ID: 925115313

View in Genome Browser
Species Human (GRCh38)
Location 2:1373744-1373766
Sequence AGGGAGAGCGGAGAGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925115313_925115316 -9 Left 925115313 2:1373744-1373766 CCCACAGTCTCTCCGCTCTCCCT 0: 1
1: 0
2: 5
3: 54
4: 506
Right 925115316 2:1373758-1373780 GCTCTCCCTGCATCAGCCAGTGG 0: 1
1: 0
2: 2
3: 37
4: 256
925115313_925115319 3 Left 925115313 2:1373744-1373766 CCCACAGTCTCTCCGCTCTCCCT 0: 1
1: 0
2: 5
3: 54
4: 506
Right 925115319 2:1373770-1373792 TCAGCCAGTGGTTCACACTGAGG 0: 1
1: 0
2: 2
3: 18
4: 207
925115313_925115321 12 Left 925115313 2:1373744-1373766 CCCACAGTCTCTCCGCTCTCCCT 0: 1
1: 0
2: 5
3: 54
4: 506
Right 925115321 2:1373779-1373801 GGTTCACACTGAGGACACACAGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925115313 Original CRISPR AGGGAGAGCGGAGAGACTGT GGG (reversed) Intergenic
900754295 1:4423085-4423107 AGGGAGAGCTGAGAGACCTCAGG - Intergenic
901749764 1:11398696-11398718 AGGGAGACCAGAGATACTTTGGG - Intergenic
902114288 1:14108157-14108179 AGAAAGAGCGGTGAGACTGGAGG - Intergenic
902509677 1:16959413-16959435 AGGCAGAGCGGGTAGCCTGTGGG - Intronic
902663254 1:17920165-17920187 ATGGAGAGCGGAGACACTCAGGG - Intergenic
902677738 1:18020618-18020640 AGGGAGAGGGGAGAGAGAGAGGG - Intergenic
903696445 1:25210821-25210843 TGGGAGGAAGGAGAGACTGTGGG + Intergenic
904128688 1:28260108-28260130 AGGGAGAGGGGAGACAGAGTGGG - Intronic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
904200524 1:28816501-28816523 GGGGAGAGAGGACAGAGTGTGGG - Intronic
904261140 1:29288546-29288568 AGGGAGAGAGGGGAGAGTCTAGG - Intronic
904563547 1:31413905-31413927 AGGGACCGCAGAGAGACTGAGGG - Intronic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906518688 1:46454559-46454581 AGAAAGAGCGGAGACACTGGAGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907359727 1:53904843-53904865 AGGGAGAGAGAAAAGACAGTGGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910065188 1:83143416-83143438 AGCCATAGCGGAGAGGCTGTTGG + Intergenic
910194096 1:84622700-84622722 AGGCAGAGAGAAGAGCCTGTAGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913073094 1:115318574-115318596 TGGGTGAGCAGACAGACTGTTGG - Intronic
914912173 1:151796440-151796462 AGGGAGAGGCAAGAGACTTTGGG - Intergenic
915322287 1:155062476-155062498 AGGTAGAGCGAGGACACTGTCGG - Exonic
915627693 1:157125630-157125652 AGAGACAGCGAAGGGACTGTGGG + Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916166770 1:161972238-161972260 AGGGAGAGAGGACAGTCTGGGGG - Intergenic
916912628 1:169367542-169367564 ACGGAGAGCGAGGAGACTGCAGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918903336 1:190454912-190454934 AGGGAAAGCTGAGAGAATGAAGG - Exonic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920958223 1:210639151-210639173 AGGAAGAGTGGACAGGCTGTTGG - Intronic
921326224 1:213988254-213988276 AGGGAGAGGGGAGAGAGAGGCGG - Exonic
922034150 1:221832068-221832090 AGGAAGAAGGGAGAGTCTGTGGG - Intergenic
922139286 1:222866131-222866153 AGGGTGAGCAGAGGAACTGTTGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923295408 1:232590194-232590216 AGGTGGAGGTGAGAGACTGTGGG - Intergenic
924206645 1:241718832-241718854 AGAGAGAGGGGAGAGAGGGTGGG + Intronic
924446759 1:244140065-244140087 AGAGAGAGCGGAGAGACCTTGGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1063948851 10:11203976-11203998 AGGCTGAGTGGAGAGACTGGGGG + Intronic
1064261370 10:13788928-13788950 AGGGAGAGCAGGGAGAATGGAGG - Intronic
1064295674 10:14076975-14076997 AGGGAGAGGGAAGAGTCTGGAGG + Intronic
1065421282 10:25547186-25547208 ATGGAAAGGGGAGAGACTGAAGG - Intronic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065552562 10:26883953-26883975 AGGGAGAGCTGAGAGAAGGCAGG - Intergenic
1065600492 10:27362958-27362980 AGGGAGAGCTGAGAGAAGGCAGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067291490 10:44946655-44946677 AGGCAGAGCTGAGAGAGGGTAGG + Intergenic
1067438294 10:46294148-46294170 AGGCAGAGCGGAGAGAGGGCAGG - Intronic
1067528317 10:47051755-47051777 AGGGAGATCAGAGAGTGTGTGGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068602425 10:58969735-58969757 GTGGAGAGAGGAGAGAATGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075618106 10:123905978-123906000 AGGAAGAGTGGACAGACCGTCGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1079587072 11:22139421-22139443 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
1080268738 11:30427777-30427799 AGGGAGAGGGGAAAGATTATGGG + Intronic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1081872832 11:46391206-46391228 AGGGAGGGCGGGGAGACGGCGGG + Intergenic
1082160940 11:48886828-48886850 AGAGAGGGCGGAGAGAGGGTGGG + Intergenic
1082161426 11:48893578-48893600 AGAGAGGGCGGAGAGAGGGTGGG - Intergenic
1082167019 11:48962031-48962053 AGAGAGGGAGGAGAGACGGTGGG - Intergenic
1082168629 11:48974319-48974341 TGGGAGAGGGGACAGAGTGTTGG + Intergenic
1082814597 11:57499702-57499724 AGGGAGCGGGGAGAGGCTGAGGG + Intronic
1084705772 11:70815299-70815321 AGGTAGGCAGGAGAGACTGTGGG + Intronic
1084989364 11:72909058-72909080 AGGGAGACCGGAGAGATGGAGGG - Intronic
1085052108 11:73385176-73385198 TGGGAGAGCTTAGGGACTGTAGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1087617838 11:100508701-100508723 AGGGAGAGAGGGAAGACAGTGGG - Intergenic
1087811331 11:102612087-102612109 AGGGAGAGATGAGAGACAGTTGG + Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088397338 11:109382976-109382998 AGGCAGAGCTGAGAGACAGATGG - Intergenic
1088544437 11:110945668-110945690 AGGGACAGAGGAGAGGCTGCTGG - Intergenic
1088881922 11:113979366-113979388 AAGGTGAGCGGAGAGGCTGAGGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090301561 11:125645304-125645326 AGGGAGATGGGAGAAAGTGTGGG - Intronic
1090975167 11:131673750-131673772 AAGGAGAGCCGAGAGAGTGGAGG - Intronic
1091825546 12:3509986-3510008 AGTGGCAGCAGAGAGACTGTAGG + Intronic
1091860616 12:3778939-3778961 TGGGTGAGAGGAGAGACTGATGG - Intergenic
1092135649 12:6145138-6145160 AGGGACAGGGGAGAGGCTGAGGG + Intergenic
1092196772 12:6554582-6554604 AGGGAGAGTGGAGAGCCAGCAGG - Intronic
1092277171 12:7070211-7070233 AGGCAGATGGGAGAGACGGTGGG - Exonic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096106777 12:49000613-49000635 AGAGAGAGGGGAGAGTGTGTGGG + Intergenic
1097069709 12:56345993-56346015 AGGCAGAAAGGAGAGGCTGTGGG + Intronic
1097069837 12:56346773-56346795 AGGCAGAAAGGAGAGGCTGTGGG + Intronic
1098915703 12:76254844-76254866 AGACAGAGTTGAGAGACTGTGGG + Intergenic
1098977126 12:76914133-76914155 AGGGAGAGAGGAGAGAAAGCAGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100785536 12:98074038-98074060 AGGGAGACATGAGAGACTGCAGG - Intergenic
1102167881 12:110820800-110820822 AGGGAGAGGGGAGAGAAGGAGGG - Intergenic
1103167647 12:118784006-118784028 AGGGAGAGAGGGGAAGCTGTGGG - Intergenic
1103522455 12:121545611-121545633 AGGGAGAGCGGAGGGGCTGAGGG - Intronic
1104286985 12:127432563-127432585 AGGGAGCACAGAGAGACTGCAGG + Intergenic
1104947318 12:132421884-132421906 AGAGACAGAGGAGAGGCTGTGGG + Intergenic
1105761120 13:23515426-23515448 AGGGAGAGTGGAGAGAGAGAAGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107414752 13:40190191-40190213 AGGGAGTGGGGAGGGAGTGTGGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108057453 13:46498867-46498889 AGGAACAGTGGAGAGACTGGGGG - Intergenic
1108417096 13:50209004-50209026 AGGGAGCGTGGAGAAATTGTTGG - Intronic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110948159 13:81450603-81450625 AGAGAGAGAGGCGAGGCTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112826027 13:103393408-103393430 AGTGAGAGAGGGGAGAATGTAGG + Intergenic
1112853404 13:103734709-103734731 AGGGGGACAGGAGAGAATGTAGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113618076 13:111695110-111695132 ACAGAGAGCGGAGAGAGTGGAGG - Intergenic
1113623609 13:111780371-111780393 ACAGAGAGCGGAGAGAGTGGAGG - Intergenic
1113627394 13:111856999-111857021 AGGAAGAGGAGAGAGACTGCAGG - Intergenic
1114430859 14:22659164-22659186 AGGGAGAGCAGAGATGCTGGAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118325073 14:64774975-64774997 AGGGAGGGCAGGGAGTCTGTGGG + Intronic
1118819456 14:69335482-69335504 AGGCAGAGCAAGGAGACTGTGGG - Intronic
1118924804 14:70182415-70182437 TGGGAGAGAGGAGAGAATCTTGG + Intronic
1118994233 14:70822284-70822306 AGAGAGAGGGGAGAGACAGAGGG - Intergenic
1119610316 14:76056339-76056361 AGGGAGAGGGGAGAGTCCTTGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121176126 14:91892050-91892072 AGGGAAAGCGGCGGCACTGTGGG + Intronic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1122840721 14:104461520-104461542 CGGGAGAGAGAAGAGGCTGTGGG + Intergenic
1123456457 15:20430682-20430704 GGAGAGAGCGGAGAGGCTGGCGG + Intergenic
1123661606 15:22569676-22569698 GGAGAGAGCGGAGAGGCTGGCGG - Intergenic
1124262596 15:28205833-28205855 GGAGAGAGCGGAGAGGCTGGCGG + Intronic
1124315405 15:28663909-28663931 GGAGAGAGCGGAGAGGCTGGCGG - Intergenic
1124682063 15:31740304-31740326 AGGGAAAGCGGAGAGTCTCCTGG - Intronic
1127000123 15:54493387-54493409 AGAGAGAGAGGAGAGAGTGAGGG - Intronic
1127113419 15:55698859-55698881 GGGGAGAGGGGAGAGAGTGCGGG + Intronic
1128109428 15:65067427-65067449 AGAGAGAGGGGAGAGACAGCAGG + Intronic
1128583638 15:68827802-68827824 AGGAAGAGGGGAGATACTATGGG - Intronic
1128701956 15:69811153-69811175 AGGGAGGGAGAAGAGACTGAAGG - Intergenic
1128815560 15:70605702-70605724 AGGGGGAGGGGACAGACAGTGGG - Intergenic
1129872133 15:78947322-78947344 CAGGAGAGGAGAGAGACTGTGGG - Intronic
1130010937 15:80152727-80152749 AGGGAGGGAGGAGAGACTGGAGG + Intronic
1130515745 15:84624602-84624624 AGGGAGCGCAGAGAGTTTGTTGG - Intronic
1130564134 15:84980573-84980595 AGGGAGGGCGGGAAGACTGGCGG + Intronic
1131233040 15:90673487-90673509 AAGGAGAGCGGAGAGACAGGTGG + Intergenic
1133089118 16:3389904-3389926 AGAGGGAGTGGGGAGACTGTTGG - Intronic
1134019630 16:10912560-10912582 AGGGAGAGCTGATAGCTTGTGGG - Intronic
1135620285 16:23949958-23949980 AGGGAGAAAGGAGAGGCTCTGGG - Intronic
1136284054 16:29230981-29231003 TGGGAGAGCGGAGAGACCGTAGG - Intergenic
1136569951 16:31090743-31090765 AGGGAGAGTGGAGGGCCTGCTGG - Intronic
1138336768 16:56259569-56259591 AGGGAGAGCTCTGACACTGTCGG - Intronic
1138434385 16:56989146-56989168 GGGGAGAGCGGAGAGCCTCCAGG - Intergenic
1138648587 16:58443557-58443579 AGGGAGTGAGGAGAGGGTGTGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139783692 16:69373049-69373071 AGGGAGGGAGGATATACTGTAGG + Intronic
1140126157 16:72120528-72120550 AAGGGGAGCGGAGAGAATGCGGG - Intronic
1141013333 16:80423951-80423973 AAGGAGAACGTAGAGACTGTGGG - Intergenic
1141099122 16:81184246-81184268 AGGGTGAGAGGAGAGAGTTTGGG + Intergenic
1141171661 16:81695622-81695644 ATGGAGAGCGGGGAGAGTGAGGG - Intronic
1142089088 16:88200489-88200511 TGGGAGAGCGGAGAGACCGTAGG - Intergenic
1142736807 17:1906146-1906168 AAGGAGAGCGGACAGTCTGGTGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143418444 17:6768965-6768987 AAGGAGAGTTGAGAGAATGTGGG - Intronic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146665332 17:34698640-34698662 ACGGAGATGGGAAAGACTGTGGG + Intergenic
1146826549 17:36028331-36028353 AGTGAGAGCTGAGAGAAAGTGGG + Intergenic
1147502610 17:40980055-40980077 AGAGAGAGAGAAGAGACTCTGGG + Intronic
1148232929 17:45948355-45948377 AGGGATTTCCGAGAGACTGTGGG + Intronic
1148572794 17:48683852-48683874 AGAAAGAGGGAAGAGACTGTGGG + Intergenic
1148697744 17:49571152-49571174 ATGGAGAGGGGACAGACTCTAGG - Intergenic
1148771182 17:50067777-50067799 AGGGAAGGATGAGAGACTGTGGG - Intronic
1150327474 17:64268492-64268514 AGGGAGAGGGGATAGACGGGAGG + Intergenic
1151189713 17:72389208-72389230 AGGGGGAGTGGAGAGACAGCAGG + Intergenic
1152452208 17:80388795-80388817 AGGGAGGCCGCAGAAACTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155433676 18:25788211-25788233 AGGGCGAGGGGAGAGATGGTCGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1157743025 18:50110011-50110033 AGGGAGTGGGGAGAGAGGGTAGG - Intronic
1158609386 18:58924778-58924800 AAGGAGTGAGGAGAGGCTGTGGG - Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159957772 18:74531958-74531980 AGGGAGAGAGGAGAGAGAGATGG - Intergenic
1160070206 18:75621651-75621673 AGGCGGAGGGGAGACACTGTGGG - Intergenic
1160100777 18:75917401-75917423 AGTGAGAGAGGAGAGACGGGAGG - Intergenic
1160256367 18:77251246-77251268 AGGGAGGGCGGAGGGCCGGTGGG + Intronic
1160865267 19:1253354-1253376 AGGGAGAGCTGGGAGGCGGTCGG + Intronic
1161219050 19:3109583-3109605 AGGGAGAGGGGAGAGCCTCGTGG + Intronic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1162905939 19:13824075-13824097 AGGGAGAAAGGAGAGATAGTAGG + Intronic
1163020088 19:14477128-14477150 GGGGTGAGCCGAGAGGCTGTGGG - Intergenic
1163463574 19:17453849-17453871 AGGGAGACCTGGGAGACTCTTGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164374450 19:27673114-27673136 AGAGACAGCTGAGCGACTGTAGG - Intergenic
1164526383 19:29016484-29016506 AGGGGGAGAGGAGAGACAGAGGG - Intergenic
1164561115 19:29292923-29292945 AGCGAGAGAGAAGAAACTGTGGG + Intergenic
1164690706 19:30208884-30208906 ATGAAGAGAGGAGAAACTGTGGG + Intergenic
1164929618 19:32165485-32165507 AGCGGGACAGGAGAGACTGTGGG - Intergenic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165362036 19:35342661-35342683 AGGGAGGCAGGAGAGACTGCAGG - Intronic
1165816395 19:38645042-38645064 AGGGGGAGCTGGGAGACAGTGGG + Intergenic
1165950445 19:39471328-39471350 AGGGAGAGCAGGGAGGCTGTGGG - Intronic
1167622894 19:50568724-50568746 AGGGAAAGGGGAGAGGGTGTGGG + Intergenic
1168115079 19:54217854-54217876 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168120772 19:54251546-54251568 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168124350 19:54275443-54275465 AGGGAAAGGGCAGAGAGTGTGGG - Intronic
1168502441 19:56904763-56904785 AGGGAATGCTGAGATACTGTTGG - Intergenic
1168663059 19:58182905-58182927 AGGGAGGGCGGGGAGAATGTAGG - Intergenic
924994126 2:341321-341343 TGGGAGAGGGGAGAGAGTGTGGG - Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925119992 2:1410903-1410925 ATGGAGAGCAGAGAGATTGCAGG - Intronic
925306010 2:2848833-2848855 AGGGAGAGGGGAGGGCCTGGGGG + Intergenic
925905630 2:8538255-8538277 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
927865024 2:26582746-26582768 ATGGAGTGAGGAGAGACTGGGGG + Intronic
928245010 2:29619498-29619520 AGGGAGAGCAGAGAGAAGGAAGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930658500 2:54030647-54030669 AGGGAGAGAGGAGAGGCGCTGGG - Intronic
931753049 2:65347575-65347597 AGGAAGGGCGGAGAGAGTGCTGG - Intronic
933981842 2:87556701-87556723 GGGGAGAGTGGAGAGACAGGAGG + Intergenic
934097514 2:88620254-88620276 AAGGAGAGGGGAGAGAGGGTTGG - Intronic
934652531 2:96100604-96100626 AAGGAGAGAGGAGAGAGTGAGGG + Intergenic
935619769 2:105118981-105119003 AGGCAGAGAGGAGACACTGAAGG - Intergenic
936311996 2:111394116-111394138 GGGGAGAGTGGAGAGACAGGAGG - Intergenic
936937695 2:117853964-117853986 AGGGAAAGCTGAGAGACACTTGG + Intergenic
936937707 2:117854016-117854038 AGGGAAAGCTGAGAGACGCTTGG + Intergenic
936937719 2:117854068-117854090 AGGGAAAGCTGAGAGACGCTTGG + Intergenic
937296054 2:120810522-120810544 AGGGAGAGGAGAGAGGCTGTTGG - Intronic
937431932 2:121846194-121846216 AGTGAGGGCAGAGAGGCTGTAGG - Intergenic
937497129 2:122432544-122432566 ATGAAGAGCTGAGAGACTGAAGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
940469403 2:154076087-154076109 AGGGAGAGCAGAGCTGCTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941721970 2:168821843-168821865 AGGGAAATCGGAGAGGCTGCCGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943676059 2:190717470-190717492 GGGGCAAGAGGAGAGACTGTTGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944189748 2:196990522-196990544 AGGGAGGGCAGTGAGGCTGTTGG - Intronic
944363221 2:198883840-198883862 AGGCAGAGCTGGGAGCCTGTAGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945044157 2:205767112-205767134 GGTGAGAAAGGAGAGACTGTGGG + Intronic
945946823 2:216002787-216002809 AGGGAGAAAGGAGGGACTGAAGG - Intronic
946412009 2:219520138-219520160 AGGGAGACCGGAGAGCCCATAGG - Intronic
946875327 2:224124021-224124043 AGAGAGAGAGGGGAGATTGTGGG - Intergenic
947224727 2:227828812-227828834 AGGGGGAGAGGAGAGATAGTAGG + Intergenic
947742136 2:232489537-232489559 AAGGAGGGAGGAGAGACTGAGGG - Intergenic
947862320 2:233369579-233369601 AGGGGGAGGGGAGAGGCTGATGG - Intronic
948208516 2:236175867-236175889 AGGGAGAGCTGGGAGACAGAGGG - Intergenic
948773811 2:240269659-240269681 AGGGGCAGTGAAGAGACTGTGGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169602214 20:7274572-7274594 AGGGAGAAGGGAGAGATTCTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170113453 20:12830415-12830437 AGGGAGAGAGGAAAGACTCCAGG - Intergenic
1170600670 20:17839056-17839078 TGGGAGAGCAGAGAGGCTGCAGG - Intergenic
1170628574 20:18048756-18048778 CGGGAGATAGGAGAGAATGTTGG - Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171141391 20:22746849-22746871 GGGGAGAGTGGAGAGAGTGATGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172122338 20:32605876-32605898 AGGGGGAGGGGAGACCCTGTGGG - Intronic
1172221273 20:33276687-33276709 AGAGAGAGGAGAGAGACAGTGGG + Intronic
1172993473 20:39052605-39052627 TGGGAGGGAGGACAGACTGTGGG + Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1175411268 20:58771012-58771034 AGGGTGAGAGGAGAGAAGGTAGG + Intergenic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1179063387 21:38001205-38001227 AGGGATAGTGGAGAGAGTATTGG - Intronic
1179299557 21:40094400-40094422 AGGCAGAGCTGAGAGCCTGAAGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181257443 22:21572947-21572969 AGGCAGAGAAGAGAGACTGAAGG - Intronic
1181669319 22:24418813-24418835 AGGGAGAGTGGAGAGATTCCAGG + Intronic
1181907327 22:26209738-26209760 AGGGAGAGAGGAGAGAAGGAAGG + Intronic
1182699403 22:32222916-32222938 AGGGAGTGGGGAGACACTCTAGG - Intronic
1183445471 22:37850950-37850972 GGGGAGAGAGGCAAGACTGTTGG - Intronic
1184116101 22:42423264-42423286 TGGGAGAAAGGAAAGACTGTGGG + Intronic
1184241659 22:43214258-43214280 AGGCAAAGCGGAGAGGCTGCTGG + Intronic
1184350696 22:43941892-43941914 AGGGAGAACGAAGAGCCTGAAGG + Intronic
1184469830 22:44690171-44690193 AGGGAGAGAGAAGACCCTGTGGG + Intronic
1185388127 22:50545838-50545860 AGGCTGAGAGGAGGGACTGTGGG + Intergenic
949116146 3:326692-326714 AGTGAGAAGGGAGAGGCTGTGGG + Intronic
950433786 3:12966976-12966998 AGGGAGAGCGGAGAGTTGGTGGG - Intronic
950487141 3:13280614-13280636 AGGGTGAGCAGTGAGGCTGTGGG - Intergenic
950500343 3:13359671-13359693 AGGGTGAGCTGAGAGCTTGTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952167661 3:30768591-30768613 AGGAAGAGTGGCGAGACTGGAGG + Intronic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
954411598 3:50373582-50373604 GGGCAGAGCGGAGGGAGTGTGGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956245836 3:67181874-67181896 AGGGTGAGCAGAAAGACTGAGGG + Intergenic
958019446 3:87979142-87979164 AGGGAGATGGGAAAGACTGAGGG + Intergenic
959090767 3:101900271-101900293 AAGGAGAGGGGAGAGGCTGAGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
961033711 3:123628088-123628110 AAGGAGAACTGAGATACTGTGGG - Intronic
961318038 3:126054031-126054053 GGGGAGAGCTGGGGGACTGTGGG - Intronic
961383514 3:126510801-126510823 TAGGAGAGCGGAGAGGCAGTCGG + Intronic
961432146 3:126890881-126890903 AGGGAGTGGGGAGGGAATGTTGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963622015 3:147622319-147622341 AGAGAGAGTGGAAAGACTATTGG - Intergenic
963760187 3:149280403-149280425 AGGGGTAAGGGAGAGACTGTTGG - Intergenic
964164379 3:153684533-153684555 TGGGAGTGTGGAGAGACTATTGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965211656 3:165797340-165797362 AGGAAGAAAGGAGAGACTGGAGG - Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968078870 3:195833281-195833303 AGGGAAAGCAGAGACACTCTAGG + Intergenic
968747048 4:2365516-2365538 AGGGACAGGAGAGAGTCTGTGGG - Intronic
968832973 4:2942762-2942784 AGGGAGACAGGAGAGTCAGTCGG + Intronic
969460564 4:7326727-7326749 TGGGACAGCGGAGAGGCTGGAGG + Intronic
970907446 4:21232878-21232900 AGGGACAGCAGAGAGAATGAGGG + Intronic
971635366 4:29049831-29049853 AGGGAGCGGGGAGAAACTGCAGG + Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976227997 4:82811933-82811955 AGGGAGAGCGGAGAGGAGTTTGG - Intergenic
976610718 4:87027532-87027554 GAGGAGAGAGGAGAGTCTGTTGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
980196515 4:129596095-129596117 AGGGAGTGGGGAGGGACTGAGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984569375 4:181373247-181373269 AGGGAGAGCTGTGAGCATGTGGG + Intergenic
984598224 4:181696312-181696334 AGGGAGAGGGGAGAGAGGGGCGG - Intergenic
984952422 4:185017346-185017368 CGGGAGAGCGCAGACACTTTGGG - Intergenic
985165169 4:187086200-187086222 AGGAAGAGAGGACAGATTGTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986693239 5:10331196-10331218 AGGGAGAGGGGAGAGCCAGCCGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988544162 5:32141600-32141622 AGGGAGAGGAGGGAGACCGTGGG - Intronic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
990995840 5:61731566-61731588 AGGGAGAGAGGAGAGAGAGAAGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991396168 5:66207499-66207521 AGGAAGGGGAGAGAGACTGTAGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993013630 5:82511206-82511228 AGGGAGACTGGAGAGGCTGGTGG + Intergenic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993301086 5:86211063-86211085 AAAGAGAGGGGAGAGACCGTTGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995241122 5:109885984-109886006 AGGGAGAGTGGAGAGACGATGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995552942 5:113298441-113298463 AGGGAGTGAGGAGAAACTGGGGG + Intronic
995836468 5:116404849-116404871 AGGCAGAGCTGAGAGACATTTGG - Intronic
997485162 5:134225465-134225487 AGGGGGAGCGGAGACCCTGTGGG - Intronic
997610255 5:135210806-135210828 AGGGAGAGAGAAGAGTGTGTCGG - Intronic
997713657 5:136027040-136027062 AAGGAGAAGGGAGAGAGTGTGGG - Intergenic
997786352 5:136717546-136717568 AGGGAGAGAGGAAAGAATGGAGG - Intergenic
998074137 5:139222522-139222544 AGGGAGAGAGAAGAGGATGTTGG - Intronic
998320933 5:141230302-141230324 AGGGAGAGAAGAGAGAATATAGG + Intergenic
998529519 5:142871847-142871869 AGGGAGAGATCGGAGACTGTTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998785391 5:145703346-145703368 AGGGAGAGCTAAGAGACAGAAGG - Intronic
999367942 5:151035079-151035101 AGGGAGGGAGAAAAGACTGTCGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1001082848 5:168679744-168679766 AGACAGAGCCGAGAGAGTGTGGG - Intronic
1001122219 5:168990232-168990254 GGGAAGAGAGGAGAGATTGTGGG - Intronic
1001234317 5:170016539-170016561 AGGGAAAGCGGAGAGAGAGATGG - Intronic
1001311314 5:170612906-170612928 AGGGAGAGAGGAGAGACCTGGGG - Intronic
1001808154 5:174606747-174606769 AGGGAGAGTGGAGAGAGAGGAGG - Intergenic
1003486190 6:6581665-6581687 AGGGAGAGGGGAAAGGCTGAGGG - Intergenic
1003507356 6:6751000-6751022 AGGGAGCGTGGAGAGAAGGTGGG - Intergenic
1005712443 6:28515196-28515218 AGGGAGAGGTGAGAGAATCTGGG - Intronic
1005779514 6:29174532-29174554 AGGGGCAGCGAAGAGACTATTGG + Exonic
1007001903 6:38321314-38321336 AGGGAGAGAGGAGAGAAAGAAGG + Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007253292 6:40511029-40511051 AGGGAGAGAGGTGAGACCATGGG + Intronic
1008057738 6:46962698-46962720 AGGTAGAGGGGAGAGATTTTAGG - Intergenic
1008124229 6:47650541-47650563 AGGGAGAGAGGAGAGAAGGGAGG + Intergenic
1008567077 6:52779665-52779687 AGGAGGAGGGGAGAGATTGTGGG - Intergenic
1008624983 6:53306346-53306368 AGGGAGAGGGGAGAGAGAGAGGG + Intronic
1008624991 6:53306372-53306394 AGGGAGAGGGGAGAGAGAGAGGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011026623 6:82876359-82876381 AGGCAGAGAGGAGAGCCAGTGGG - Intergenic
1012547483 6:100436047-100436069 AGGTAGGGAGGAGAGACAGTGGG - Intronic
1014035948 6:116766465-116766487 AGGGAGTGTGGAGAGTTTGTGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015832513 6:137385729-137385751 AAGAAGAAGGGAGAGACTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018797715 6:167200161-167200183 AGGGTGAGCAGAAACACTGTGGG - Intergenic
1019156033 6:170039579-170039601 AGGGACAGCGGGGACACAGTGGG - Intergenic
1019156083 6:170039765-170039787 AGGGACAGCGGGGACACAGTGGG - Intergenic
1019637236 7:2082390-2082412 AGGGAGATGGGAGAGACAGAAGG + Intronic
1019925647 7:4190569-4190591 GTGCAGAGTGGAGAGACTGTGGG + Intronic
1020011410 7:4807725-4807747 AGGGAGGGCAGAGAGACGGAGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022056636 7:26742407-26742429 AGGGAGAGGGGAGAGGAAGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023041381 7:36175966-36175988 TGGGAGAGCTGAGAGGCTGCAGG + Intronic
1024036266 7:45509865-45509887 AGGGACAGTGGTGGGACTGTAGG + Intergenic
1024609798 7:51054682-51054704 AGGGAGAGCTGAGATGCTGGGGG - Intronic
1024920056 7:54545941-54545963 TGGGAGAGCAGAGAGAATGAGGG + Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025083786 7:56006232-56006254 AGGGAGAGAGAAGAGAATGAAGG + Intergenic
1026586762 7:71661783-71661805 AGGGAGAGCTGAGGGACTTTGGG + Intronic
1026653031 7:72232156-72232178 AGGGGGAGCAGAGAGGATGTAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028585482 7:92447612-92447634 AGGAAGAGCGGTGAGAGCGTCGG - Exonic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029410937 7:100410192-100410214 TGGGAGAGAGGAGAGGCTGAGGG - Intronic
1029457748 7:100679588-100679610 AGAGGGGGCGGGGAGACTGTGGG + Exonic
1030196854 7:106860905-106860927 AGGGAGAGGAGAGAGAATGAGGG + Intergenic
1030318922 7:108144211-108144233 AGGGGCAGTGGAGAGGCTGTGGG + Intergenic
1030327015 7:108230363-108230385 AGAGAGAGTAGAGAGACTGTTGG - Intronic
1030343285 7:108405150-108405172 AAGCAGAGAGAAGAGACTGTTGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031127249 7:117788797-117788819 AGGGAGAACGGAGGCACTGGAGG - Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032195679 7:129787029-129787051 AGGTACTGCGGAGAGACTGCTGG - Intergenic
1032322139 7:130895312-130895334 AGGGAGAGCAGAGACTCTGCAGG + Intergenic
1032340733 7:131070280-131070302 AGTGACAGCGGGGAGACTGCTGG + Intergenic
1033024660 7:137760646-137760668 AGGGAGAGAGGAGAGCCAGAAGG + Intronic
1033457056 7:141512083-141512105 AGGGAAAGCGGAGAAACAGGAGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035221213 7:157407564-157407586 AGGGAGAGAGGAGAGACGAAGGG - Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035496121 7:159328050-159328072 AGAAAGAGAGGAGAGACTGAAGG + Intergenic
1036401089 8:8409133-8409155 AGAGAGAGAGAAGAGAATGTAGG - Intergenic
1037400329 8:18489254-18489276 AGAGAGAGAGGAGAGACAGCAGG + Intergenic
1038273608 8:26098642-26098664 GGGGACAGAGGAGAGCCTGTGGG - Intergenic
1038441454 8:27573478-27573500 AGAGAGGGCGGAGAGAGGGTGGG - Intergenic
1039392085 8:37189463-37189485 AGAGAGAATGGAGAGAGTGTGGG + Intergenic
1039588661 8:38728620-38728642 AGGGAGAGGGGAGCGACCCTGGG + Intronic
1040301151 8:46188648-46188670 GGGGAAAGCGGTGAGACTGCAGG - Intergenic
1040342409 8:46447583-46447605 AGGGAAAGCGGCTAGACTGCAGG - Intergenic
1041738526 8:61135532-61135554 AGGGAGAGAAGAGAGAGAGTAGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047406026 8:124586513-124586535 GGGGAGGGAGGAGAGACTGTAGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048427787 8:134338768-134338790 AGGGAGAGAAGAGAGGCTGGAGG - Intergenic
1048592953 8:135838436-135838458 AGGGAGAGCAGAGACACTAGAGG - Intergenic
1049790010 8:144468170-144468192 CAGGAGAGCAGAGGGACTGTGGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052434425 9:28408099-28408121 AGGCAGTGCTGAGGGACTGTTGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1055728996 9:79261511-79261533 AGGGAGGGATGGGAGACTGTCGG - Intergenic
1056522287 9:87412132-87412154 AGAGAGAGTGGAGAAACTGAGGG - Intergenic
1057843860 9:98506922-98506944 AGGGAGGGCAGGGAGGCTGTAGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058900910 9:109441444-109441466 AGGGAGAGGGGAGAGCATCTGGG - Intronic
1058943441 9:109835157-109835179 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1058943446 9:109835177-109835199 AGGGAAAGAGGAGAGGGTGTAGG + Intronic
1059456662 9:114404059-114404081 TGGGAGAGCGTAGAGGCTGCTGG + Exonic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060199645 9:121645141-121645163 AGGGAGAAAGGAGGGGCTGTGGG + Intronic
1060245223 9:121940254-121940276 AGGGTGAGGGAAGAGCCTGTAGG - Intronic
1061086822 9:128404541-128404563 AGGGAGATGGAAGAGAGTGTTGG - Intergenic
1061406296 9:130394614-130394636 GGGGAGAGGGGAGGGACTGCAGG + Intronic
1061422245 9:130478711-130478733 AGGGAGAGAGGAGAGGCGGGGGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061993588 9:134173184-134173206 AGGGAGTGCGGAATGACTTTGGG + Intergenic
1062354243 9:136154301-136154323 TGGGGGAGGGGAGAGACTGGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1062354329 9:136154564-136154586 TGGGAGACCGGAGAGTCTGGAGG - Intergenic
1062354343 9:136154616-136154638 TGGGAGACCGGAGAGACTGGAGG - Intergenic
1062354357 9:136154668-136154690 TGGGAGACCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185892898 X:3836108-3836130 TGGGTGAGGGGAGAGACGGTAGG - Intronic
1185898007 X:3874528-3874550 TGGGTGAGGGGAGAGACGGTAGG - Intergenic
1185903126 X:3912959-3912981 TGGGTGAGGGGAGAGACGGTAGG - Intergenic
1186347975 X:8713912-8713934 AGGGAGAGAAGAGAGACATTTGG - Intronic
1186412134 X:9353362-9353384 AGGGTGAGTGGAGAGCCTGGGGG - Intergenic
1187440053 X:19310186-19310208 AGGAGGGGCAGAGAGACTGTGGG + Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1190234105 X:48602887-48602909 AGGAAGAAAGGAGAGGCTGTGGG - Intronic
1190245275 X:48686783-48686805 AGGGAGAGCGGACCCACTGGAGG - Exonic
1191779093 X:64847557-64847579 AGGGAGAGCAGAGGGCCTTTTGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192147354 X:68690428-68690450 AGGCAGGGCGGGGGGACTGTTGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192437855 X:71153840-71153862 AGGGAGAGTGGAGAGAAAGCAGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195086428 X:101418269-101418291 AGGGACAGGGAAGAGGCTGTCGG + Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196738389 X:119001212-119001234 AGGGAGAGAGGAGAGAGGGAGGG + Intronic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197339617 X:125250302-125250324 AGAGAGAGAGGAGAGAAAGTGGG + Intergenic
1197411412 X:126120706-126120728 AGAGAGAGAAGAGAGACTCTAGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1200002450 X:153069032-153069054 AAGGAGAGGGGAGAGAATCTTGG + Intergenic
1200005274 X:153080978-153081000 AAGGAGAGGGGAGAGAATCTTGG - Intergenic
1200154429 X:153967894-153967916 AGGGACAGAGGAGAGAATGGAGG + Intronic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201696187 Y:16829095-16829117 AAAGAGAGAGGAGAGACTGAGGG + Intergenic