ID: 925104428

View in Genome Browser
Species Human (GRCh38)
Location 2:1278389-1278411
Sequence TGCTGTTTATGGAGGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925104423_925104428 0 Left 925104423 2:1278366-1278388 CCATATCAGTTACTGCACCAGGT 0: 1
1: 0
2: 3
3: 7
4: 90
Right 925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG 0: 1
1: 0
2: 1
3: 7
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925104428 Original CRISPR TGCTGTTTATGGAGGGCACC AGG Intronic
900420517 1:2554116-2554138 TGCTGGTAATGGTGGGCCCCGGG + Intergenic
902694333 1:18130080-18130102 TGCTGAGTATGGGCGGCACCAGG + Intronic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
909607102 1:77518715-77518737 TGTTGCTTACTGAGGGCACCAGG - Exonic
911067946 1:93808668-93808690 TTTTGTTTTTGGAGGGCAGCTGG + Intronic
911484310 1:98486500-98486522 GGCTGTTTCTGCAGGGAACCAGG - Intergenic
913401603 1:118440558-118440580 AGATATTTATGGAGGCCACCTGG - Intergenic
915820867 1:159022311-159022333 TGCTATTTATTTATGGCACCAGG - Intronic
917860346 1:179137892-179137914 TGCTGTGGATGTAAGGCACCCGG - Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
923445428 1:234066419-234066441 TGCTGTTTCTGGATCCCACCAGG + Intronic
1067297251 10:44982008-44982030 TGCTGCTGTTGGAAGGCACCGGG + Intronic
1069179319 10:65336956-65336978 TGCTGCTTCTGGAAAGCACCAGG - Intergenic
1069590007 10:69635712-69635734 TGGAATTTGTGGAGGGCACCAGG - Intergenic
1069981672 10:72256973-72256995 GGCTTTTTGTGCAGGGCACCAGG + Intergenic
1074946730 10:118287178-118287200 AGCTGTTTGAGGAGTGCACCAGG + Intergenic
1075086721 10:119418770-119418792 AGCTGTTTAAGGAGACCACCTGG + Intronic
1077441199 11:2570072-2570094 TGCTTATCACGGAGGGCACCCGG + Intronic
1077709636 11:4523150-4523172 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
1079371469 11:19856838-19856860 TCCTGCTTATGGATGCCACCAGG + Intronic
1081392226 11:42542408-42542430 TGCTGTTTAGGCAGTGCAGCTGG - Intergenic
1083487423 11:62992340-62992362 TGCTGTGGCTGGAGGGAACCGGG + Intronic
1083893771 11:65610179-65610201 AGGTGGTCATGGAGGGCACCTGG - Intronic
1083925604 11:65804213-65804235 TGCTGGTTAGGGAGGGCAGGAGG - Intergenic
1087876925 11:103369786-103369808 TGCTGGTTATGCAGGGCACAAGG - Intronic
1088985168 11:114899445-114899467 TGCTGATTATGCAGGGCCCAGGG - Intergenic
1090279668 11:125445153-125445175 TGCTGTTCATGGAGGGCCGCGGG + Intergenic
1091124807 11:133084291-133084313 TGATGTTTATGGAGTGCGCAGGG - Intronic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091595804 12:1878423-1878445 TGCTGTTTGTGCTGGGCATCTGG + Intronic
1099268103 12:80473836-80473858 TGCTTTTTATAGAGGGCAAATGG - Intronic
1104641585 12:130470589-130470611 TGATGTTTATGAAGTGCGCCTGG - Intronic
1111651411 13:91094983-91095005 GGCTGTTTCTGGATGGGACCTGG - Intergenic
1112618902 13:101034858-101034880 TGCTGTTTATTCAGGGCCCACGG + Intergenic
1114057603 14:18986378-18986400 TTCTGTTCAGGGAGGGAACCAGG + Intronic
1114104943 14:19415376-19415398 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1115516204 14:34187671-34187693 TGTTCCTTATGGAGGGCACAGGG + Intronic
1116403424 14:44538283-44538305 AGATGTTTCTGGAAGGCACCAGG + Intergenic
1116991699 14:51284160-51284182 TTCTGTGCATGGAAGGCACCGGG - Intergenic
1123497862 15:20847875-20847897 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1123555092 15:21421502-21421524 TTCTGTTCAGGGAGGGAACCAGG - Intronic
1123591338 15:21858834-21858856 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1126852038 15:52803406-52803428 TGTGGTTTATGCAGAGCACCCGG - Intergenic
1127103027 15:55587413-55587435 TGCTGTTGAAGAAGGGCTCCTGG - Intronic
1127546053 15:59995167-59995189 TGCTGTCTACAGAGGGCACTTGG + Intergenic
1128313557 15:66646388-66646410 TGCTGACTCTGGAGGGCATCTGG + Intronic
1131983192 15:98016162-98016184 TCCTGTAAATGGAGAGCACCTGG - Intergenic
1202963439 15_KI270727v1_random:148712-148734 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1135194675 16:20384667-20384689 AGCTGTTTTTTGAGGGCAACAGG - Exonic
1135618469 16:23932573-23932595 TGCTGTTGATGGAGGCTAGCTGG - Intronic
1137854439 16:51779606-51779628 TACTGTTTTTAGAGGGCACTTGG + Intergenic
1139587316 16:67912376-67912398 TGGTGTCTATGGAAGGCACTGGG + Intronic
1142284138 16:89164902-89164924 TGCTGGACACGGAGGGCACCAGG - Intergenic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1148169848 17:45509794-45509816 TGCTGCTGATGGTGGGCATCAGG - Intergenic
1148177205 17:45577168-45577190 TGCTGTTTCTTCACGGCACCGGG + Intergenic
1148279361 17:46336014-46336036 TGCTGCTGATGGTGGGCATCAGG + Intronic
1148301578 17:46553869-46553891 TGCTGCTGATGGTGGGCATCAGG + Intronic
1148365511 17:47052871-47052893 TGCTGCTGATGGTGGGCATCAGG + Intergenic
1148550201 17:48545618-48545640 TGTTGTTTTTGGAGGGTAACAGG - Intergenic
1149075692 17:52594706-52594728 TGCTGATTATTCAGGGCCCCAGG + Intergenic
1150400929 17:64855392-64855414 TGCTGCTGATGGTGGGCATCAGG - Intronic
1152450805 17:80378374-80378396 TACTGTGTATGGAGGGCTCTAGG - Intronic
1156368578 18:36451994-36452016 TGCTGCTTGTGGAGGGCAAAGGG - Intronic
1156898173 18:42270314-42270336 TTCTATTGATGGAGGGCACAGGG + Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160985641 19:1837354-1837376 GGCTGTGCATGGAGGGCCCCGGG - Intronic
1163203022 19:15781908-15781930 TGCACTTTATGTAGAGCACCTGG - Intergenic
1163361450 19:16848953-16848975 TGGCATTTATGCAGGGCACCCGG + Intronic
1163706000 19:18813712-18813734 TGCTGTACATGGAGGGTCCCGGG + Intergenic
1166799736 19:45449297-45449319 TGCTGTGTATTGAGTGCACCGGG + Intronic
1167666289 19:50824171-50824193 TGCTGGTGTTTGAGGGCACCAGG - Intergenic
925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG + Intronic
925104421 2:1278317-1278339 TGCTGTTTATGGAGGGTACGAGG + Intronic
925104428 2:1278389-1278411 TGCTGTTTATGGAGGGCACCAGG + Intronic
925864394 2:8213485-8213507 CGCTGTTTAGAGAGAGCACCAGG + Intergenic
930301745 2:49624500-49624522 TGCTGTATATGCAGGGTAACTGG + Intergenic
931220932 2:60287178-60287200 GGCTTTTTATGTAGGGTACCAGG - Intergenic
934717240 2:96551152-96551174 TGCTGTTCCTGGGGGGCTCCTGG - Exonic
935045112 2:99475050-99475072 TGCTGTTTCTTTATGGCACCGGG - Intronic
936042036 2:109157373-109157395 TGATTTTTATGGATGGCACGTGG - Intronic
937512488 2:122611727-122611749 TGCTGGTTATTCAGGGCACAAGG - Intergenic
938283553 2:130087158-130087180 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938284692 2:130101504-130101526 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938334187 2:130475722-130475744 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938335331 2:130490059-130490081 TTCTGTTCAGGGAGGGAACCAGG - Intronic
938354491 2:130630608-130630630 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938355635 2:130644940-130644962 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938430914 2:131237388-131237410 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938432054 2:131251733-131251755 TTCTGTTCAGGGAGGGAACCAGG + Intronic
938475726 2:131610342-131610364 TTCTGTTCAGGGAGGGAACCAGG + Intergenic
939644164 2:144675877-144675899 TGCTGATCAAGGAGAGCACCTGG - Intergenic
940894078 2:159063658-159063680 TGCTATTTATGGAGGAAAACAGG + Intronic
942312379 2:174667629-174667651 TGCTGGTGATGCAGAGCACCAGG + Intronic
942391801 2:175502734-175502756 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
944851807 2:203727304-203727326 AGCTGTTACTTGAGGGCACCTGG - Intronic
948823816 2:240564679-240564701 TCCTGGCTGTGGAGGGCACCTGG + Intronic
1168742089 20:200567-200589 TGCTGGTTATTCAGGGCACAAGG + Intergenic
1173333544 20:42095406-42095428 TGCTGTTCCTCAAGGGCACCAGG + Intronic
1174926185 20:54762722-54762744 TGCTGTTTTTAGAGAGTACCGGG + Intergenic
1175961710 20:62640611-62640633 TGCTGCCTGTGGAGGGCTCCCGG - Intergenic
1176293682 21:5059425-5059447 TGCTGCTCATGGAAGGCAGCCGG + Intergenic
1176818304 21:13629049-13629071 TTCTGTTCAGGGAGGGAACCAGG + Intronic
1178610845 21:34078156-34078178 AGCTGTTTAGGGAGGGCCCATGG - Intronic
1179110551 21:38441874-38441896 TGCTGTTCATGAAGGGAACAAGG - Intronic
1179783945 21:43719309-43719331 GGCTCTGTATGGAGAGCACCCGG - Exonic
1179863577 21:44204223-44204245 TGCTGCTCATGGAAGGCAGCCGG - Intergenic
1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG + Intronic
1183098753 22:35570573-35570595 GGCTGTTAGTGGAGGGCCCCTGG + Intergenic
1184701918 22:46180940-46180962 TGCTGTCTAGGAAGGACACCGGG - Intronic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185275015 22:49947004-49947026 TGCTGGTTATGGGGAGAACCTGG - Intergenic
950036965 3:9893122-9893144 TGCTGATCATGGAGAGCACCAGG - Exonic
950631189 3:14283323-14283345 TGCTGTTTCTGGTGGGCACAGGG - Intergenic
951719880 3:25687224-25687246 TCATGTTTATTGAGGGCACTAGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957621881 3:82604517-82604539 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
961057954 3:123804766-123804788 TGCAGTTTAGGGGAGGCACCAGG + Intronic
961146526 3:124598498-124598520 TTCTGATTATTGAGGGGACCAGG - Intronic
962777022 3:138671258-138671280 TGCTGTTTATTGACTGAACCAGG - Intronic
962806824 3:138933417-138933439 TGCATTTTCTGGAGGCCACCTGG + Intergenic
964021754 3:152021685-152021707 TGCTGGTTATTCAGGGCACAAGG - Intergenic
967282295 3:187834001-187834023 TGCTGTGTATCCAGGGGACCTGG + Intergenic
967830918 3:193919587-193919609 TGCTGTTTATGAAGGGGATGTGG - Intergenic
969710155 4:8838580-8838602 TTCTGTTTATGGAGTGCCTCAGG - Intergenic
970511309 4:16784516-16784538 TGCTCTTTATGGAGGGGAAGAGG - Intronic
972908389 4:43780725-43780747 TACTTTTTATTGATGGCACCAGG - Intergenic
975685204 4:76913884-76913906 TGTGGTTTATGGGGGGCACAGGG - Intergenic
975931248 4:79525790-79525812 TAATGTTTATGGAAGGCATCAGG + Intergenic
979888767 4:126063896-126063918 TGCTGTTTCTTTACGGCACCGGG - Intergenic
982051461 4:151506552-151506574 TGCTGTATGTGGAGGTCACATGG + Intronic
982847304 4:160270159-160270181 TTCTGTTGAAGGAGGGCACAGGG - Intergenic
982932213 4:161422942-161422964 AGCTGTTTATGGAGACCACAAGG + Intronic
984759550 4:183351850-183351872 TGCTGTTTAGGGAGTTCTCCAGG + Intergenic
986077915 5:4357153-4357175 TGCTGTTTCTGGAGAGCCCAGGG + Intergenic
990214251 5:53513399-53513421 TGCTGGTTATGCAGGGCCCAAGG + Intergenic
991028222 5:62053166-62053188 TACTGTTTATTGAGTGCTCCTGG - Intergenic
994974088 5:106779940-106779962 TGCTGGTTATTCAGGGCACAAGG - Intergenic
995958215 5:117806316-117806338 AGCTGTTTATGGTAGGCCCCGGG + Intergenic
1000278226 5:159758600-159758622 AACTGGTTATGGAGGGAACCGGG - Intergenic
1001148488 5:169205284-169205306 TTCTGTTGATGGAGGAAACCAGG - Intronic
1002825058 6:764968-764990 TGCTGTTGATGGAGGGTATAGGG + Intergenic
1003116137 6:3284953-3284975 TGCAGTTCTTGGAGGGCAACGGG + Intronic
1003371952 6:5537272-5537294 TGCTGTCTGTGGAAGGCACTGGG - Intronic
1006051264 6:31346545-31346567 TCCTGTTTATGGATTGCACTGGG + Intronic
1007117913 6:39356841-39356863 TGGTGTTTTTGGAGGCTACCTGG + Intronic
1012931788 6:105325159-105325181 TTGTGTTTGTGGGGGGCACCGGG - Intronic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1018390119 6:163335645-163335667 TGCTGTTCATGGAGGGTCCTGGG + Intergenic
1022644738 7:32219653-32219675 TGATGCTTATGGTGGCCACCAGG - Intronic
1023188212 7:37552866-37552888 TGCTGTTTTTAGAGGTCCCCTGG - Intergenic
1023703168 7:42912155-42912177 CCATGTTTATTGAGGGCACCTGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025820341 7:64956499-64956521 AGCTGCTTATGGAGGACACATGG - Intergenic
1031467023 7:122125361-122125383 TGCTGTTTCTTTACGGCACCAGG - Intronic
1031894836 7:127336972-127336994 TGCTCTTCATGTAGGGCACGAGG + Intergenic
1035281848 7:157783648-157783670 TGCTGTTTCAAGAGGGCTCCTGG - Intronic
1036911750 8:12763350-12763372 TCCTGTTTATAGAGGGTGCCTGG + Intergenic
1037656226 8:20886612-20886634 TGGTGATTATGGACGGCACTTGG + Intergenic
1038840853 8:31183448-31183470 TACTGTTTCTGGAAGACACCAGG + Intergenic
1040598442 8:48861988-48862010 TGCTTTTCAAGGAGGGCACTTGG + Intergenic
1041738251 8:61133472-61133494 GGCTGTTTATGGAGGTGAGCTGG + Intronic
1043724304 8:83590459-83590481 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
1044377141 8:91488898-91488920 TGCTGTTTTTTGAATGCACCAGG - Intergenic
1047344149 8:124010832-124010854 TGCTGCATTTGGAGGGCACGTGG + Intronic
1048926093 8:139272746-139272768 TGCTGATAATGGAGAGCACTTGG + Intergenic
1049461754 8:142732907-142732929 TGCTGTTTCTTTACGGCACCGGG - Intronic
1049748530 8:144273053-144273075 CGCTGCTTGTGGAGGGCGCCCGG - Intronic
1050842189 9:10165089-10165111 TTTTGTTTCTGTAGGGCACCAGG - Intronic
1051079919 9:13281807-13281829 TGCTGTTTAAAGAGGGCATGTGG - Intergenic
1055982086 9:82014114-82014136 TGTTATTCATGGTGGGCACCTGG + Intergenic
1056396297 9:86184374-86184396 TGGTGTTTGTGGGGGCCACCAGG + Intergenic
1058327313 9:103715050-103715072 TGATCTCTATGCAGGGCACCTGG + Intergenic
1059423475 9:114206687-114206709 CACTCTTTGTGGAGGGCACCTGG + Intronic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1061470110 9:130817701-130817723 TGCTTTTTCTTCAGGGCACCAGG + Intronic
1061915603 9:133751595-133751617 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
1203529055 Un_GL000213v1:120454-120476 TTCTGTTCAGGGAGGGAACCAGG - Intergenic
1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG + Intergenic
1185513903 X:683992-684014 TGCTGTTTCTTGATGGCACAGGG - Intergenic
1189929674 X:45996029-45996051 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1192065411 X:67879897-67879919 TGCTGCTTATTGAGGGCCCAAGG - Intergenic
1194841988 X:98754184-98754206 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1194921986 X:99778502-99778524 TGCTGTTTATTGAGGGCCCAAGG + Intergenic
1196609547 X:117695700-117695722 TGCTGGTTATTGAGGGCTCAAGG - Intergenic
1199115227 X:143984761-143984783 TGCTGGTTATTAAGGGCCCCGGG + Intergenic
1199277612 X:145964546-145964568 TGCTGCTTATGTAGGGCCCAAGG - Intergenic
1200076245 X:153552677-153552699 TTCTGTTGCTTGAGGGCACCAGG - Intronic
1202096043 Y:21249041-21249063 TGCTGTTAGGGAAGGGCACCGGG + Intergenic