ID: 925107513

View in Genome Browser
Species Human (GRCh38)
Location 2:1305504-1305526
Sequence TTGTAAACATAGAGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925107511_925107513 -3 Left 925107511 2:1305484-1305506 CCAAGGCATCAAGGGAAAATTTG 0: 1
1: 0
2: 0
3: 19
4: 204
Right 925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 190
925107508_925107513 13 Left 925107508 2:1305468-1305490 CCAATTAGAGTTTCTTCCAAGGC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925107513 Original CRISPR TTGTAAACATAGAGGAAGCC TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905431877 1:37930720-37930742 TTGTAAACTGAGAGGAAACGAGG - Intronic
906257515 1:44361640-44361662 TTGGAAAGATAAAGGGAGCCTGG - Intergenic
907687866 1:56631880-56631902 TTTTAAAAATAGAGGAAGATAGG + Intronic
907989049 1:59561265-59561287 TGGTAAACAAAGAGGAAGCGAGG - Intronic
908092859 1:60704903-60704925 TTATCAACATAGAGGAATCCTGG + Intergenic
908419197 1:63943197-63943219 TTGAAAAGATAAAGGAATCCAGG - Intronic
908953024 1:69585399-69585421 TTGAAGAGATAGAGGAATCCAGG + Intronic
910441755 1:87260223-87260245 TTGAAAGCTCAGAGGAAGCCAGG + Intergenic
910481035 1:87658666-87658688 TTGAAAAGATTGAGAAAGCCTGG - Intergenic
912195004 1:107387474-107387496 TAGTAAGCCTAGAGGAAGCCTGG + Intronic
912982376 1:114387150-114387172 TAATAAGCATAGAGGAAGCAAGG + Intergenic
917493559 1:175519454-175519476 GTGTAAAGATAAAGGAAGCATGG - Intronic
919205029 1:194410943-194410965 TTGTAGACATAAAGAAAGACAGG - Intergenic
919282199 1:195505010-195505032 CTGTAATGATAGAAGAAGCCAGG - Intergenic
920738826 1:208560693-208560715 CTGCAAAAATAGAGGATGCCTGG - Intergenic
922830786 1:228552856-228552878 TTGTAATAATAGAGAAACCCAGG - Intergenic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
923349216 1:233087263-233087285 GTGAAAAGAAAGAGGAAGCCAGG + Intronic
924725173 1:246663009-246663031 TTGTTAACATAGATGAAGTGGGG + Intronic
1064659831 10:17595607-17595629 TTGGAAGCATACAGGATGCCTGG - Intronic
1067543856 10:47177799-47177821 TTGTATTGAGAGAGGAAGCCCGG + Intergenic
1072565680 10:96614966-96614988 ATGTAAAAAGAGAGGATGCCAGG + Intronic
1074297540 10:112204439-112204461 TTGTAAAGATAGAGCAACACTGG + Intronic
1074603932 10:114941636-114941658 TTGTAAACATAAAGTGAGCCGGG - Intronic
1075096156 10:119472938-119472960 TGGAAACCATGGAGGAAGCCCGG - Intergenic
1077884656 11:6378001-6378023 TTTTAAACAGACAGGAAGCCAGG + Intergenic
1080574046 11:33582304-33582326 TTGAAATCAGAGAGGAAGACTGG + Intronic
1080944887 11:36959829-36959851 TTCTAAACACAAAGGAAGACAGG + Intergenic
1081242264 11:40721563-40721585 TTGTGGACACATAGGAAGCCTGG + Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1085883673 11:80497222-80497244 TTTAAAACATAGTGGAGGCCAGG - Intergenic
1086040631 11:82472912-82472934 TTGTTAACATTGGGGAAGCCTGG - Intergenic
1089047373 11:115514339-115514361 TTGTAAAGAAAGATGAAGGCAGG - Intergenic
1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG + Intergenic
1096226061 12:49867620-49867642 TTGTAAAGCTGGAGGCAGCCAGG - Exonic
1097862594 12:64533113-64533135 TTGGAAAAATACATGAAGCCAGG + Intergenic
1098538983 12:71630186-71630208 TTCAAAAAATAGAGGAAGGCTGG - Intronic
1099162941 12:79267724-79267746 TGGTAAACGTAAAGGATGCCAGG - Intronic
1099563139 12:84204626-84204648 TTTTAAAAATATAGGAGGCCTGG - Intergenic
1100103149 12:91134324-91134346 TTGTAAAGATAGAGACAGCCAGG - Intergenic
1100161159 12:91862532-91862554 TTGTGAACCTAAAGGAAGGCTGG - Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1100693881 12:97068933-97068955 TTGTAACAATAGATGAAACCTGG - Intergenic
1101164364 12:102012971-102012993 TTTTTAACATAGAAGAAGCTTGG + Exonic
1101581699 12:106047681-106047703 TTGGGAATATAGAGGAAGCAAGG - Intergenic
1108118277 13:47154381-47154403 TTATAGACATAGAGCAAGCAGGG + Intergenic
1108809798 13:54208214-54208236 TAGTAGTCATAGAGGAAGCCTGG - Intergenic
1111184692 13:84718292-84718314 TTGTAAATAAATAAGAAGCCAGG - Intergenic
1111554163 13:89858085-89858107 CTGTAATCATTGAGGAAGACAGG + Intergenic
1113096373 13:106668326-106668348 GTGTGAACATAGAGGAAGCTGGG - Intergenic
1114250515 14:20956062-20956084 TTGTCACCACAGTGGAAGCCAGG + Exonic
1116602844 14:46949130-46949152 TTTTACAGATAGAGGAAGCAAGG + Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1120307216 14:82785969-82785991 TTCTAAAAAGAGAGGAAGCCTGG - Intergenic
1123792475 15:23736106-23736128 TTTTAAACATAGAGGAGAACAGG + Intergenic
1123913561 15:24996731-24996753 TTAGAAAGATAGAGGAAGACAGG + Intergenic
1128791379 15:70436985-70437007 GTGTATACATAGAGGAAGTTTGG + Intergenic
1129984121 15:79901894-79901916 TTTTAAAGATACAGGCAGCCAGG + Intronic
1129991109 15:79964306-79964328 TTTTAAAGATACAGGCAGCCGGG + Intronic
1131167009 15:90149516-90149538 ATGTAAACAAAGAGAAAGCCAGG - Intergenic
1131715902 15:95110514-95110536 TTATAAAGAAAGAGGCAGCCGGG - Intergenic
1132609480 16:808152-808174 TTGTAAACCAAGAAGTAGCCGGG + Intronic
1134013766 16:10874322-10874344 GTTTCAACAGAGAGGAAGCCTGG + Intergenic
1134905438 16:17975939-17975961 TGGTAATCATAGAGGTGGCCTGG - Intergenic
1135680424 16:24452171-24452193 TTGGAGACATAAAGAAAGCCAGG + Intergenic
1136519842 16:30788139-30788161 TTACAAACACAGAGGAATCCTGG + Intergenic
1138881884 16:61026519-61026541 TTTTAAACATAGTTGAATCCAGG - Intergenic
1142646508 17:1317128-1317150 ATGAAAACACATAGGAAGCCGGG + Intergenic
1144891930 17:18499300-18499322 CTGCAAACATAGAGGTGGCCCGG + Intergenic
1145030251 17:19499708-19499730 TTGTGAGCATTGAGGAAGCATGG + Intronic
1145140292 17:20445017-20445039 CTGCAAACATAGAGGTGGCCCGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1154279463 18:12990088-12990110 TTTTTTCCATAGAGGAAGCCAGG - Intergenic
1158903528 18:61988295-61988317 TTCTACAGTTAGAGGAAGCCAGG - Intergenic
1164759592 19:30719113-30719135 TTGTAAACAAAGAAAAAGGCAGG - Intergenic
1165250225 19:34526599-34526621 TTGAAAATATACAGTAAGCCAGG + Intergenic
1165345620 19:35247658-35247680 TTGGAAACAGCGAGGAGGCCAGG + Intergenic
1165639585 19:37372767-37372789 TTGTAAAAATAGAGACAGGCTGG - Intronic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925554297 2:5113036-5113058 TTGTGAGCATATAGGAAGCAAGG + Intergenic
929904872 2:46036904-46036926 TTGTAAAACCAGTGGAAGCCTGG + Intronic
932547282 2:72726778-72726800 TTGTAAAGATAGAAGGAACCAGG + Intronic
933149487 2:78896732-78896754 TTGTAAATAAAGGGAAAGCCCGG + Intergenic
933252175 2:80041225-80041247 TTATAATCATAGAGGAAGGTAGG + Intronic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
935117686 2:100151115-100151137 TGCTAAACATAAAGGAAGCAGGG - Intergenic
936024232 2:109019092-109019114 TTGTAGCCACAGAGGAGGCCCGG + Intergenic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
937565806 2:123287008-123287030 TTGTAAACACAGAGAAACACAGG + Intergenic
939498074 2:142947960-142947982 TTGTAAATAAAGAGGCACCCAGG - Intronic
940857038 2:158737347-158737369 TTGCAAAGCTGGAGGAAGCCAGG - Intergenic
941649363 2:168077304-168077326 TTGTAAACATAGAGCCAGAGGGG - Intronic
942274838 2:174313228-174313250 TTGTAAAGATAGAAGAGACCCGG - Intergenic
942963734 2:181864122-181864144 TTCTAAAAATAGTGGGAGCCAGG - Intergenic
946728525 2:222686029-222686051 TTTTAATCATAGAGTGAGCCAGG - Intronic
947352891 2:229264791-229264813 TTGTAAACTTAGAGGACTCACGG - Intronic
1170550855 20:17474777-17474799 TTGTAAAGATAGATGTAGGCCGG - Intronic
1172075720 20:32295586-32295608 TTGTAAACATAAGGTCAGCCAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174996897 20:55579947-55579969 TTGTAAGCAGTAAGGAAGCCAGG + Intergenic
1175536722 20:59719923-59719945 TTGAAAACATGGAGAAAGCCTGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177403182 21:20632667-20632689 TTTTAAAAAAAGAGGAAGCAAGG - Intergenic
1177579806 21:23006717-23006739 TTTTAAAGATAGACAAAGCCAGG + Intergenic
1179314007 21:40225238-40225260 TTGTAAACAGAAATGAAGGCAGG - Intronic
1182411683 22:30192365-30192387 TTGTATACATAGAGTCAGACAGG + Intergenic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
1184199810 22:42960523-42960545 TTGTAAAAATTGAAGAAGCGAGG - Intronic
949688369 3:6604625-6604647 TTTTAAACATGAAGGAAGCGAGG - Intergenic
950837512 3:15935052-15935074 TTGTAAATATAGTGGAAGAAAGG + Intergenic
951682513 3:25309432-25309454 TTGTAAGAATAGAGGAGGCCGGG - Intronic
956449808 3:69363118-69363140 GTGGAAAAATAGAAGAAGCCTGG - Intronic
957762567 3:84577642-84577664 TTCTAAACAAAGAAGAATCCAGG + Intergenic
961842850 3:129731918-129731940 TTTAAAACATATGGGAAGCCAGG - Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962357997 3:134711381-134711403 CAGGAAACATAGAGGAATCCAGG - Intronic
965364571 3:167783043-167783065 TTGTAAACATAGGAATAGCCTGG + Intronic
965991437 3:174823734-174823756 TTTTAATCTCAGAGGAAGCCAGG + Intronic
966396582 3:179510124-179510146 TTGTAAAAAAAAAAGAAGCCTGG - Intergenic
966781416 3:183587568-183587590 TTGTAACGAAAGAGGAAGACAGG + Intergenic
966838297 3:184066870-184066892 TTAAAAATATGGAGGAAGCCTGG - Intergenic
967084513 3:186081816-186081838 TTGTAAGCACAAAGGTAGCCAGG - Intronic
969858318 4:10017634-10017656 TACAAAACATAGGGGAAGCCTGG - Intronic
970722216 4:19001119-19001141 TTGTAGGCTTAGATGAAGCCTGG + Intergenic
971559144 4:28052578-28052600 TTGTAAAGAAAAAGGAAGACTGG + Intergenic
971603363 4:28624643-28624665 TTGTCAACATAGCAAAAGCCCGG - Intergenic
971652257 4:29293371-29293393 CTTTGAAGATAGAGGAAGCCAGG - Intergenic
976241860 4:82966488-82966510 TTGCAAACATGGAGAATGCCAGG + Intronic
976633852 4:87267581-87267603 TTGAAAAGAAAGAGGAGGCCAGG + Intergenic
977323073 4:95544455-95544477 TAGTAAACATAGGTGAAGCTAGG - Intronic
979159725 4:117444518-117444540 TTTTAAACATAAAGGAATGCTGG + Intergenic
980372373 4:131892925-131892947 TTGAAAACATAGTTGAGGCCAGG + Intergenic
982992143 4:162289952-162289974 TTTTAATCATAGAGGAATGCTGG - Intergenic
983641774 4:169950054-169950076 TTGTCAACATAGAAAAAGCTAGG - Intergenic
984077537 4:175201887-175201909 TTGTAAATCTAGAGGAAGAAAGG - Intergenic
985326612 4:188777757-188777779 TTGTAAACTTAGCAGAGGCCGGG + Intergenic
986825040 5:11511397-11511419 GTGGTAACAAAGAGGAAGCCAGG + Intronic
987271986 5:16319532-16319554 TTGTAAATGGAGAGTAAGCCGGG - Intergenic
987867007 5:23555186-23555208 TTTTAAAGATAGATGAAGCAAGG - Intergenic
990128068 5:52543506-52543528 TTGTAAAGACAGAGAAAGCCAGG - Intergenic
990894238 5:60680873-60680895 TTGTGAAAATAGAGGCAGCCTGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992160861 5:74000192-74000214 TTGTAAAGAGAGATGAAGGCTGG - Intergenic
992283420 5:75206080-75206102 TTATAAACATATAGTAAGCCAGG + Intronic
992660442 5:78954941-78954963 TTGTGACCATAGAGGATGTCTGG + Intronic
998092713 5:139380532-139380554 ATGTAAGCATAGAAGAGGCCGGG - Exonic
998397340 5:141827145-141827167 TTGGAGACATTGAGGAAGACAGG + Intergenic
999128046 5:149261143-149261165 TTGTAAACATAGAGGACACATGG - Intergenic
1002651194 5:180696503-180696525 TTGTTAACAGATAGGAAGCAAGG - Intergenic
1003350052 6:5308208-5308230 TTGTAAACATCCAGGCACCCTGG - Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622824 6:27635670-27635692 TTGTAAACTCTGATGAAGCCGGG - Intergenic
1007316547 6:40993830-40993852 AAGGAAACATTGAGGAAGCCAGG - Intergenic
1013817592 6:114117317-114117339 TAGAAAACACAGAGGTAGCCTGG + Intronic
1014126266 6:117780145-117780167 GTGTAACCTTATAGGAAGCCTGG - Intergenic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1015816076 6:137212207-137212229 TTGGAAACCTAGAGGAAGGGGGG - Intronic
1017336360 6:153265096-153265118 TTGTTAAGATAGAGGAAACTGGG + Intergenic
1019758361 7:2789816-2789838 TTGCAGCCACAGAGGAAGCCAGG + Intronic
1021397927 7:20173134-20173156 TTATAAAAATAAATGAAGCCTGG - Intronic
1022297590 7:29070575-29070597 TTGTAAACACAAAGGAAGAGGGG - Intronic
1022499319 7:30872681-30872703 GTGCAAACATAGAAGAGGCCAGG - Intronic
1025064700 7:55843324-55843346 ATGTAAACATAGAGGAAAGCTGG + Intronic
1025981311 7:66409163-66409185 TTCTAAACATACAGGAACTCGGG + Intronic
1026073568 7:67144763-67144785 TTAAAAACAAAGAGGAGGCCAGG - Intronic
1026193096 7:68147559-68147581 TTGCAAAAATCGTGGAAGCCAGG - Intergenic
1026703317 7:72667417-72667439 TTAAAAACAAAGAGGAGGCCAGG + Intronic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1030985577 7:116238101-116238123 TTGTATACTTACAGAAAGCCAGG + Intronic
1034651162 7:152691337-152691359 TTGTAATCTTAGAGGAAGCATGG + Intergenic
1038327112 8:26579576-26579598 TTGTGCACGGAGAGGAAGCCGGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039268695 8:35856550-35856572 TTGTAATCATAAAGGAATGCTGG - Intergenic
1039832060 8:41223276-41223298 TTGTAAAGATAAGGGAAGGCCGG + Intergenic
1040670797 8:49687896-49687918 TTTTAATCATAAAGGAATCCTGG + Intergenic
1041259719 8:56010414-56010436 TTGTAAACATAGAGCTAGTTGGG - Exonic
1041829435 8:62137266-62137288 TTGTAAACATTCAAGAACCCAGG - Intergenic
1043565125 8:81539142-81539164 TTTAAAACATAAAGGTAGCCAGG - Intergenic
1044152372 8:88797442-88797464 TTTAAAACTTAGAGGAGGCCAGG + Intergenic
1045061199 8:98412737-98412759 TTTTTAACATAGAAGAAGCTCGG + Intronic
1045813859 8:106256903-106256925 TTGTAACCATAAAGGAATGCTGG + Intergenic
1047034543 8:120922820-120922842 TTTTAAAGATAGAGGATGCTTGG + Intergenic
1047136499 8:122084929-122084951 TTTAAAACATAGAAGAGGCCGGG + Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051172414 9:14332035-14332057 TTAAAAACCAAGAGGAAGCCAGG + Intronic
1051943839 9:22541841-22541863 TGATAAACATCAAGGAAGCCAGG + Intergenic
1052444122 9:28537513-28537535 TTATAAACAGAGAGGAATGCTGG + Intronic
1053464353 9:38294365-38294387 TTCTAAAAATAGAGAAAACCTGG - Intergenic
1054991738 9:71335738-71335760 TTGTAAACATAAAGAATGTCAGG + Intronic
1055037719 9:71836196-71836218 CTGTAAAGAAAGAGGTAGCCAGG - Intergenic
1056591013 9:87966085-87966107 TTTTAAAAATAAAGGGAGCCTGG + Intergenic
1056963188 9:91144561-91144583 TTGTAAACTGAAAGGAACCCTGG + Intergenic
1058590252 9:106557890-106557912 TGGTGAACAAGGAGGAAGCCAGG - Intergenic
1062693764 9:137860454-137860476 TAGTAAACATATATGAAACCAGG - Intronic
1185949007 X:4409982-4410004 TTTTAAACTTAGAGGAGGCTGGG + Intergenic
1188829986 X:34884425-34884447 TTGTAAACCTAGAGAAAAACAGG + Intergenic
1189607948 X:42699859-42699881 TTGATATCACAGAGGAAGCCTGG + Intergenic
1190027125 X:46934729-46934751 TTATAAACATAGAAGAAGGCCGG - Intronic
1190814586 X:53918535-53918557 TTTTAAACATAAAAGAAGACTGG - Intergenic
1192403273 X:70858619-70858641 TTTTAAACATAGAGGATGCTTGG - Intronic
1194492266 X:94566658-94566680 TTTAAAACATAAAGGAGGCCAGG - Intergenic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1195966272 X:110432771-110432793 TTGGAAACATTCAGGAAGCAGGG - Intronic
1197670292 X:129269370-129269392 TTGAAAACCTAGAAGAAGGCCGG - Intergenic
1199471330 X:148199052-148199074 TTGTCCACTCAGAGGAAGCCTGG + Intergenic
1200832386 Y:7699760-7699782 TGGAAAACAGAGAAGAAGCCGGG + Intergenic
1200953786 Y:8925682-8925704 TTGTAAACATAAAGCATTCCAGG - Intergenic
1200957628 Y:8968057-8968079 TTGTAAACATAAAGCATTCCAGG - Intergenic
1202196167 Y:22300169-22300191 TTGTAAACATAAAGCATTCCAGG + Intergenic
1202231905 Y:22667076-22667098 TTGTAAACATAAAGCATTCCAGG - Intergenic
1202311251 Y:23529082-23529104 TTGTAAACATAAAGCATTCCAGG + Intergenic
1202559551 Y:26141512-26141534 TTGTAAACATAAAGCATTCCAGG - Intergenic