ID: 925109150

View in Genome Browser
Species Human (GRCh38)
Location 2:1318908-1318930
Sequence CTCTGTCATCCCCGGGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925109142_925109150 5 Left 925109142 2:1318880-1318902 CCTGCGGTGTCCCCGTGGCTTTC 0: 1
1: 0
2: 0
3: 5
4: 104
Right 925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG 0: 1
1: 1
2: 2
3: 25
4: 234
925109144_925109150 -6 Left 925109144 2:1318891-1318913 CCCGTGGCTTTCTGAGCCTCTGT 0: 1
1: 1
2: 0
3: 48
4: 393
Right 925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG 0: 1
1: 1
2: 2
3: 25
4: 234
925109139_925109150 21 Left 925109139 2:1318864-1318886 CCATGAGGGTTTCACGCCTGCGG 0: 1
1: 0
2: 4
3: 55
4: 451
Right 925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG 0: 1
1: 1
2: 2
3: 25
4: 234
925109145_925109150 -7 Left 925109145 2:1318892-1318914 CCGTGGCTTTCTGAGCCTCTGTC 0: 1
1: 0
2: 4
3: 57
4: 485
Right 925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG 0: 1
1: 1
2: 2
3: 25
4: 234
925109143_925109150 -5 Left 925109143 2:1318890-1318912 CCCCGTGGCTTTCTGAGCCTCTG 0: 1
1: 1
2: 3
3: 26
4: 291
Right 925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG 0: 1
1: 1
2: 2
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925109150 Original CRISPR CTCTGTCATCCCCGGGGCTC AGG Intronic
900285075 1:1895153-1895175 CTTTGTCTTTCCCTGGGCTCTGG + Intergenic
900367364 1:2316666-2316688 CTCTGTCATCCGGGAGGCCCTGG + Intergenic
900779088 1:4605867-4605889 CTCTCTCCTCCCTGTGGCTCTGG + Intergenic
901022670 1:6262969-6262991 CTCAGTGAGCCCCTGGGCTCAGG + Intergenic
901160382 1:7172791-7172813 GGCTGGCATCCCCGGGGCCCTGG + Intronic
902448619 1:16483486-16483508 CTCTGTGATCCCCGCGCCCCAGG - Intergenic
902488840 1:16765837-16765859 CCCTGCTCTCCCCGGGGCTCTGG - Intronic
902705982 1:18204794-18204816 CTCAGTCATCCCCCTGCCTCTGG - Intronic
903280949 1:22249497-22249519 CTCGGTCTTCCCCAGGTCTCTGG - Intergenic
904254349 1:29245101-29245123 CTCTGTCCTGCCCTGGGCTGGGG + Intronic
904504266 1:30937894-30937916 ATCTGTAATCCCAGGTGCTCGGG - Intronic
905266020 1:36754996-36755018 CTCTGTAACCCCCTGGGCCCAGG - Intergenic
907557702 1:55359119-55359141 CTGTGGCATCCCTGGAGCTCTGG - Intergenic
907938777 1:59066905-59066927 CTCTGCCTTCCCCAGGGCTGTGG + Intergenic
909136218 1:71803546-71803568 CTCTGACATTTCCGTGGCTCAGG + Intronic
912507084 1:110163745-110163767 CTCATTCTGCCCCGGGGCTCTGG + Intronic
917153149 1:171965976-171965998 TTCTGTCATCCCCATGACTCAGG + Intronic
918212102 1:182360138-182360160 CCCTGTCATCCCAGCTGCTCAGG + Intergenic
918518894 1:185392841-185392863 CCCTGTAATCCCAGGGACTCAGG - Intergenic
919678699 1:200411681-200411703 CTCTCTCCTCCCCGGAGGTCGGG - Intergenic
919834191 1:201562510-201562532 CCCTGTCCTGCCCAGGGCTCAGG - Intergenic
923531596 1:234816687-234816709 CCCTGCTCTCCCCGGGGCTCTGG + Intergenic
923630284 1:235645126-235645148 CTCTGTCTTCCCAGAGGGTCAGG - Intronic
924762857 1:247005630-247005652 CTCTGTCATCCCCTGGGCTCAGG - Intronic
1066431113 10:35352739-35352761 CTCTGCCATCCAGGGGACTCTGG - Intronic
1070832810 10:79430715-79430737 CTCTGCTATCCCCGGGCCTCTGG + Intronic
1070968107 10:80542280-80542302 CTCAGTCATCCCAGGTTCTCAGG + Intronic
1070976703 10:80611048-80611070 CCCTGTCATCCCAGGTACTCAGG + Intronic
1071564042 10:86662478-86662500 CTCAGGCAGCCCTGGGGCTCTGG + Intronic
1074534103 10:114316195-114316217 CTCTGGCATTCCAAGGGCTCAGG + Intronic
1074845051 10:117390420-117390442 CTCTGTCATTCCAGTTGCTCAGG + Intergenic
1075852809 10:125602964-125602986 TTCTGTCCTCTCCGGGGCTTGGG + Intronic
1076462204 10:130655180-130655202 GTCTGTCCTTCCCGGGGCTGCGG - Intergenic
1076618211 10:131770826-131770848 CTCTGTGCTCCCCTGGGCCCAGG - Intergenic
1076625035 10:131816439-131816461 CCCTGTCAGCCCCAGAGCTCCGG - Intergenic
1077165326 11:1132343-1132365 CTCTCCCATCCCCGGGTCCCAGG - Intergenic
1077900131 11:6481144-6481166 CTCATCCTTCCCCGGGGCTCGGG + Intronic
1078089177 11:8253317-8253339 CTCTGTCCTCCCTGGGGTACTGG - Intronic
1078225098 11:9384730-9384752 CTCGGTCAAACCCGGGGCTCGGG - Exonic
1078602059 11:12741830-12741852 CACTGTGATCCCAGGAGCTCTGG - Intronic
1079088394 11:17463366-17463388 CTCTGTCCTGCCCTGGGTTCAGG - Intronic
1079996874 11:27304708-27304730 TTCTGTGCTCCCCAGGGCTCAGG + Intergenic
1081774389 11:45667354-45667376 CTCTGCCATCCCAGGTGCTGTGG - Intergenic
1083029824 11:59582290-59582312 CTCTTTCATCCCCAGAGGTCAGG - Intronic
1083272722 11:61580411-61580433 CGCTGGCACCCCCGGGGCACCGG + Intronic
1083745763 11:64735711-64735733 CTCTCTGTTCCCCGGGGCTCTGG - Intronic
1084940410 11:72609627-72609649 CTCTTTGATCCCCATGGCTCTGG - Intronic
1085394584 11:76200901-76200923 CTGTGTCTTTCCCTGGGCTCCGG + Intronic
1087258714 11:95986320-95986342 ACCTGTAATCCCAGGGGCTCAGG - Intronic
1089976012 11:122732100-122732122 CTTTGTCATCCTCAGGGCTAGGG - Intronic
1091018869 11:132080610-132080632 CTCTGTATTCCCTTGGGCTCTGG + Intronic
1091649106 12:2296400-2296422 CACTGCCATCCTCTGGGCTCTGG + Intronic
1096878849 12:54650938-54650960 CTTTGTCAATCCCAGGGCTCTGG + Intergenic
1097014358 12:55974530-55974552 CCCAGTCACCCCCGGGGCTCGGG - Intronic
1099810120 12:87569749-87569771 CACTGTCATCCCTGGGGCTAGGG - Intergenic
1102954606 12:117051415-117051437 ATCTGTCCTTCCCTGGGCTCAGG + Intronic
1103477795 12:121231452-121231474 TTCTGTCATCCCCCGGCCCCTGG + Intronic
1103568153 12:121827425-121827447 CTCTGTCATCCCCAGTGTCCTGG - Intronic
1103749748 12:123150774-123150796 CTCTGTCCTCTTCGGGGCCCCGG + Intergenic
1103874504 12:124116688-124116710 CTCTGTAATCCCGGCGACTCGGG - Intronic
1104270854 12:127280991-127281013 CTCTGCCAACCCCTGGGCACTGG + Intergenic
1104586718 12:130053692-130053714 GTCTGTCATTCCCCAGGCTCAGG + Intergenic
1104964740 12:132503815-132503837 CTCTGTCATTCCAAGAGCTCAGG - Intronic
1105209657 13:18250286-18250308 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1105733704 13:23246188-23246210 CTCTGTCATCTTCAGGTCTCTGG - Intronic
1106058330 13:26260443-26260465 CTCTGTTTTGCCTGGGGCTCTGG + Intronic
1109542603 13:63799807-63799829 CTCTGTCCTGCCCAGGGATCAGG + Intergenic
1110244048 13:73301589-73301611 CTCTGTCATCCCAGCGACTCAGG - Intergenic
1112114311 13:96335489-96335511 CTTTCTCATCCCTGTGGCTCTGG + Intronic
1113666045 13:112142711-112142733 CTCTGTCCTCCCCAGGGCTAAGG - Intergenic
1117844775 14:59899757-59899779 CTCAGTCTTCTCCGGGCCTCAGG - Intergenic
1119789877 14:77340596-77340618 CTGTGTCACCCCTGAGGCTCAGG - Exonic
1122214215 14:100192784-100192806 GTCTGACATCCCCGGGGCAGTGG - Intergenic
1122975879 14:105170514-105170536 CTCTGTCCACCCCCGGGCTGGGG - Intergenic
1123055149 14:105566029-105566051 CTCTGTCCTCCCCTGTGCCCAGG - Intergenic
1123079598 14:105685873-105685895 CTCTGTCCTCCCCTGTGCCCAGG - Intergenic
1124002812 15:25772764-25772786 CGCTGTCTTCCCTGGGGTTCCGG - Intronic
1128513381 15:68327148-68327170 CCCTGTCTTTCCCTGGGCTCTGG + Intronic
1128770599 15:70278840-70278862 CCTTCTCATCCCCGGGCCTCAGG - Intergenic
1129876759 15:78980738-78980760 CGCTGTGATCCCCGAGGCCCGGG + Intronic
1130337565 15:82970208-82970230 CTCTGTCCTCCCCCTGCCTCAGG - Intronic
1130517695 15:84638884-84638906 CTCTGTAATCCCAGCGACTCAGG - Intergenic
1132150399 15:99454575-99454597 CCCTGCCATCCCCGGGGCCCTGG - Intergenic
1132313864 15:100877183-100877205 CTCTGCCATCTCCGATGCTCAGG + Intergenic
1136068796 16:27775962-27775984 CTCTGTCCTCCCTGAGACTCAGG + Intronic
1136084558 16:27875497-27875519 CTCTGCCATTCCTGGGGCACCGG + Intronic
1138093227 16:54193571-54193593 CTCTGCCATCCCCCTGCCTCAGG - Intergenic
1139446251 16:67000465-67000487 CTCCGCCAGCCCCGGGGCCCAGG - Intronic
1139476099 16:67203272-67203294 CCCTGGCAGCCCCGGGGCCCAGG - Intronic
1140788574 16:78367616-78367638 CTTTGTAATCTCCTGGGCTCAGG + Intronic
1140881932 16:79206271-79206293 CTATGTCTTCCACGGGGCTCCGG - Intronic
1141157818 16:81609531-81609553 CTCTGTCTCCCCAGGGGCTGAGG - Intronic
1142879643 17:2874421-2874443 CTCCGTCAGCCCGGGGCCTCAGG - Intronic
1143113707 17:4568742-4568764 CCTTGCCATCCCCGGGGCCCAGG - Intergenic
1143150984 17:4807508-4807530 CTGGGTGTTCCCCGGGGCTCTGG + Intronic
1143203588 17:5128530-5128552 CACTGTCACCCCCGGAGCCCAGG - Intronic
1145041668 17:19581953-19581975 TGCTGTCATCCCTGGGGCTGTGG + Intergenic
1146844995 17:36176850-36176872 CACTGTCACCCCCGAGGCCCAGG + Intronic
1146857302 17:36264785-36264807 CACTGTCACCCCCGAGGCCCAGG + Intronic
1146863314 17:36323590-36323612 CACTGTCACCCCCGAGGCCCAGG - Intronic
1146873214 17:36388695-36388717 CACTGTCACCCCCGAGGCCCAGG + Intronic
1146880570 17:36439781-36439803 CACTGTCACCCCCGAGGCCCAGG + Intergenic
1147066174 17:37924178-37924200 CACTGTCACCCCCGAGGCCCAGG - Intergenic
1147076096 17:37989320-37989342 CACTGTCACCCCCGAGGCCCAGG + Intronic
1147077707 17:38003739-38003761 CACTGTCACCCCCGAGGCCCAGG - Intronic
1147087621 17:38068866-38068888 CACTGTCACCCCCGAGGCCCAGG + Intergenic
1147093644 17:38127673-38127695 CACTGTCACCCCCGAGGCCCAGG - Intergenic
1147103563 17:38192815-38192837 CACTGTCACCCCCGAGGCCCAGG + Intergenic
1148379958 17:47189164-47189186 CACCGTCATCCTCGAGGCTCAGG + Exonic
1148903876 17:50899277-50899299 CTCTGGCTTCCCCAGGGCACAGG + Intergenic
1149848137 17:60019312-60019334 CACTGTCACCCCCGAGGCCCAGG + Intergenic
1149862034 17:60127212-60127234 CACTGTCACCCCCGAGGCCCAGG - Intergenic
1150086494 17:62275915-62275937 CACTGTCACCCCCGAGGCCCAGG + Intronic
1152183568 17:78840461-78840483 CTCCGCCGTCCCCCGGGCTCCGG - Exonic
1152239939 17:79155883-79155905 CTCTGACTGCCACGGGGCTCGGG + Intronic
1153282134 18:3424666-3424688 CTCTCTCCTCCCCGAGGCTGGGG - Intronic
1153439954 18:5105196-5105218 CTCTGTCATCCCAGCTACTCAGG + Intergenic
1156473202 18:37390298-37390320 TTCTCTCATCCCCAGGGCTCTGG - Intronic
1157719909 18:49915765-49915787 CTCTCTCTTCCCCAGGGTTCCGG - Intronic
1158152383 18:54387450-54387472 CTCTGTCACTCCCAGGGGTCGGG - Intergenic
1158437801 18:57446140-57446162 CACTGCCCTCCCAGGGGCTCGGG + Intronic
1160880097 19:1315806-1315828 CTCTGGCCCCCCCGCGGCTCCGG + Intergenic
1161033502 19:2071191-2071213 CTCTGTCTCCCCCAGGGCTCGGG - Exonic
1161298453 19:3531610-3531632 CTCTCTCCTCACCAGGGCTCTGG - Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161621330 19:5298861-5298883 CTCTGTCCTTCCAGGGGCTCAGG + Intronic
1163233085 19:16016786-16016808 CACTGTCACCCCCGGGCCTGTGG - Intergenic
1163365355 19:16873074-16873096 CTGTGTCCTCCCTGGGGCTCAGG + Intronic
1163432085 19:17274230-17274252 TTCTGTCATCCTTGGGGCCCAGG + Intronic
1166396169 19:42442897-42442919 CTGAGTCATCCCCAGGGATCAGG - Exonic
1167445541 19:49535035-49535057 GTCTGTCCTCCACAGGGCTCCGG + Intronic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
1168676178 19:58279374-58279396 CTCTGTCCTCCCCAGGGCTGGGG + Exonic
925109150 2:1318908-1318930 CTCTGTCATCCCCGGGGCTCAGG + Intronic
927193779 2:20534197-20534219 CTCTGGCACCCCAGGGGCTCAGG - Intergenic
934561829 2:95317504-95317526 CTCTGGCTGCCCCGGGGCTCTGG + Intronic
934624299 2:95834590-95834612 CTCTGTCAGCCCCGGAACACTGG + Intergenic
934750124 2:96788751-96788773 CTCTGAGATCCCAGGGGCCCAGG - Intronic
934810002 2:97269803-97269825 CTCTGTCAGCCCCAGGACACTGG - Intergenic
934827690 2:97438136-97438158 CTCTGTCAGCCCCAGGACACTGG + Intergenic
936079779 2:109424175-109424197 CTGTCTGATCCTCGGGGCTCTGG + Intronic
936471146 2:112799586-112799608 CTCTGACATGCCCCTGGCTCAGG - Intergenic
937477342 2:122227358-122227380 CTCTGTCCTCACAGGGCCTCAGG - Intergenic
937908465 2:127064126-127064148 CTCTGTCTTGCCCGGAGCCCTGG - Intronic
937910758 2:127074412-127074434 CTCTGTCTGCCCCCGGGCTCAGG - Intronic
940791826 2:158037248-158037270 ATCTGTAATCCCAGGTGCTCGGG + Intronic
941736476 2:168982189-168982211 CTCTGTCTTCCCAGGGGCCATGG - Intronic
943190915 2:184679516-184679538 CTCTGCACTCCCGGGGGCTCAGG + Intronic
946405113 2:219488356-219488378 CCCTCCCATCCCCTGGGCTCAGG - Intronic
947497563 2:230649284-230649306 CTCAGTCACCACCTGGGCTCTGG + Intergenic
947638595 2:231693470-231693492 CTCAGTCATCCCAAGGCCTCAGG - Intergenic
948174054 2:235929143-235929165 CACTGGCATCCAAGGGGCTCAGG - Intronic
948380462 2:237547002-237547024 CTCAGTCCTCCTGGGGGCTCTGG + Intronic
948548024 2:238746298-238746320 CACTGTCATCCTGGGGGCACTGG - Intergenic
948763056 2:240204498-240204520 CTCTGTCATGCCCGAAGCTCAGG + Intergenic
1171290816 20:23981953-23981975 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1171336189 20:24388020-24388042 TTCTGTCATGCCAGGTGCTCAGG + Intergenic
1172091295 20:32434735-32434757 CTCGGGCCTCCCCTGGGCTCAGG - Exonic
1172473536 20:35219608-35219630 ATCTGTCATCCCAGGTACTCAGG - Intergenic
1174267196 20:49340462-49340484 CCCTGCCATCCCCGAGGCTTTGG - Intergenic
1174341447 20:49899256-49899278 CTCTGTCATCCCAGCTACTCCGG + Intergenic
1174379804 20:50149294-50149316 CTCTGTAATCCCCAGGGCAGGGG + Intronic
1174417038 20:50374222-50374244 CTCTCTCCTTCCAGGGGCTCAGG - Intergenic
1175799299 20:61792072-61792094 CTCTCTCCTCCCTGGGGCTCTGG - Intronic
1175833850 20:61981248-61981270 CTCTGACTTTCCCGTGGCTCTGG - Intronic
1179926677 21:44538738-44538760 CGCTGTCATGCCCTGGGCTGTGG - Intronic
1179936308 21:44606847-44606869 CTCTGGCAGCCCCCGGCCTCTGG - Intronic
1180766609 22:18349113-18349135 CTCTGTTCTCCCCAGGCCTCAGG - Intergenic
1180779705 22:18513265-18513287 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1180812420 22:18770586-18770608 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1181054248 22:20252657-20252679 CTGTGTCATCCCTGGGGCTCAGG - Intronic
1181198578 22:21204833-21204855 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1181401158 22:22650967-22650989 CTCTGTTCTCCCCAGGCCTCAGG - Intergenic
1181648364 22:24245917-24245939 CTCTGTTCTCCCCAGGCCTCAGG + Intergenic
1181703125 22:24632047-24632069 CTCTGTTCTCCCCAGGCCTCAGG - Intergenic
1182433120 22:30312396-30312418 CCCTGTCATCCCAGCTGCTCGGG + Intronic
1183025347 22:35061525-35061547 CTCTGTCATCCCCAGTGCATTGG - Intergenic
1183464735 22:37973819-37973841 CTCTGTCTTCACCTGGGCTTTGG + Exonic
1183678000 22:39310579-39310601 GTCTGTCTTCCCCCAGGCTCAGG - Intergenic
1184394629 22:44225822-44225844 CCCTGTCTTCCCCGTGGCTTGGG + Intergenic
1184673166 22:46026319-46026341 CTCTGTCATGGCAAGGGCTCAGG - Intergenic
1185047558 22:48536697-48536719 CTCTGTCCTCCCCGCAGCACAGG - Intronic
1203228227 22_KI270731v1_random:90004-90026 CTCTGTTCTCCCCAGGCCTCAGG - Intergenic
950628497 3:14265955-14265977 ATCTGTAATCCCAGGGACTCAGG + Intergenic
953546901 3:43870276-43870298 CTGAGTCATCCCCTGAGCTCTGG + Intergenic
953881593 3:46693874-46693896 CTCTGGCGTCCCCCGGGATCCGG + Intergenic
953908238 3:46879081-46879103 CTCTCTCACCCTCGGGCCTCTGG - Intronic
956427793 3:69154838-69154860 CTCAGTTAACCCCGGGGCTGGGG + Intergenic
961047759 3:123721229-123721251 CTCTCCATTCCCCGGGGCTCAGG - Intronic
961806290 3:129491647-129491669 CTCTGTGGTACCAGGGGCTCTGG + Intronic
964512591 3:157469198-157469220 CTCTTTCATCCCCAGGGTTAAGG - Intronic
965596795 3:170418822-170418844 CTCTTTAAGCCCCGCGGCTCCGG - Intergenic
968753354 4:2401733-2401755 CTCTATGACCCCCGGGGCTCAGG + Intronic
968755200 4:2412100-2412122 CTCAGGCATCCCCGTGGATCTGG - Intronic
969715134 4:8864684-8864706 CCCTGTTATCCGTGGGGCTCTGG - Intronic
969723468 4:8906125-8906147 CTCTGTGGTCCCCAGGGTTCCGG - Intergenic
969866477 4:10079826-10079848 CTCTGTCATCTGCCCGGCTCTGG + Intronic
973223247 4:47752832-47752854 ATCTCTCATCCCCTGGGCCCTGG - Intronic
976917628 4:90397587-90397609 CACTGTCATCACAGGGGCTATGG - Intronic
977602369 4:98948202-98948224 CTCTGTAATCCCCGCTACTCGGG + Intergenic
981428493 4:144632715-144632737 ATCTGTAATCCCAGGTGCTCGGG + Intergenic
985487391 5:159096-159118 TCCTGTCGTCCTCGGGGCTCTGG + Intronic
985640778 5:1062656-1062678 CTCTGCCATACCCAGGGCTGGGG + Intronic
986343948 5:6817170-6817192 CTCTGTCACCCTTGGAGCTCAGG - Intergenic
988227378 5:28429674-28429696 CCCTGTCATCCCAGGTACTCAGG - Intergenic
991470130 5:66959175-66959197 CTCTGTCATCACCGGGACGCTGG + Intronic
993720265 5:91315117-91315139 GTCTGTAATCCCCGGTACTCAGG - Intergenic
996338467 5:122410696-122410718 CTCTGTAATCCCCGGTACTCAGG + Intronic
996847040 5:127911393-127911415 CTCTGTAATCCTCATGGCTCTGG + Intergenic
997248877 5:132373758-132373780 CTCAGTCATCCCTGGGGTACTGG + Intronic
998219767 5:140267434-140267456 CTCTTTCAGCCCCCAGGCTCTGG + Intronic
998812472 5:145979966-145979988 CTCTGTCACCTCACGGGCTCTGG - Intronic
999043322 5:148440578-148440600 CTCTGTAATCCCAGCGACTCAGG + Intronic
1000042657 5:157496757-157496779 CTCTTTCATCCCCTTGACTCAGG - Intronic
1001166026 5:169368192-169368214 CTCTTTCATCCACAGAGCTCTGG + Intergenic
1002684327 5:180996060-180996082 CTCTGTCATTCCCTAGGGTCTGG - Intronic
1003408731 6:5844812-5844834 CTCTGCCATCCCTGGTGTTCTGG + Intergenic
1003599725 6:7505869-7505891 CTTTCACATCCCCAGGGCTCGGG + Intergenic
1003917858 6:10804465-10804487 CCCTGTAATCCCCGCTGCTCGGG - Intronic
1005209825 6:23447769-23447791 CTCTGTCCTACCCTGGGCTCAGG + Intergenic
1006806369 6:36792216-36792238 CTCTGTCTTCTCAGGGGCTTTGG - Intronic
1007783110 6:44265338-44265360 CTCCGACATGCCCGCGGCTCTGG + Exonic
1008085444 6:47239421-47239443 CTCTGCCATCCCCGGGGCTAGGG - Intronic
1008554911 6:52664843-52664865 CCCTGTCTTCCCCGGCGCTTAGG - Intergenic
1016710315 6:147164022-147164044 CTCCATCATCCCCCTGGCTCAGG - Intergenic
1016824217 6:148373491-148373513 CTGTGTCATCCTGGGGGCTGTGG + Intronic
1018238507 6:161749710-161749732 CTCTGTAATCCCTCGGCCTCGGG + Intronic
1018685007 6:166297649-166297671 CTGTGTCATCCCAGGGTCTGCGG - Intergenic
1018711225 6:166499273-166499295 CTCTGTCATCCCCAAGACTTGGG - Intronic
1019220702 6:170470311-170470333 CTCGGTCAGCCTGGGGGCTCTGG + Intergenic
1020016295 7:4834042-4834064 CTCTCTCATCCCCGGCCCTGTGG - Intronic
1022655506 7:32315868-32315890 ATCTGTAATCCCAGGTGCTCGGG + Intergenic
1024803706 7:53111177-53111199 CTCTGTCATCCCTGTGGATTTGG - Intergenic
1029622192 7:101697165-101697187 ATCTGTAATCCCCGCTGCTCGGG + Intergenic
1031897597 7:127369447-127369469 CTCTGTCACTTCAGGGGCTCAGG - Intronic
1032331868 7:130987847-130987869 CTCTGTAATCCCAGCTGCTCAGG + Intergenic
1032795348 7:135271777-135271799 GACTGTCATCCCAGGTGCTCGGG - Intergenic
1035002574 7:155625432-155625454 CTCTGCCATCCCCAGGACTTTGG + Intronic
1037891757 8:22627411-22627433 CACTGTCCACCCCGGGGCTTTGG - Intronic
1039836181 8:41258250-41258272 CTCTGAGATCCCCGGGTGTCAGG - Intergenic
1040538495 8:48330454-48330476 TTCCGTCATCACCGGGGCACTGG + Intergenic
1044142314 8:88671088-88671110 CTCTGTCCTGCCCGGCTCTCAGG + Intergenic
1044506434 8:93025266-93025288 CCCTGTAATCCCAGCGGCTCAGG + Intergenic
1045738090 8:105319166-105319188 CTCTCTCCTGCCCGAGGCTCGGG - Intronic
1049411791 8:142476895-142476917 CTGTGCCATCCCTGGGCCTCTGG - Intronic
1049554567 8:143275533-143275555 CTCTGGCGTCCCCCAGGCTCCGG + Intronic
1052943038 9:34145512-34145534 CTCTGTCACCCCAGGCCCTCTGG - Intergenic
1052979005 9:34433873-34433895 CTCTGCCCTCCCCGTTGCTCAGG + Intronic
1055791380 9:79926506-79926528 CTCTCTCCTCCCCGGAGGTCTGG - Intergenic
1056123209 9:83510109-83510131 CTCTTTCATCTGCGGGGCTGGGG - Intronic
1059218084 9:112585513-112585535 CAGTGTCCTCCACGGGGCTCAGG + Intronic
1059404821 9:114093136-114093158 CCCTGGAATCCCTGGGGCTCTGG + Intronic
1060182729 9:121545573-121545595 CTCTGGGATCCCAGGGCCTCAGG + Intergenic
1060989785 9:127841828-127841850 CTCTGGCATCCCCAGGGATCTGG + Intronic
1061790382 9:133055953-133055975 CACTGGCAGCCCCAGGGCTCTGG + Intronic
1062488261 9:136791697-136791719 CTCTGCCACCCCAGGGACTCGGG + Exonic
1185993092 X:4913686-4913708 CTCTGTCTTCCCAGGGGGTTTGG - Intergenic
1186514161 X:10153857-10153879 CTCTGTCCTTCCAGGAGCTCAGG + Intergenic
1195544762 X:106101821-106101843 CTCTTTCATCCCTGGAGTTCAGG + Intergenic
1195668497 X:107450410-107450432 TTCTGGCAGCCCCTGGGCTCGGG - Intergenic
1199019495 X:142860550-142860572 CTATGTCATGCCCAGGGATCTGG + Intergenic
1200137512 X:153882216-153882238 CTCTGTGATCCCCAGGGCTTGGG + Intronic
1200746987 Y:6911410-6911432 CCCTTTCATCCACGGGACTCGGG + Intronic