ID: 925110710

View in Genome Browser
Species Human (GRCh38)
Location 2:1334054-1334076
Sequence ACTAATATCCAGACTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8772
Summary {0: 1, 1: 36, 2: 826, 3: 3572, 4: 4337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925110708_925110710 23 Left 925110708 2:1334008-1334030 CCACGGAAAGGGATAAAATCTTC 0: 1
1: 0
2: 2
3: 123
4: 1167
Right 925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG 0: 1
1: 36
2: 826
3: 3572
4: 4337
925110707_925110710 24 Left 925110707 2:1334007-1334029 CCCACGGAAAGGGATAAAATCTT 0: 1
1: 1
2: 12
3: 747
4: 14576
Right 925110710 2:1334054-1334076 ACTAATATCCAGACTCTGCAAGG 0: 1
1: 36
2: 826
3: 3572
4: 4337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925110710 Original CRISPR ACTAATATCCAGACTCTGCA AGG Intronic
Too many off-targets to display for this crispr