG - Intronic
999454399 5:151702795-151702817 CCAGGGAAGGGGCAGGAGGGAGG + Intergenic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
999812340 5:155139646-155139668 CAGAGGAAGGGTGAGCAGGGAGG + Intergenic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1001209653 5:169798198-169798220 CCGAGGAAGTTGCAGGAGGAAGG - Intronic
1001563697 5:172686318-172686340 CAGGGGCAGGGGCTGGCGGCTGG + Intronic
1001636081 5:173211361-173211383 CAAAGGAGGGGGCTGGGGGCTGG - Intergenic
1001662897 5:173409867-173409889 CAGAGGTAGGGGCAGGGGAGAGG - Intergenic
1001801255 5:174546086-174546108 GGGAGGCAGGGGCAGGAGGTGGG - Intergenic
1001874110 5:175184538-175184560 CATAGGCAGAGGGAGGAGGCTGG - Intergenic
1001884020 5:175272072-175272094 GTGAGGAAGAGCCAGGAGGCTGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002000687 5:176194872-176194894 CAGGGGCAGGGGCAGGAGCGGGG + Intergenic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002106935 5:176884148-176884170 GAGAGGAAGTGGCAGGAAGCTGG + Intronic
1002140407 5:177134106-177134128 GAGGGGGAGGGGGAGGAGGCCGG - Intronic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002253655 5:177944115-177944137 CAGGGGCAGGGGCAGGAGCGGGG - Intergenic
1002309472 5:178306003-178306025 GAGAGGATGTGGCTGGAGGCAGG + Intronic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002579515 5:180199124-180199146 CAGAGGACGGGAGAGGTGGCAGG + Intronic
1002584052 5:180230301-180230323 CAGAGGAAGGTTCAGGAGACAGG + Intergenic
1002795094 6:465631-465653 AAGAGGATGGGGCAGGTGGCGGG - Intergenic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1003310418 6:4965394-4965416 GAGTGGGAGGGGCAGGAGGGAGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003450207 6:6223780-6223802 CAAAGGGAGGGGTTGGAGGCTGG - Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003774029 6:9339535-9339557 CAGAGGCTGGGGCAGGAGAATGG - Intergenic
1003806102 6:9727429-9727451 CAGTGAAAGGGCCAGGAGGTCGG - Intronic
1003871790 6:10410064-10410086 CAGAGGCAGAGCCAGGAGTCTGG - Exonic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004184792 6:13412704-13412726 AAGAGGAGGGAGCAGAAGGCAGG - Intronic
1004412035 6:15390087-15390109 AACAGGGAAGGGCAGGAGGCAGG - Intronic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1005965345 6:30722641-30722663 CACAGGTAAGGGCAGGAGCCCGG + Exonic
1006112867 6:31759332-31759354 CAGAGTTAGGGGCTGGAGGTGGG + Intronic
1006154634 6:32007602-32007624 CTGAGGGAGCGGCTGGAGGCTGG + Intergenic
1006160946 6:32040337-32040359 CTGAGGGAGCGGCTGGAGGCTGG + Intronic
1006230372 6:32581267-32581289 CAGAGGCAGGGCCTGGAGCCTGG + Intronic
1006269584 6:32953471-32953493 AAGAGGAAGAGCCAGGAGGGAGG - Intronic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006338075 6:33431447-33431469 CAGGGGAATGGGCAGGGAGCAGG - Intronic
1006338103 6:33431552-33431574 CCAAGGAAGGGGCAGGTGGGGGG - Intronic
1006388646 6:33746263-33746285 CACGGGAGGGGGCAGGAGGCCGG - Intronic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006403155 6:33829546-33829568 GAGAGGAGGGGACAAGAGGCTGG - Intergenic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006988285 6:38191753-38191775 GGTGGGAAGGGGCAGGAGGCGGG + Intronic
1007090113 6:39178866-39178888 GAGAGGAAGAGACAGGAGCCAGG - Intergenic
1007094034 6:39202437-39202459 GAGAGGAGAGGGCAGGGGGCAGG + Intronic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007378398 6:41471317-41471339 GTGGGGGAGGGGCAGGAGGCAGG - Intergenic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007577979 6:42938426-42938448 CACAGCGAGAGGCAGGAGGCAGG + Intronic
1007664957 6:43508617-43508639 CTCAGGAAGGGGCAGGACGGGGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007704065 6:43780591-43780613 CGGAGGAAGTGTCAGGAGGCAGG - Intronic
1007710363 6:43819145-43819167 CAGGGGCTGAGGCAGGAGGCAGG + Intergenic
1007742753 6:44022829-44022851 GAGAGGATGGGGCTGGAGGCGGG - Intergenic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1008920807 6:56843245-56843267 AAGAGGAAGGAGCAGCACGCTGG + Intronic
1009422225 6:63475920-63475942 CAGAGGAAGAGGGAAAAGGCAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1011554622 6:88561797-88561819 CAGTGGGAGGGCCAGGTGGCCGG - Intergenic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1012448283 6:99328636-99328658 CAGATGAAGGGGCTGGTGGTCGG - Intronic
1013084972 6:106848804-106848826 CAGAGGATGAGGCAGGAGTGAGG + Intergenic
1013215069 6:108019670-108019692 AAGAGAAAGAGGCAGGAGCCAGG + Intergenic
1013290731 6:108717030-108717052 CAGAGGAAGGGGTAGCGGCCAGG + Intergenic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1013817514 6:114116672-114116694 AAGAGGATGGGGAAGGAGGTGGG - Intronic
1013906978 6:115232454-115232476 CAGTGGAAGGGCCAGCAGGTTGG + Intergenic
1014703296 6:124715691-124715713 CAGAGGCAGTGACAGGGGGCAGG - Intronic
1015042438 6:128738420-128738442 GAAAGGGAGGGGCAGGAGACAGG + Intergenic
1015277434 6:131398863-131398885 AAGATTTAGGGGCAGGAGGCCGG + Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1015652259 6:135477143-135477165 CAGAGGCTGGGGCAGGAGAATGG - Intronic
1016181769 6:141155575-141155597 AAAAGGAAGGGGCAGCAGTCAGG + Intergenic
1016346266 6:143117229-143117251 AAGTGGCAGTGGCAGGAGGCAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1017634438 6:156430317-156430339 TAGAGGAAGGGGAAAGAGACAGG + Intergenic
1017664566 6:156707107-156707129 CAGAGACAGAGGCATGAGGCAGG - Intergenic
1017791670 6:157805211-157805233 CAGAGGGAGGGTCAGGATGAAGG - Intronic
1017809960 6:157977481-157977503 CAGAGGGAGGGAGAGGAGGTTGG - Intergenic
1017877727 6:158537523-158537545 GAGAGGAAGGGGGCGGGGGCCGG - Intronic
1017941352 6:159055890-159055912 AAAGGGAAGGGGCAGGAGGGTGG + Intergenic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018420913 6:163640668-163640690 CAGAGGCTGGGGCAGCAGGCAGG - Intergenic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018610621 6:165644498-165644520 CAGAGGTAAGGGCAACAGGCAGG + Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1018890066 6:167976858-167976880 AAGACCCAGGGGCAGGAGGCCGG - Intergenic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019158240 6:170052874-170052896 CAGAGGGAGGGGGAGGGGGAGGG - Intergenic
1019345992 7:531179-531201 CAGGGGCAGGGGCGGGGGGCGGG + Intergenic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019508420 7:1404959-1404981 AAGAGGGAGGGGGAGGAGGGAGG + Intergenic
1019604104 7:1899892-1899914 CAGAGGAAGATGGAGGACGCGGG + Intronic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019646889 7:2135616-2135638 CAGAGGAAGGCTCAGGTGGTGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019922855 7:4173925-4173947 CCCAGGCTGGGGCAGGAGGCTGG - Intronic
1020000549 7:4753357-4753379 CAGAGGAAAGGGCAGCAAGGCGG + Intronic
1020077209 7:5266282-5266304 GAGCGGAGGGGGCGGGAGGCAGG + Intergenic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1020262263 7:6536968-6536990 CAGAGGGAGGGGCAGGCTGCGGG + Intronic
1021024539 7:15648503-15648525 CAGAGGAAAGGATAGCAGGCCGG + Intronic
1021316106 7:19149143-19149165 AAGAGGAAGGGACATGAGGAAGG - Intergenic
1021396344 7:20153191-20153213 CAGTGGAAGTGTCAGCAGGCTGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1021819348 7:24480709-24480731 CAGAGGCAAGGGCAGGAGCTGGG - Intergenic
1021907371 7:25348684-25348706 CAGAGTTGGGGGCAGGAGACTGG + Intergenic
1022088396 7:27090983-27091005 TAGAGGAGGGGGCAGGAGAAGGG + Intergenic
1022924268 7:35044297-35044319 GAGAAGAAGGGGCAGGAAGAGGG - Intergenic
1022953095 7:35356741-35356763 CAGAGGAAGAGGCAACAGACAGG + Intergenic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023623846 7:42097348-42097370 AAGATGGAGGGGCAGGGGGCGGG + Intronic
1023640791 7:42254985-42255007 AAGTGGAAGGGGCAGTGGGCAGG - Intergenic
1023822278 7:43986788-43986810 CCGGGGAGGGGGCCGGAGGCTGG + Intergenic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024175075 7:46831269-46831291 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1025752795 7:64307733-64307755 CAGAGGAAGGGGCAGGGATGAGG - Intronic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026285041 7:68955400-68955422 CAGAGAAAAGGGGAAGAGGCAGG + Intergenic
1027251547 7:76401735-76401757 CAGAGGAAGGGGCTCCAAGCTGG - Intronic
1028334029 7:89629083-89629105 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029488278 7:100856495-100856517 AAGAAGAAGGGGCAGGGCGCCGG - Intronic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029598647 7:101550982-101551004 AAGAGGAAGGGAGAGGAGGATGG - Intronic
1029617006 7:101665404-101665426 CAGAGGAAGAGACAGGGGCCGGG - Intergenic
1029750543 7:102540202-102540224 CCGGGGAGGGGGCCGGAGGCTGG + Intronic
1029768496 7:102639310-102639332 CCGGGGAGGGGGCCGGAGGCTGG + Intronic
1029822576 7:103160063-103160085 GAGAAGAAGGGGCAGGAAGACGG - Intergenic
1029870963 7:103692424-103692446 AAGAAGAAGAGGCAAGAGGCAGG - Intronic
1030012886 7:105189048-105189070 CTGAGGAAAGGGCTGGAGTCTGG - Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030162238 7:106520747-106520769 AAGAGGCAGGGGCGGGAGGATGG + Intergenic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030706510 7:112698051-112698073 GAGAGGGAGGGGGAGGAGGAGGG + Intergenic
1031817856 7:126461385-126461407 CAGAGGCAGGGAGAAGAGGCTGG - Intronic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032037535 7:128531389-128531411 CGGATTAAGGGGCCGGAGGCGGG + Intergenic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032268239 7:130383135-130383157 CAGGGGAAGGGCCAGGGGCCTGG + Intronic
1032286665 7:130542760-130542782 TAAAAGAAGGGACAGGAGGCAGG + Intronic
1032323495 7:130905430-130905452 GGGAGGCTGGGGCAGGAGGCAGG - Intergenic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032848662 7:135773522-135773544 CAGAGGAGGAGGGAGGAGCCAGG - Intergenic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033565522 7:142574899-142574921 CAGAGGCAGGGGGAGGGGGAGGG - Intergenic
1033565526 7:142574905-142574927 CAGAGGCAGAGGCAGGGGGAGGG - Intergenic
1033619502 7:143049461-143049483 GAGGGGAAGGGCCAGGAGACAGG + Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034202865 7:149293424-149293446 AAGAGGAAGGGGCAAGTGGGAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034260565 7:149752817-149752839 GGGAGGCCGGGGCAGGAGGCAGG + Intergenic
1034278112 7:149832934-149832956 GAGGGGACGGGGCAGGAGCCTGG + Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1034845781 7:154443141-154443163 CAGAGGGAGTGGCAGGTGCCTGG - Intronic
1034907903 7:154966850-154966872 CAGGGGTTGGGGCAGGAGCCAGG - Intronic
1034959933 7:155358830-155358852 CAGGGGCTGGGGCAGGAGCCCGG - Intronic
1035404197 7:158587591-158587613 CGGACGAAGGGGCGGCAGGCAGG + Exonic
1035472342 7:159118487-159118509 AAGAGGCAGGATCAGGAGGCAGG - Intronic
1035690660 8:1557439-1557461 CACAGGATGGGGCAGAGGGCAGG + Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037497048 8:19450217-19450239 AAGAGGGAGGGGGAGGGGGCAGG + Intronic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037882073 8:22578423-22578445 CAAGGGAGGGGGCAGGAAGCGGG + Intronic
1037991348 8:23323408-23323430 AAGAGGACAGTGCAGGAGGCAGG - Intronic
1038704837 8:29883981-29884003 CAGGGGTAGGGCCTGGAGGCAGG + Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1039370726 8:36981575-36981597 CAGAGGAGAGGACAGGAGGAAGG - Intergenic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039473943 8:37829587-37829609 CAGAGAAAGGGACAGGGGTCTGG - Intronic
1039722034 8:40174529-40174551 CAGAGGATTGGGCAGCAAGCTGG - Intergenic
1039890441 8:41682190-41682212 CACAGGACGGGGCTGGAGGCGGG - Intronic
1040435174 8:47383173-47383195 CAGAGCACCTGGCAGGAGGCTGG - Intronic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040903528 8:52441425-52441447 GAGAGGCAGAGGCAGGAGGATGG + Intronic
1041085082 8:54249477-54249499 AAGAGCAAGGGTCAGGAGGTGGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041996696 8:64070170-64070192 GAGAGGCAGAGGCAGGAGGATGG - Intergenic
1042175617 8:66034784-66034806 CAGAGGTGGGGGCAGGTGTCTGG + Intronic
1043089609 8:75881657-75881679 CAGAGGCTGAGGCAGGAGGATGG - Intergenic
1044216394 8:89616146-89616168 CAAAGGAAGAGGCAGGAGAAGGG + Intergenic
1044700030 8:94957385-94957407 CAGAGGAAAGGGCTGAAAGCTGG + Intronic
1045016765 8:98007318-98007340 CAGAGCAAGGGGCAGGGGAGGGG - Intronic
1045318994 8:101067380-101067402 TAGGGGAGAGGGCAGGAGGCAGG + Intergenic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045878418 8:107009989-107010011 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1046475469 8:114736953-114736975 CAGGAGAAAGGGCGGGAGGCAGG - Intergenic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047904040 8:129453793-129453815 CTGAGGATAGGGCAGGATGCTGG - Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048236047 8:132691840-132691862 CAGAGGAAGGCCCATGTGGCTGG + Intronic
1048259488 8:132933735-132933757 CTGAGGAGCGGGCAGCAGGCTGG + Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1048586393 8:135777948-135777970 CAGAGGATGGGGCTGGAGTTGGG + Intergenic
1048837554 8:138535979-138536001 AAGAGGAAGGGGCAGGGGCGTGG - Intergenic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049277042 8:141725160-141725182 CACAGGAAGGGGTGGGTGGCGGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049359616 8:142206098-142206120 CAGCGGAAGGGGCAGGGGCAGGG + Intergenic
1049414001 8:142487229-142487251 CAGGCGAAGGGGTGGGAGGCTGG - Intronic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049488755 8:142879931-142879953 CAGAGGTCAGGGCTGGAGGCAGG + Intronic
1049653876 8:143789309-143789331 CCGAGGGAGGGCCAGGAAGCTGG + Intergenic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049743978 8:144255318-144255340 CAGGGGTAGAGGCAGGAGACAGG - Intronic
1049774060 8:144396649-144396671 CAGAGGAGGGGGCTGGGGCCCGG - Exonic
1049803781 8:144529939-144529961 CCGAGGGAGGGAGAGGAGGCGGG + Exonic
1049812041 8:144579964-144579986 CCGAGGCAGGGACAGGAGGCTGG - Intronic
1049988477 9:972349-972371 CAAAGGAGGAGGCGGGAGGCTGG + Intergenic
1050400851 9:5252619-5252641 GAGATGAAAGGGTAGGAGGCTGG - Intergenic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1051367312 9:16330097-16330119 CGCAGGGTGGGGCAGGAGGCAGG + Intergenic
1051593980 9:18805667-18805689 CAGGGGCAGGGGCAGGAGAAAGG - Intronic
1051725914 9:20088302-20088324 CAGAGGGAGGGGCAGGCTGCCGG + Intergenic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1052900648 9:33791921-33791943 CAGAAGGAGGGGCAAGGGGCAGG + Intronic
1052900655 9:33791944-33791966 CAAGAGGAGGGGCAGGAGGCAGG + Intronic
1052974982 9:34403484-34403506 CAAAGTAAGGGGCAGAAGGCTGG + Intronic
1053123069 9:35560545-35560567 AAAAGAAAGGGGCAGGAGGTGGG + Exonic
1053275809 9:36782453-36782475 AGAAGGAAGAGGCAGGAGGCTGG - Intergenic
1053302677 9:36963002-36963024 CTGAGCAAGGGGCCGCAGGCTGG - Intronic
1053307211 9:36993545-36993567 CAGAGAAAGGGACAGGAAGAAGG + Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053484471 9:38441738-38441760 CAGAGGTATGGGCAGGAGCTGGG + Intergenic
1053562351 9:39209670-39209692 GGGAGGAAGGGGCAGAAGGGGGG - Intronic
1053605325 9:39652531-39652553 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1053828155 9:42047658-42047680 GGGAGGAAGGGGCAGAAGGGGGG - Intronic
1053863240 9:42409158-42409180 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1054248218 9:62689885-62689907 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054562333 9:66724410-66724432 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054602403 9:67139792-67139814 GGGAGGAAGGGGCAGAAGGGGGG + Intergenic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055560044 9:77513636-77513658 GAGAGGAAGGGGCAGAGGCCAGG - Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1056059533 9:82870030-82870052 CACAGGATGGGGGATGAGGCAGG - Intergenic
1056163598 9:83921492-83921514 GAGAGGACGCGGCGGGAGGCGGG - Intergenic
1056179095 9:84064260-84064282 AAGAGGCAGGGGCAGGGTGCAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1057195010 9:93111945-93111967 GAGAGGGAGGGGCAGCAGGGAGG - Intronic
1057200699 9:93138252-93138274 AACAGGCAGGAGCAGGAGGCTGG + Intergenic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057442942 9:95095255-95095277 CAGAGGAAGGGACAGGAAACTGG - Intergenic
1057515112 9:95714186-95714208 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057789958 9:98118356-98118378 AAGAGGAAGGCTCTGGAGGCAGG - Intronic
1057895715 9:98906993-98907015 CAGCTGTCGGGGCAGGAGGCTGG + Intergenic
1058247298 9:102643231-102643253 CACAGGATGAGACAGGAGGCTGG + Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058720702 9:107760911-107760933 AGGATGAAGGGGTAGGAGGCTGG + Intergenic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059428408 9:114235672-114235694 CAGGGGCAGGGGCAGGGGGAGGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1060044471 9:120328811-120328833 AAAGGGAAGGGGCAGGAGGTAGG - Intergenic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1060438634 9:123617714-123617736 CAGAGCAAAGGTCAGGAGACAGG + Intronic
1060493030 9:124098832-124098854 AGGTGGCAGGGGCAGGAGGCAGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060803677 9:126561681-126561703 CAGGGGAGGAGACAGGAGGCAGG - Intergenic
1060825953 9:126688314-126688336 CTGGGGAAGGGGCAGCAGGGCGG - Intronic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1061089787 9:128420380-128420402 CGGAGGATGGGGCGGGAGCCGGG + Intronic
1061250165 9:129421796-129421818 GAGAGCAAGGGGCAGGGGGTGGG + Intergenic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061379114 9:130243693-130243715 CTGAGGCAGGGGCAGGGGTCTGG + Intergenic
1061416495 9:130450103-130450125 TGGAGCAGGGGGCAGGAGGCAGG + Intronic
1061535886 9:131249911-131249933 CAGAGGCTGAGGCAGGAGGATGG + Intergenic
1061560192 9:131397096-131397118 AAAAGGAAGGGCCAAGAGGCAGG - Intronic
1061799337 9:133105534-133105556 CAGAGGTAGCGTCAGGAGCCTGG + Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061926442 9:133808268-133808290 CAGAGGGTGGGGCAGCAGGAGGG + Intronic
1062103751 9:134741594-134741616 CAGAAGCAGAGGCAGGAGGGTGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062264640 9:135681384-135681406 ACCAGGACGGGGCAGGAGGCAGG + Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062344592 9:136109063-136109085 GAGAAGCAGGGGCAGGAGGCAGG - Intergenic
1062362319 9:136193777-136193799 CTGGGGGAGGGGCCGGAGGCCGG + Intergenic
1062453999 9:136627203-136627225 CACGGGGAGGGGCTGGAGGCTGG + Intergenic
1062460370 9:136660307-136660329 CAGAGGCAGGTACAGGAGGTGGG - Intronic
1062472641 9:136713112-136713134 GGGATGAAGGGGCAGGGGGCGGG - Intronic
1062482596 9:136759417-136759439 CCTGGGAAGGGGCAGGGGGCAGG - Intergenic
1062502882 9:136858802-136858824 CAGAAGCGGAGGCAGGAGGCTGG - Exonic
1062722848 9:138053532-138053554 CACAGGGAGGGGCCGGAAGCAGG - Intronic
1185463147 X:341515-341537 CAGGAGGAGGGGCAGGAGGGGGG - Intronic
1185640650 X:1588143-1588165 CAGAGGAAAGGGGAGGGGGGAGG - Intergenic
1185860416 X:3573499-3573521 CTGGGGAAGGGAGAGGAGGCAGG + Intergenic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1186627415 X:11309339-11309361 CAGAGAAGGAGACAGGAGGCAGG + Intronic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188032094 X:25275556-25275578 CAGAGGAATGGACACAAGGCAGG - Intergenic
1188542963 X:31269984-31270006 GAGAGGAAAGGACAGGAGGAAGG + Intronic
1189269365 X:39740137-39740159 CAGAGGAAGAGGCAGGGGCCCGG - Intergenic
1189323801 X:40101246-40101268 GAGAGGAGGGGGCAGGAGAAGGG - Intronic
1189340292 X:40199974-40199996 CGGAAGAAGGTGCAGGGGGCCGG - Intergenic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190149889 X:47936673-47936695 CAGCGGCAGGGGCGGGCGGCGGG + Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190367562 X:49711029-49711051 CAAAGGCAGAGGCAGAAGGCAGG - Intergenic
1190407014 X:50098361-50098383 CAGAGGTAAGAACAGGAGGCTGG - Exonic
1190465459 X:50721609-50721631 CACAGGATGAGGCAGGAGGTCGG - Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191690363 X:63932880-63932902 GAGATGAAGGGGCAAGAGGCTGG - Intergenic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1192207288 X:69105000-69105022 GAGAGGCAGGGGGAGGGGGCCGG + Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192363822 X:70455125-70455147 GAGAGGAGGGGGAAGGAGGGAGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1192847990 X:74925480-74925502 AGGAGGAAGGGGGAGGAGGGGGG - Intronic
1193400510 X:81036779-81036801 CAGAGGAATACACAGGAGGCTGG - Intergenic
1193565862 X:83076333-83076355 CAGAGGAGGGGTCAGGTGGGAGG - Intergenic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1195202756 X:102565641-102565663 GAGAGGGAGGGGCAGGGGGAGGG + Intergenic
1195273660 X:103257261-103257283 GAGAGGGAGGCGCTGGAGGCAGG - Intergenic
1195353733 X:104018741-104018763 CTGAGGAAGGGTCTGGAGGCAGG + Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195385035 X:104306031-104306053 CAGAGGCAGGGTCAGCAGACAGG - Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195708201 X:107753247-107753269 GGGAGGAAGGGCCAGGATGCTGG + Intronic
1196124347 X:112082980-112083002 GGGAGGACGGGGCAGGCGGCAGG + Intergenic
1196362446 X:114879601-114879623 CAGGGGAAAGGATAGGAGGCGGG - Intronic
1196370128 X:114968329-114968351 CAGAGGCAGAGGCAGGAGAATGG + Intergenic
1196554325 X:117069748-117069770 CGGGGGAAGGGGGAGGAAGCTGG + Intergenic
1196911445 X:120488321-120488343 GAAAGGAAGGGGTGGGAGGCAGG + Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197881428 X:131170738-131170760 CCAAGGAAGGGGCAGGAGAGAGG + Intergenic
1197988596 X:132293598-132293620 TAGAGGAAGGGGAGGGAGACAGG + Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1198242031 X:134796602-134796624 GAGAGGAAGGGGGCGGAGGAGGG + Intronic
1198370591 X:135985473-135985495 GTGAGGTAGGGGCGGGAGGCGGG + Exonic
1199023046 X:142904733-142904755 TAGGGGTAGGGGTAGGAGGCTGG + Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199800746 X:151248371-151248393 CAGAGGGAGGGGGAGGGGGAGGG + Intergenic
1199861331 X:151802498-151802520 CAGAGGAAGGTGCTGGCTGCTGG - Intergenic
1199976556 X:152897978-152898000 CAGAGGAAGGGGCCGGCCGAGGG + Intergenic
1200003612 X:153074081-153074103 CACAGGAAGGGGCCGGTGCCCGG + Exonic
1200004111 X:153075928-153075950 CACAGGAAGGGGCCGGTGCCCGG - Intergenic
1200049341 X:153420489-153420511 GAGATGAAGGGGCGGGAGGATGG - Intronic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200137769 X:153883303-153883325 CAGAGGCAGAGGGAGGAGACGGG + Intronic
1200206094 X:154317455-154317477 CAGAGGAAGGGCCAAGTGGTAGG + Intronic
1200746974 Y:6911360-6911382 GGGCGGAAGGGGCAGGTGGCGGG + Intronic
1200785767 Y:7259130-7259152 CAAAGGATGAGACAGGAGGCCGG + Intergenic
1200796092 Y:7342605-7342627 CACAGGATGAGACAGGAGGCTGG - Intergenic
1201255822 Y:12107422-12107444 CACAGGATGGGATAGGAGGCTGG - Intergenic
1201291122 Y:12421384-12421406 CAGAGGCAGAGGCTGGGGGCTGG - Intergenic
1201638574 Y:16153525-16153547 AAGAGGAAGGGGCTTGAGGTAGG + Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202459401 Y:25092624-25092646 CACAGAAAGGGCCAGGAGGTTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic