ID: 925110710 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:1334054-1334076 |
| Sequence | ACTAATATCCAGACTCTGCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 8772 | |||
| Summary | {0: 1, 1: 36, 2: 826, 3: 3572, 4: 4337} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925110708_925110710 | 23 | Left | 925110708 | 2:1334008-1334030 | CCACGGAAAGGGATAAAATCTTC | 0: 1 1: 0 2: 2 3: 123 4: 1167 |
||
| Right | 925110710 | 2:1334054-1334076 | ACTAATATCCAGACTCTGCAAGG | 0: 1 1: 36 2: 826 3: 3572 4: 4337 |
||||
| 925110707_925110710 | 24 | Left | 925110707 | 2:1334007-1334029 | CCCACGGAAAGGGATAAAATCTT | 0: 1 1: 1 2: 12 3: 747 4: 14576 |
||
| Right | 925110710 | 2:1334054-1334076 | ACTAATATCCAGACTCTGCAAGG | 0: 1 1: 36 2: 826 3: 3572 4: 4337 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925110710 | Original CRISPR | ACTAATATCCAGACTCTGCA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||