ID: 925104411

View in Genome Browser
Species Human (GRCh38)
Location 2:1278245-1278267
Sequence TATTGTTTATGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925104407_925104411 -3 Left 925104407 2:1278225-1278247 CCATGTCAGTTAATGCAACATAT 0: 1
1: 0
2: 3
3: 9
4: 164
Right 925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG 0: 1
1: 1
2: 2
3: 23
4: 218
925104405_925104411 30 Left 925104405 2:1278192-1278214 CCTCATTTTGGGACAACTCAATC 0: 1
1: 0
2: 0
3: 23
4: 181
Right 925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG 0: 1
1: 1
2: 2
3: 23
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925104411 Original CRISPR TATTGTTTATGGAGGGCAGA AGG Intronic
900691673 1:3984375-3984397 TAACATTTATTGAGGGCAGATGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903105985 1:21080514-21080536 TATTTTTTTTGGAGGGGACAGGG + Intronic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
906091381 1:43182314-43182336 TATTGTGTCTCGAGGGCAAAAGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908613685 1:65892748-65892770 TATTGTTTATTGGGGGCGGGTGG - Intronic
908934425 1:69357493-69357515 AAATCTTTATGGAAGGCAGAGGG + Intergenic
909602160 1:77472267-77472289 TATGCGTTAAGGAGGGCAGATGG - Intronic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
913330516 1:117663312-117663334 TCTTGTATCTGGAGGGCAGTGGG - Intergenic
913515218 1:119599634-119599656 TTTTGTTCATGGAGTACAGAAGG - Intergenic
914085478 1:144450435-144450457 TCTTGTTTGTGGGGGGCTGAGGG - Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
918289954 1:183097843-183097865 TTTTGTTTATGGAAGGGATATGG + Intronic
922053026 1:222012692-222012714 TATTGTGTGTTGAGGGTAGAAGG + Intergenic
922226249 1:223648338-223648360 CATTGATTATGGAGAGCACAGGG - Intronic
1065638935 10:27760952-27760974 TTCTGTTTATGGAAAGCAGAGGG - Intergenic
1066356444 10:34688838-34688860 TATTTTTTATGGAGGGGAAGAGG - Intronic
1069495824 10:68902178-68902200 TTTTTTTTTTGGAGGGCAGGGGG - Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1069882455 10:71602259-71602281 TAGTGTTCATGGAGGAAAGATGG + Intronic
1070204312 10:74241388-74241410 TATTTTTTGGGGAGGGGAGACGG + Intronic
1070275330 10:75000489-75000511 TCTTTTTTATCGGGGGCAGACGG + Intronic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071827027 10:89335531-89335553 TTTTTTTTTTGGAGGGCAGAAGG - Intronic
1071871987 10:89806211-89806233 TATTCTTTGTGGAGAGCAGCAGG + Intergenic
1072074974 10:91961600-91961622 TTTTGTTTATGGGGGTAAGAGGG - Intronic
1072523462 10:96250497-96250519 AATTTCATATGGAGGGCAGAGGG + Intronic
1072656384 10:97333507-97333529 GATTGTTTAAGGAGGGCTCAGGG - Exonic
1073017991 10:100417314-100417336 AGTTGTTTATGAAGGGAAGAAGG + Intergenic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073778273 10:106809838-106809860 TACTGTTTGTGGATGGCAGAAGG + Intronic
1076098232 10:127751190-127751212 TATTTTCTATAAAGGGCAGATGG - Intergenic
1076899657 10:133331786-133331808 CATTTTATATGGAAGGCAGAGGG + Intronic
1078634988 11:13040972-13040994 CATTGTTCATGGATGGCACATGG - Intergenic
1079874388 11:25838576-25838598 TTTTGTTTCTGGAAAGCAGAGGG + Intergenic
1081853080 11:46287249-46287271 TATTGTTTATAGAGGGTTTATGG - Intronic
1083336390 11:61924132-61924154 CATTTTTTAGGGAGGGCAGTTGG + Intergenic
1084987556 11:72889394-72889416 TATTGCTGATGGAGGGCTTAAGG + Intronic
1085427452 11:76417254-76417276 TATTTTTTCTGGAGTGCAGGAGG - Intergenic
1092676048 12:10921940-10921962 TATTGTTTGTAGAGGGCAGTGGG + Intronic
1094053126 12:26242371-26242393 TAATGTTTGCAGAGGGCAGAGGG - Intronic
1094278353 12:28705957-28705979 TATGGTTAATGGATGGAAGAAGG + Intergenic
1096088761 12:48884083-48884105 GAATGTTTATGGAAGGCAGAGGG + Intergenic
1096812056 12:54177031-54177053 TAGTGTTTCTGGATGGCACACGG + Intronic
1098933584 12:76450789-76450811 TTTTGTTTTTGGAGGGGAGAAGG - Intronic
1099046049 12:77720834-77720856 TATTGTCCATGGAGGGAAGGAGG + Intergenic
1099905946 12:88770072-88770094 TATTGATTAAGGAAGACAGAAGG + Intergenic
1100286175 12:93169005-93169027 TATTGTATATTGATGGCGGAGGG + Intergenic
1106840984 13:33684852-33684874 TATTGTTTCTTGGGGGCAGGAGG - Intergenic
1106871263 13:34024544-34024566 TATTGTTTATGTAGAACACATGG - Intergenic
1107373799 13:39780635-39780657 TATTATTTAGGGAGGTCTGAGGG + Intronic
1107794961 13:44041902-44041924 TACTGGCTATGGAGCGCAGATGG - Intergenic
1108086430 13:46797686-46797708 TAATTTTTATTGAGGGAAGAAGG - Intergenic
1108223774 13:48266326-48266348 TTTTCTTTGTGGAGGGCAGGGGG - Exonic
1108708265 13:53009568-53009590 TATTGTTTGAGGAGTCCAGATGG + Intergenic
1109082000 13:57915765-57915787 AATTGTTTTTGGAGATCAGAAGG - Intergenic
1111781179 13:92726880-92726902 TTTTGTTTATGGAGAAAAGAGGG + Intronic
1111948283 13:94688463-94688485 AATTGTTTATGGATGGGAGTAGG + Intergenic
1112104044 13:96221084-96221106 TATGGTGGAGGGAGGGCAGAGGG - Intronic
1113293431 13:108931296-108931318 CATTGCTATTGGAGGGCAGAAGG - Intronic
1113918017 13:113886086-113886108 TGTTCTTGATGGAGGGGAGAAGG - Intergenic
1114919830 14:27312536-27312558 AAATCTTTATGGGGGGCAGAGGG - Intergenic
1115516204 14:34187671-34187693 TGTTCCTTATGGAGGGCACAGGG + Intronic
1116515444 14:45799706-45799728 AATTCTTTCTGGAAGGCAGAAGG + Intergenic
1116776943 14:49192284-49192306 TATTGATTTTGGAGAGCAGGGGG - Intergenic
1119055474 14:71415148-71415170 AAAGGTTTATGGAGGGGAGATGG - Intronic
1119975840 14:79023040-79023062 TTTGGTTGATGGAGGGCAGCGGG + Intronic
1129162572 15:73754742-73754764 AATTGGTTTTGGAGGGTAGAAGG + Intergenic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1133803550 16:9105070-9105092 TACAGTTTTTCGAGGGCAGAGGG - Intronic
1134908919 16:18006400-18006422 TAAGGTTTATAGAGGGAAGAGGG - Intergenic
1138242973 16:55443983-55444005 TATTGTTTTTGGGTGGCAGGGGG + Intronic
1138766214 16:59608103-59608125 TATTTTTTAAGGAGAGCATAAGG + Intergenic
1140920489 16:79533227-79533249 TATTTTTTAAAGGGGGCAGAGGG + Intergenic
1142934158 17:3313248-3313270 TATTATTTGAGGAGGGCAGCAGG + Intergenic
1144481416 17:15632611-15632633 TAGTGTTTACGTAGGGCTGAAGG - Exonic
1144698417 17:17321349-17321371 TAGTGTCTGTGAAGGGCAGAGGG + Intronic
1146109745 17:30077916-30077938 TATTGGATATGGAAGGCAAAAGG + Intronic
1147160131 17:38564725-38564747 TATTCTTCATGGAGTTCAGAGGG + Intronic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1149362815 17:55911776-55911798 TCTTGGTTATGCAGGGCACAGGG + Intergenic
1149881767 17:60299141-60299163 TTTTGTTTTTGGAGGGGATAGGG - Intronic
1149972575 17:61233817-61233839 TTTGGTTAATGGAGGGCACAGGG + Intronic
1150224631 17:63517328-63517350 TATGGTTTGTGGAGGGGAGAGGG + Intronic
1156292172 18:35756812-35756834 TATTGTTTAGGTAGGTAAGAGGG + Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1157044727 18:44087540-44087562 TAATGATTATGGTGGGCAGAAGG - Intergenic
1157913066 18:51637552-51637574 GAATATTTATGGAAGGCAGAAGG - Intergenic
1157979322 18:52362793-52362815 TTTGGTTTATGGAGGGAGGAGGG - Intronic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159971615 18:74662984-74663006 TATTGTTTGTAGAAGGCAGACGG + Intronic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1165351267 19:35277281-35277303 TATTGGTTTTGGAGGAAAGAGGG + Intronic
1166935612 19:46330660-46330682 TATGGTGGATGGATGGCAGATGG + Intronic
925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG + Intronic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925104437 2:1278461-1278483 TATTGTTTATGGAGGACAGGAGG + Intronic
926075557 2:9940299-9940321 GATTGTTTCAGAAGGGCAGAAGG - Intergenic
926703331 2:15818694-15818716 TAGTGTTTATGGAGGGCGTGTGG + Intergenic
932232586 2:70094894-70094916 TATTTTGTATGGAAGGCTGAAGG - Intergenic
932536498 2:72602962-72602984 TATTTTTTATGGGGGAGAGAGGG - Intronic
932842475 2:75096295-75096317 TGATGTTTAGGGAGAGCAGAGGG - Intronic
933160359 2:79016980-79017002 TATTGTTTATGGTAGAGAGAGGG + Intergenic
935284148 2:101548987-101549009 AAGTGTTTATGGAGTGCATATGG + Intergenic
936724527 2:115296838-115296860 TATTACTAATGGAGGGAAGAAGG - Intronic
937144401 2:119630078-119630100 TACTGTTTTTGGATGGCATATGG + Intronic
937171203 2:119871268-119871290 AAGTGTTTTTGGAAGGCAGATGG + Intronic
937892439 2:126948786-126948808 TGTTGTTTGAGGAGGGCAGTGGG + Intergenic
938271342 2:129974896-129974918 AATTTTTTTTGAAGGGCAGAGGG - Intergenic
940051758 2:149472457-149472479 ATTTTTCTATGGAGGGCAGATGG - Exonic
940910038 2:159202426-159202448 TACTGGTTTTGGAGAGCAGAGGG + Intronic
940965247 2:159830165-159830187 AAATGTTTATGGTTGGCAGAGGG - Intronic
940991823 2:160104954-160104976 TATTGTCTCTGGAGGGCACTGGG + Intronic
941045684 2:160672443-160672465 TATTGGTTTTGGAGAGCAGTTGG - Intergenic
942192488 2:173483875-173483897 TATTGCTCATGAAGGGCAAAGGG + Intergenic
943845777 2:192645500-192645522 TATTTTTAATGGAGGGAAGCAGG - Intergenic
944606847 2:201359456-201359478 TATTGTGTAAGGAGAGAAGAGGG + Intergenic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
945824659 2:214706631-214706653 TATTGGTTCTGCAGGGCAGATGG - Intergenic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
947896115 2:233674377-233674399 TATAATTTATGGAGGGTAAAGGG - Intronic
1168864050 20:1069481-1069503 TATTGCTTTTGGAGGGGAGAGGG - Intergenic
1169361654 20:4955000-4955022 CATTGTTTTGGGAGGCCAGAAGG + Intronic
1170439537 20:16365073-16365095 TAATGATTATGAAGGGCAGAGGG - Intronic
1170993800 20:21331797-21331819 CATTGTTTATGTGGAGCAGATGG + Exonic
1174653459 20:52149780-52149802 TATTATATATGGAAGGCAGCTGG + Intronic
1175371307 20:58495016-58495038 TATTGTTTATGGAGGAGTGCAGG - Intronic
1176326013 21:5502118-5502140 AATTGTTCAGGGAGGCCAGATGG - Intergenic
1176401744 21:6318833-6318855 AATTGTTCAGGGAGGCCAGATGG + Intergenic
1176435413 21:6670271-6670293 AATTGTTCAGGGAGGCCAGATGG - Intergenic
1176459675 21:6997341-6997363 AATTGTTCAGGGAGGCCAGATGG - Intergenic
1176483236 21:7379119-7379141 AATTGTTCAGGGAGGCCAGATGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178032610 21:28545185-28545207 TATTGTTTACGGTGCCCAGAAGG + Intergenic
1179029767 21:37710693-37710715 TGTTATTTATAGAGGGCAAATGG - Intronic
950335924 3:12192899-12192921 TATTGTTTATGTTGAGCTGAAGG - Intergenic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
954075063 3:48172155-48172177 TTTTGTTTGTGGGGGGCACAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957127987 3:76187017-76187039 TAATATTTATGGATGGCATAGGG - Intronic
958047083 3:88298404-88298426 TGTGGTTTGTGGAGGGCAAAGGG + Intergenic
958114230 3:89194376-89194398 CATTGTTTCTGCAAGGCAGAAGG - Intronic
958669933 3:97190712-97190734 TATTTTTTGTGGAGGGGAGCGGG + Intronic
959145012 3:102533703-102533725 TATTGTTCATGGAAGTCACAGGG + Intergenic
959646457 3:108708617-108708639 TAATTTTTATGAAGGGCATAAGG + Intergenic
959806619 3:110562222-110562244 TATTGTTTATTCAGGGCCTAAGG + Intergenic
961248427 3:125477900-125477922 TCTTGTTTCTGAAGGCCAGATGG - Intronic
963192454 3:142487843-142487865 TTTTGTTTATGGTGGGAAGAAGG + Intronic
964221723 3:154354571-154354593 TTTTTTTTTTGGAGGGCAGGCGG + Intronic
964392279 3:156210430-156210452 TATGCTTTCTGGAGGTCAGAGGG + Intronic
965481454 3:169224216-169224238 TGTTGGTGATGAAGGGCAGATGG - Intronic
965993020 3:174844187-174844209 TTTTGTATATGGTGGGAAGAAGG + Intronic
966090298 3:176126874-176126896 TATTGTTTTTGTAGGTCAAAGGG - Intergenic
970903464 4:21187377-21187399 TAATGTTTATTAAGGGCAAAGGG + Intronic
972607849 4:40630362-40630384 ACTTGTTTATGGGGGGAAGAAGG - Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
975685204 4:76913884-76913906 TGTGGTTTATGGGGGGCACAGGG - Intergenic
975931248 4:79525790-79525812 TAATGTTTATGGAAGGCATCAGG + Intergenic
976124707 4:81820960-81820982 TATGGATTTTGGAGGGAAGAGGG - Intronic
976553092 4:86419121-86419143 AATAGTTTTTGGAGGACAGATGG - Intronic
976565239 4:86545602-86545624 TATTTTTCATGGTGGGCAAATGG + Intronic
977921980 4:102655625-102655647 TATTTTTTATGTATGGTAGAAGG - Intronic
978049187 4:104174806-104174828 TATTGCCTATGTAGGCCAGAAGG + Intergenic
978510621 4:109513581-109513603 TATTTTTTAAGGAGGGCTTAAGG + Intronic
979878616 4:125926747-125926769 TATTGGTTATGAAGTGCAAAGGG - Intergenic
983004758 4:162470248-162470270 TTTTGTTAATGAAGGGCAAAAGG - Intergenic
983625511 4:169798004-169798026 TGTTGTTGGTGGAGGGGAGAGGG + Intergenic
986674766 5:10174030-10174052 TAGTTTTTATGGATGGCAGAGGG - Intergenic
987693369 5:21297214-21297236 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
987952331 5:24691125-24691147 AACTCCTTATGGAGGGCAGATGG + Intergenic
988816599 5:34840327-34840349 TATTGTTTTTGCAGGTCTGACGG - Intronic
990443577 5:55870812-55870834 TATTGTTTCTGGACATCAGAAGG - Intronic
991528070 5:67585088-67585110 TATTTTTTTTGCAGAGCAGAAGG - Intergenic
991746905 5:69752338-69752360 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991750800 5:69802904-69802926 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
991798507 5:70332280-70332302 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991826282 5:70627650-70627672 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
991830088 5:70677801-70677823 TCCTGGTTATGGAAGGCAGAGGG - Intergenic
991890838 5:71331603-71331625 TCCTGGTTATGGAAGGCAGAGGG + Intergenic
995333001 5:110966570-110966592 TAGTCTTTATGTAGGACAGAAGG - Intergenic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
996082437 5:119270608-119270630 TAATGTGTATGGAGGACAAAAGG - Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996950274 5:129118140-129118162 TATTGTCTGTGGTAGGCAGATGG - Intergenic
1000388055 5:160694173-160694195 TATTTTATTTGGAGGGGAGAGGG - Intronic
1002838122 6:882641-882663 GATTGTTTATGGAGGGGAGCAGG + Intergenic
1002921797 6:1578184-1578206 TATTGTTTTTGGAGAGCTGGTGG - Intergenic
1003671279 6:8162741-8162763 TATTGTTTTTGCTGGGCAGAAGG + Intergenic
1004777169 6:18860556-18860578 TATCTTTGATGGAAGGCAGATGG + Intergenic
1005909106 6:30292530-30292552 TTTTGTTTCTGGAGGGAAAAGGG + Intergenic
1007975572 6:46097854-46097876 TTTTGTTAATGGAAGACAGACGG + Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009689528 6:67010402-67010424 TATTGTTTATGGAATGCTGAGGG - Intergenic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1010730461 6:79385339-79385361 TACTGTTTCTGTAGGGCAAAGGG - Intergenic
1013149966 6:107436007-107436029 TTTAGTTTATGGAGTGCAGCTGG - Intronic
1013328498 6:109072482-109072504 CATGGTTTTTAGAGGGCAGAAGG - Intronic
1014269360 6:119319414-119319436 TATTGTTGATGGATGGCAAGTGG + Intronic
1015122117 6:129711201-129711223 TTTTTTTTTTGGAGGGGAGATGG - Intergenic
1018637147 6:165872588-165872610 GATTGCTTAGGGTGGGCAGAAGG + Intronic
1021069917 7:16224007-16224029 TCTTTTTTGTGGGGGGCAGAAGG - Intronic
1021157807 7:17233692-17233714 TATGGTTTCATGAGGGCAGAAGG - Intergenic
1021434740 7:20601258-20601280 TGTTGTTTTTGGAGGGAGGAAGG + Intergenic
1022043082 7:26598966-26598988 TTTTTCTTATGGAGGGCAGAGGG + Intergenic
1023467588 7:40474299-40474321 TATTGAGTGTGGGGGGCAGAGGG + Intronic
1023897441 7:44445602-44445624 TTTTGTTTTTGGAGGGGAGGAGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025641126 7:63370736-63370758 TTTTCTTTACGGAGGGCAGAAGG - Intergenic
1025650315 7:63461068-63461090 AAGTGTTTATGGTGGCCAGATGG + Intergenic
1030005610 7:105116206-105116228 TATTGTTTTTTAAGGGCAGAAGG - Intronic
1030828531 7:114191202-114191224 TATAGTTTATGGAGGGAGAAGGG + Intronic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1033777300 7:144626956-144626978 TATTGTTTATTGATGAAAGAAGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1037315799 8:17598356-17598378 TATTCTTTCAGGAGGGAAGAAGG - Intronic
1037955462 8:23054041-23054063 AATTATTTATGGAGGACAAAAGG - Intronic
1038914558 8:32006303-32006325 TACTCTTTCTGGAAGGCAGAAGG - Intronic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1045691773 8:104766683-104766705 TATTTTTTAAGGAAGGCTGATGG + Intronic
1046672658 8:117073859-117073881 AATTATTTGTGGAGGGCTGACGG - Intronic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1047549290 8:125852162-125852184 TATTCCTGATGGAGGGCAGGGGG - Intergenic
1050255009 9:3785213-3785235 TATTTGTTATGGTGGGCAGTGGG + Intergenic
1052502271 9:29306866-29306888 TATTTTTTTTGGAGGGAAGTGGG - Intergenic
1057068990 9:92079723-92079745 TACTCTTTATGCAGGGGAGATGG - Intronic
1058555726 9:106164465-106164487 CATTGTTTTTGGAGAGGAGAGGG + Intergenic
1059767510 9:117397539-117397561 CATGGTTTATGGAAGACAGATGG + Intronic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1061444685 9:130631192-130631214 GAGTGTTGATGGAGGACAGATGG + Intronic
1187058720 X:15765435-15765457 TAGTGTCTATGGAAGACAGAAGG + Intronic
1187662768 X:21568600-21568622 TTTTTTTGATGGAGGGAAGAGGG + Intronic
1189058003 X:37719927-37719949 TTTTGTTTATGGCAGTCAGATGG + Intronic
1189760163 X:44314169-44314191 TATTTTTTATGCAGGGCTGTGGG - Intronic
1190035825 X:47022907-47022929 TATTGTTTATGGTTGGGAAATGG + Intronic
1192175097 X:68880411-68880433 TATGGTTGGTGGAGGTCAGAAGG + Intergenic
1193864184 X:86709381-86709403 TAATTTTTGTGAAGGGCAGATGG - Intronic
1195544971 X:106103986-106104008 AAGTGTTTATTGAGGGCAAAGGG + Intergenic
1196074250 X:111557522-111557544 AATTGTTTATGGATGACAAAAGG + Intergenic
1196556213 X:117087571-117087593 CATTGTCTCTGGATGGCAGAGGG - Intergenic
1198058540 X:133020287-133020309 TATAGTTTCTGTAGGGCACAAGG + Intergenic