ID: 925114591

View in Genome Browser
Species Human (GRCh38)
Location 2:1367726-1367748
Sequence GTGAACTGCATCAGGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925114591_925114602 16 Left 925114591 2:1367726-1367748 CCAGTCCACCTGATGCAGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 925114602 2:1367765-1367787 CAGCAGCATGAGAACCATGTGGG 0: 1
1: 1
2: 1
3: 44
4: 323
925114591_925114601 15 Left 925114591 2:1367726-1367748 CCAGTCCACCTGATGCAGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 925114601 2:1367764-1367786 CCAGCAGCATGAGAACCATGTGG 0: 1
1: 0
2: 1
3: 44
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925114591 Original CRISPR GTGAACTGCATCAGGTGGAC TGG (reversed) Intergenic
905803341 1:40859765-40859787 GTGAACTGCAGAGGGTGGCCAGG + Intergenic
907315896 1:53572433-53572455 GAGCACTGGATCAGGTGGATGGG - Intronic
913209711 1:116571981-116572003 GTGAACTCCCTCAGCTGGGCAGG - Intergenic
916627621 1:166575447-166575469 GAGACCTGCATAAGGTGGACAGG + Intergenic
917337831 1:173943475-173943497 TGGAACTGCACCAGGTGGAAAGG - Exonic
920041685 1:203102059-203102081 GTGAGCTGCATCAAGTTGCCTGG + Intronic
920198794 1:204246592-204246614 GTTAACTGCATCAGAGAGACAGG + Intronic
922701466 1:227763611-227763633 GGGTACTGCATCAGCTGGCCTGG + Intronic
922754214 1:228085782-228085804 GTGTACAGCATGAAGTGGACAGG + Intronic
1069156584 10:65037518-65037540 CTTAACTGCCTCATGTGGACAGG - Intergenic
1070058016 10:72953954-72953976 GTGAACTGCAGCAGGGGGAAGGG + Intronic
1071007549 10:80900223-80900245 GTGAACTTGATCAGCTGGAGTGG + Intergenic
1071398324 10:85244921-85244943 GAGAAATGAAGCAGGTGGACAGG - Intergenic
1071400399 10:85263124-85263146 GTGAATAGCATGAGTTGGACTGG + Intergenic
1073730792 10:106285232-106285254 CTAGACTGCATAAGGTGGACGGG + Intergenic
1074553124 10:114463683-114463705 GAGAACTTCAGCAGGAGGACTGG + Intronic
1074942005 10:118245322-118245344 GAGAAATGCATGACGTGGACAGG - Intergenic
1076193459 10:128498938-128498960 GTGAGCTGCATCTTGTGGAGAGG + Intergenic
1076336202 10:129707935-129707957 GTGCACTGCATCAGGGGCTCCGG - Exonic
1076415891 10:130288235-130288257 ATGAACTGGAGCAGGTGGAAGGG + Intergenic
1076878023 10:133226180-133226202 GTGAACTGCATTTCGTGGCCAGG - Exonic
1081936444 11:46907248-46907270 GTGAATTGCATTAGGTGGAGGGG - Intronic
1084530966 11:69727544-69727566 GTGCAGTGCAGCAGTTGGACAGG - Intergenic
1084652202 11:70495840-70495862 GTGTACAGTATCAGGTGGGCTGG - Intronic
1085741309 11:79080399-79080421 GGGCACTGCATCAGGTGGGGTGG + Intronic
1088618841 11:111661852-111661874 GTAAACTGAATCATGTGGGCAGG - Intronic
1094643995 12:32303236-32303258 GTGAAATGCATTATGAGGACTGG - Intronic
1104455934 12:128912067-128912089 GGGAGCTGCATCAGCTGGGCCGG + Intronic
1106285619 13:28316199-28316221 GGGAACTGGACGAGGTGGACAGG - Intronic
1114301751 14:21384818-21384840 ATGAACTGCAGCAAGGGGACTGG - Intergenic
1114693344 14:24605734-24605756 CTGATCAGCATCAGGTGGGCTGG + Intergenic
1117106694 14:52404683-52404705 GTGAGATGGATGAGGTGGACAGG - Intergenic
1119174866 14:72561656-72561678 GTGAACTGGATCATGAGGCCTGG - Intronic
1122408896 14:101516154-101516176 ATGGACTGGAGCAGGTGGACTGG - Intergenic
1135035894 16:19076563-19076585 GTGAACAGCACCAGGTGGTGTGG - Intronic
1138795431 16:59962653-59962675 GGGAGCTGCATCAGTTGGAAGGG + Intergenic
1139440353 16:66963648-66963670 TGGAGCTGGATCAGGTGGACAGG - Intronic
1143369112 17:6427406-6427428 GTGCACTGCACAAGGTGCACCGG - Intronic
1144328813 17:14206465-14206487 GTGAGGAGCATCAGGTGGGCAGG + Intronic
1149479402 17:56990445-56990467 GTGATCTCCATCAGGTGGGAAGG - Intronic
1151340506 17:73467876-73467898 GGGAGCTGCAGCTGGTGGACAGG + Intronic
1152107476 17:78339376-78339398 GTGAACTGAGTTAGTTGGACTGG + Intergenic
1157415225 18:47496766-47496788 GGGAACTGCATTAGAAGGACAGG - Intergenic
1160920318 19:1516484-1516506 GCGACGTGGATCAGGTGGACTGG + Intergenic
1163492781 19:17626610-17626632 GTGAGCTGGGCCAGGTGGACTGG - Intronic
925114591 2:1367726-1367748 GTGAACTGCATCAGGTGGACTGG - Intergenic
925182702 2:1827299-1827321 GTGATCTGCAGGAGGTGGAAGGG - Intronic
926323239 2:11763395-11763417 GTGGACTGCACCAGGTGGTCAGG + Intronic
927654534 2:24934271-24934293 GTTAACTTCATCAGGTCTACAGG + Intergenic
928343235 2:30464702-30464724 GGGAATTTCATCAGGTGCACAGG - Intronic
929807500 2:45159842-45159864 GAAAACTGCAACAGGAGGACAGG + Intergenic
932575947 2:72962447-72962469 TTAAAGTGCATCAGCTGGACTGG + Intronic
935359450 2:102235235-102235257 GTGTGCTGCAGCAGCTGGACCGG - Exonic
942466499 2:176213027-176213049 GTGAGCCGCTTCAGGGGGACAGG + Intergenic
942469157 2:176241990-176242012 ATGAATTGCATCAGGTGCAGTGG - Intergenic
943237903 2:185346610-185346632 GGTAACTGAATCATGTGGACAGG + Intergenic
948162461 2:235836324-235836346 GAGCACTGCAGCAGGTGGCCGGG + Intronic
948603866 2:239122634-239122656 GAAAACTCCACCAGGTGGACAGG - Intronic
1169943248 20:10960799-10960821 GTTGACTGCATCAGGTGTAGGGG + Intergenic
1171218908 20:23375792-23375814 GTGACATGCATGAGGTGGGCTGG - Exonic
1177816453 21:25982440-25982462 GTCAACGGCATCAGGGGTACTGG + Exonic
1178185525 21:30215600-30215622 ATGAAATGCACCAGGTGCACGGG - Exonic
1178900717 21:36596336-36596358 TTGAGGTGCAGCAGGTGGACAGG - Intergenic
1179523059 21:41957940-41957962 GTGAACTGCTTCAGGGTGAAGGG - Intergenic
1181718338 22:24752374-24752396 GTGATCTCCATCTGGTGGGCGGG - Intronic
1182441413 22:30366471-30366493 ATCAACTGCCTGAGGTGGACAGG - Intronic
950217444 3:11169463-11169485 GTGAGCTGGATAAGGTGGGCTGG - Intronic
950255966 3:11506332-11506354 GTTAACTGCCTCAGTTGCACTGG + Intronic
959527561 3:107394638-107394660 CTGACCTGCACCAGTTGGACTGG + Intergenic
962425970 3:135269798-135269820 ATGACCTGCCTAAGGTGGACTGG + Intergenic
962933937 3:140062102-140062124 GTGAAATGCATCAGGTATGCAGG + Intronic
965708729 3:171535475-171535497 GCAAACTGCCTCTGGTGGACAGG + Intergenic
965901157 3:173643976-173643998 GTGATCTGCAGCTGGTGGACTGG - Intronic
967539001 3:190642596-190642618 GTGTACTGCATAAGGTGGTGAGG - Intronic
968052424 3:195664263-195664285 GTGTCCTGTCTCAGGTGGACGGG - Intergenic
968103386 3:195984077-195984099 GTGTCCTGTCTCAGGTGGACGGG + Intergenic
976117934 4:81748072-81748094 GTGAATCACATCTGGTGGACAGG - Intronic
983054468 4:163085373-163085395 CTGAATTCCATCAGGAGGACTGG - Intergenic
985498630 5:226059-226081 GTGTCCTGTCTCAGGTGGACGGG - Intronic
994484616 5:100377541-100377563 GAGAATTGCCTCAGGTGAACCGG - Intergenic
1001155050 5:169265462-169265484 GGGAATTGGATCAGGTGGACTGG - Intronic
1002838656 6:887032-887054 GTGAACTGCATGCGTTGGAATGG - Intergenic
1003158570 6:3616932-3616954 GTTACCTGCACCTGGTGGACAGG - Intergenic
1004901286 6:20196571-20196593 GTGAACTGCACCAGGTGCAGTGG + Intronic
1005811204 6:29517776-29517798 CAGAACTGCCTCAGGTGGAGAGG + Intergenic
1007052969 6:38851829-38851851 CTGGACTGCATCAGGATGACAGG - Intronic
1008627235 6:53328999-53329021 GTGAACTTCACCAGGTGGGCTGG - Intronic
1011346997 6:86381218-86381240 GTAAACTGCATCTGCTGGAGAGG - Intergenic
1018562664 6:165118398-165118420 GGTAACTGAATCAGGTGGGCAGG + Intergenic
1018596605 6:165487781-165487803 ATGAACTGCATCAGTGGGAGGGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1025256315 7:57385848-57385870 GTGACCTGGAGCAGGTGGAGGGG - Intergenic
1026048228 7:66922572-66922594 GTGGCCTGAATCAGGTGGACTGG + Intronic
1028437614 7:90822497-90822519 GTGAACTCCAAAAGGTGGGCTGG - Intronic
1032548998 7:132766887-132766909 GTGAGCTGCAGCAGGAGGAGGGG + Intergenic
1035467355 7:159088434-159088456 GTGTACTGCCGCAGGTGTACAGG - Intronic
1037086155 8:14853357-14853379 GGGAACTGCATTTGGTGGACTGG - Intronic
1038889283 8:31700610-31700632 GTGAATTGCATCAGGGTGCCTGG + Intronic
1040875579 8:52148436-52148458 GCTAACTGCATCAGGTGGCTGGG - Intronic
1049320047 8:141991469-141991491 GTGAAGTGCGTCAGGTGGAGAGG - Intergenic
1052544277 9:29853348-29853370 GTGAACTAAATCAGGAGGGCTGG - Intergenic
1053567363 9:39267496-39267518 GTGAAATGCACCAGGTGTTCAGG + Intronic
1053833088 9:42105229-42105251 GTGAAATGCACCAGGTGTTCAGG + Intronic
1054129780 9:61351502-61351524 GTGAAATGCACCAGGTGTTCAGG - Intergenic
1054597464 9:67082180-67082202 GTGAAATGCACCAGGTGTTCAGG - Intergenic
1060391328 9:123279754-123279776 GTGAAGGGCATCACGTGGCCAGG - Intergenic
1061191362 9:129084634-129084656 GAGAACAGAATCAGGAGGACAGG - Intronic
1061869351 9:133512690-133512712 GTGCACCTCCTCAGGTGGACTGG + Intergenic
1062093000 9:134688388-134688410 GTCATCTTCAGCAGGTGGACCGG + Intronic
1062474876 9:136721973-136721995 GTGAGCTGCATATGGTGGAGTGG + Exonic
1185695916 X:2194462-2194484 GTAAACAGCAGCAAGTGGACAGG - Intergenic
1187883150 X:23864846-23864868 GTGAGCTGCTTCAAGTGGATGGG - Intronic
1190927096 X:54920349-54920371 CTGAATTGCATAAGATGGACGGG + Intergenic
1192177884 X:68897254-68897276 GTGAACTGCATGAGGGTGTCTGG + Intergenic
1195321305 X:103724069-103724091 CTGTACAGCATCAGGTGCACCGG - Exonic