ID: 925117147

View in Genome Browser
Species Human (GRCh38)
Location 2:1389200-1389222
Sequence TGCCACAGGGAAGGGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925117140_925117147 13 Left 925117140 2:1389164-1389186 CCTAGGGGAGACTGTGCTGGGAT 0: 1
1: 0
2: 2
3: 14
4: 256
Right 925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG 0: 1
1: 0
2: 3
3: 52
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925117147 Original CRISPR TGCCACAGGGAAGGGTGCTG AGG Intronic
900121857 1:1051653-1051675 TGGCACAGGGCAGGGGGCGGAGG + Intronic
900122974 1:1057015-1057037 AGCCTCAGGGAAGGGCGCGGTGG + Intergenic
900194536 1:1369117-1369139 TGCCTCTGGGAAAGGTGGTGTGG + Intergenic
900229365 1:1548622-1548644 AGCCACGGGGTGGGGTGCTGGGG + Intronic
900393884 1:2445236-2445258 AGCCTCAGGGAAGGGGCCTGTGG - Intronic
900742677 1:4340208-4340230 GGCCACAGGGGAGGGAGTTGGGG + Intergenic
900964556 1:5948661-5948683 GGCCCCAGGGAAGGGGGCTCTGG - Intronic
901306677 1:8237881-8237903 TCCCCCAGGGCAGGGCGCTGTGG - Intergenic
901483586 1:9542210-9542232 GGGCACAGGGAAGGGTACAGAGG - Intronic
903261683 1:22134959-22134981 TGCCATTGGGATGGCTGCTGAGG - Intronic
903554853 1:24186152-24186174 AGCCACAGAGAACGCTGCTGTGG + Intronic
904180136 1:28660459-28660481 CGACACAGGGCAGGGTGCGGTGG + Intergenic
904419189 1:30380419-30380441 TGCCAGAAGGCTGGGTGCTGGGG + Intergenic
904672790 1:32178929-32178951 TGCCTCAGGGAAACCTGCTGTGG + Intergenic
904933140 1:34106524-34106546 TGGCAGAGGGAAGGGTGGTAGGG - Intronic
905178138 1:36150741-36150763 TGCCACAGGGGAGGGAGCCAAGG + Intronic
905225771 1:36478239-36478261 TGCCACAGGGCTGGGCGCGGTGG + Intronic
905470398 1:38187510-38187532 TCCCACACTGAGGGGTGCTGAGG - Intergenic
905517522 1:38572678-38572700 AAGCACAGGCAAGGGTGCTGTGG - Intergenic
905650675 1:39654676-39654698 TGCCAAAGGGAAGGGACATGGGG - Intergenic
905678911 1:39852336-39852358 TCCCACTGGGAAAGCTGCTGGGG + Intronic
906282917 1:44566304-44566326 TTCAACAAGGAAGGGGGCTGAGG + Intronic
908070514 1:60454973-60454995 GGGGACAGGCAAGGGTGCTGTGG - Intergenic
908076725 1:60527949-60527971 TCCCAAAGGAGAGGGTGCTGAGG + Intergenic
908415339 1:63908085-63908107 TGCCACATGGAATTGTTCTGAGG - Intronic
908796991 1:67840016-67840038 TCCCTCAGGGGAGGGTGCTGGGG + Intergenic
910461131 1:87448991-87449013 TGGCATAGGGAAGGGTGATTAGG + Intergenic
912419815 1:109535369-109535391 GGCCCCAGGGAAGGGTTTTGGGG + Intergenic
912500184 1:110116536-110116558 TGCCACATGGCAGGATGCTGTGG - Intergenic
913688756 1:121258321-121258343 TCCCACAGGGAAGCAAGCTGCGG + Intronic
913711802 1:121491732-121491754 TTCCAAAGGGAAGGGTGCACAGG + Intergenic
913984336 1:143551491-143551513 TGTCACAGGAAAGGGTGCAAGGG + Intergenic
914148844 1:145021955-145021977 TCCCACAGGGAAGCAAGCTGCGG - Intronic
914318369 1:146535326-146535348 TGCCGTAGGGAAGGGTGATTAGG + Intergenic
914495991 1:148198031-148198053 TGCCGTAGGGAAGGGTGATTAGG - Intergenic
914940091 1:152014830-152014852 TTCCACAGGGGAGGATCCTGGGG + Intergenic
915130665 1:153693436-153693458 TGGCACAGGGTAGGGAGGTGTGG - Exonic
915661954 1:157412010-157412032 GGCCACATGGCAGGGAGCTGAGG - Intergenic
915734548 1:158076357-158076379 TGGCACAGAGGAGGGTGGTGAGG - Intronic
917264868 1:173210298-173210320 TGCAGAAGGGAAGGGTGCAGGGG + Intergenic
917410568 1:174756435-174756457 TGGTACAGGGCAGGGTGCGGTGG - Intronic
918598727 1:186326172-186326194 TGACACAGGGATGGGAGATGAGG - Exonic
919804917 1:201375835-201375857 AGCCACTGGGCATGGTGCTGGGG + Intronic
920201492 1:204262453-204262475 TCTCACTGGGAAGTGTGCTGAGG - Intronic
920476080 1:206276821-206276843 TCCCACAGGGAAGCAAGCTGCGG + Intronic
920510662 1:206549597-206549619 TTCCACAGGGCTGGGTGCAGTGG - Intronic
921575875 1:216834111-216834133 TGACTTAGGGACGGGTGCTGTGG + Intronic
921721794 1:218480613-218480635 TTCCACTGAGAAGAGTGCTGCGG + Intergenic
922531100 1:226345916-226345938 TGCCACACAGATGGGAGCTGAGG + Intergenic
922699532 1:227750704-227750726 GGCCATAGGCGAGGGTGCTGCGG + Intronic
923559993 1:235031861-235031883 TGCCACAATGCAGGGTGCGGTGG + Intergenic
924441319 1:244087744-244087766 TCCCACAGGGAAGCCTTCTGTGG + Intergenic
924646068 1:245878308-245878330 TGCCACAGGGAAGGAGTCAGTGG + Intronic
924941028 1:248812544-248812566 TGGAGCAGGGAAGGGTGTTGTGG - Intronic
1063101225 10:2951503-2951525 TTCCACATAGAAGGCTGCTGGGG + Intergenic
1063473742 10:6310042-6310064 TGACTCAGGGTAAGGTGCTGGGG + Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1066620595 10:37345186-37345208 TGCCACAGGGACGGGGGTGGTGG + Intronic
1067049429 10:43003953-43003975 TGCTACTGGGAATGGTGCTGTGG + Intergenic
1067458750 10:46441755-46441777 TGTCATAGGGAAGGAAGCTGTGG + Intergenic
1067628444 10:47942881-47942903 TGTCATAGGGAAGGAAGCTGTGG - Intergenic
1068690776 10:59911653-59911675 GGCAACAGGGACGGGTGCGGTGG + Intergenic
1069738096 10:70670611-70670633 AGCCCCAGGGAAGGGGGCGGGGG + Intergenic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1070519989 10:77244231-77244253 TTCCTCAGGAAAGGATGCTGAGG + Intronic
1070722107 10:78764093-78764115 TGCCCCAGGGAAGGGTTCAGAGG - Intergenic
1072246627 10:93549352-93549374 TACCACAGGGATGGTGGCTGAGG + Intergenic
1072722042 10:97787103-97787125 TGCGAAAGGGATGGGAGCTGGGG + Intergenic
1072809195 10:98446448-98446470 GGCCACAGGGAGGTTTGCTGGGG - Intronic
1073298888 10:102458596-102458618 TGCCGCAGTGAAGGGGACTGAGG + Intergenic
1074386127 10:113018037-113018059 TGGCACAGTGCTGGGTGCTGGGG + Intronic
1075182272 10:120222295-120222317 TGCCTGAGGCAGGGGTGCTGGGG - Intergenic
1075754189 10:124798064-124798086 TGCCACTGGGCTGGGTGCAGTGG - Intergenic
1076063190 10:127429169-127429191 TGCTACAGAGAAGGGTGGGGAGG - Intronic
1076191035 10:128483604-128483626 TGCCCCACGGCAGGGTGCTGAGG + Intergenic
1076331821 10:129675840-129675862 TGCCACAGGGAAATGGGCTCTGG - Intronic
1076511626 10:131018213-131018235 GGCCACAGGGCAAGGAGCTGAGG + Intergenic
1076788157 10:132761530-132761552 TGCCACGAGGAAGCTTGCTGAGG + Intronic
1076879861 10:133234819-133234841 GGCCACAGGGGTGGGTGTTGGGG + Intergenic
1076895101 10:133307284-133307306 TACCGCAGGGACGCGTGCTGAGG + Intronic
1076931957 10:133537332-133537354 TGCCAAAGGGAAGGGTCTTGGGG - Intronic
1077034777 11:489340-489362 TGGCACAGGGCAGGGTTCGGTGG + Intronic
1077111513 11:864163-864185 TGCCCCAGGGATGGGGGCAGGGG + Intronic
1077112089 11:866357-866379 AGGCTCAGGGGAGGGTGCTGTGG + Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1077487985 11:2847880-2847902 TGCCGCAGGGCTGGGTGATGTGG - Exonic
1077544767 11:3164620-3164642 TGCCCCAGAGATGGGGGCTGTGG + Intronic
1078852822 11:15179682-15179704 GGCCACAGGCTGGGGTGCTGGGG + Intronic
1078907116 11:15697854-15697876 TGCCACAGCTAAGGCTCCTGGGG + Intergenic
1079175555 11:18137106-18137128 TCCCACATGGCAGGGTGGTGGGG + Intronic
1079263906 11:18911471-18911493 TCCCACATGGCAGGGTGGTGGGG - Intergenic
1079266141 11:18934859-18934881 TCCCACATGGCAGGGTGGTGGGG - Exonic
1080034683 11:27699773-27699795 TGACTGAGGGGAGGGTGCTGGGG - Intronic
1080873717 11:36258734-36258756 TGCCACAGGGTGGGGCTCTGAGG + Intergenic
1081569217 11:44279248-44279270 TGTCATGGGGAAGGGCGCTGGGG - Intronic
1081755841 11:45543874-45543896 TGCCACAGGGAACTGTTATGTGG + Intergenic
1081984357 11:47290746-47290768 TGCCACAGGAAAGGGTCCTAAGG + Exonic
1082794817 11:57371246-57371268 TGCCCCAGGGCAGGGCTCTGGGG + Intergenic
1082802638 11:57425983-57426005 TGCCACAGGGCAGGCTGGTAAGG - Exonic
1083178782 11:60971166-60971188 TTCTACAGGGAAGGGTGCCAAGG - Intergenic
1083556332 11:63631692-63631714 TGACACTGGGACGGGTGCGGTGG + Intronic
1083619533 11:64042071-64042093 GGCCACAGGGAAGGTGGCGGTGG + Intronic
1083698870 11:64461098-64461120 TGCCACTGGGAATGGTGGGGAGG + Intergenic
1084525904 11:69697878-69697900 TTCCCCAGGGAAGAGTGCTGAGG + Intergenic
1084876324 11:72136254-72136276 TGCCACAGGTAAGGCCACTGAGG + Intronic
1084881299 11:72173323-72173345 TGCCACAGGTAAGGCCACTGAGG + Intergenic
1085445952 11:76600955-76600977 TGCTACATGGAAAGGTGCTTGGG + Intergenic
1085466893 11:76730135-76730157 TGACACAGGCAAGTGTGCAGAGG + Intergenic
1088648891 11:111940057-111940079 TGCCACAGGGAATGGAGCTTTGG + Intronic
1089011562 11:115136095-115136117 CAGCACAGGGAAGGCTGCTGTGG - Intergenic
1090517991 11:127448804-127448826 TCCCTCAGGGAAGGGTGAGGGGG + Intergenic
1090988751 11:131796742-131796764 TGGCACAGGGTAGGGCCCTGGGG + Intronic
1091178528 11:133582348-133582370 TGCCACAGGTAAGGATGGTGGGG - Intergenic
1091446941 12:549199-549221 AGCCACAGAGAAGGGGGGTGGGG - Intronic
1091655698 12:2345248-2345270 TTGAACAGGGAAGGATGCTGTGG + Intronic
1091890815 12:4052850-4052872 GGCCATGGGGAATGGTGCTGTGG - Intergenic
1092682054 12:10994185-10994207 TCCCAAATGGAAGGGTGATGTGG - Intronic
1093665027 12:21802205-21802227 TGCCTCAGAGAAGGGTGATGAGG + Intronic
1094497958 12:31000976-31000998 AGCCACAGGGAAGGGCAGTGGGG - Intergenic
1096421765 12:51464760-51464782 TTCCACTGGGTAGAGTGCTGAGG - Intronic
1096674281 12:53218230-53218252 TTTCAGAGGGAAGGGTGCTTGGG - Intronic
1096828012 12:54294315-54294337 TGCAGCAGGAAAGGGTTCTGAGG - Intronic
1097146419 12:56942424-56942446 TGTCCCAGGGAAGGGACCTGGGG + Intergenic
1097147310 12:56950716-56950738 TGCCCCAGGGAAGGGATCTGAGG + Intergenic
1097151181 12:56981041-56981063 TGCCCCAGGGAAGGGACCTGGGG + Intergenic
1097243609 12:57592739-57592761 TGGCAGAGGGTGGGGTGCTGGGG - Intronic
1097504535 12:60448839-60448861 TGCCACAGGGCTGGGCGCGGTGG - Intergenic
1097695154 12:62768260-62768282 TACCACAGGGCAGGGAGATGGGG + Intronic
1098077676 12:66750292-66750314 TCCCACAGAGAAGCATGCTGGGG + Intronic
1098228141 12:68345805-68345827 CAACACAGGGAAGGGTGCAGAGG - Intergenic
1098801241 12:74960866-74960888 TGCCACATGGAACAGTACTGAGG - Intergenic
1099844509 12:88012775-88012797 TGACATGGGGAAGGGTGCAGTGG + Intronic
1101527307 12:105543196-105543218 GGCCACAGGGCAGGGAACTGTGG - Intergenic
1101606277 12:106248912-106248934 AGCCTCTGGGATGGGTGCTGCGG + Intronic
1102016079 12:109648815-109648837 TGGCGCAGGGGAGGGTGGTGAGG + Intergenic
1102631272 12:114282747-114282769 GGGCACAGTGAAGGGGGCTGAGG + Intergenic
1103704400 12:122863472-122863494 TGCCAGAGGGAAGGCTGAGGTGG + Intergenic
1103835912 12:123820887-123820909 GGCCGCAGGGAAGGGGGATGGGG + Intronic
1103836188 12:123823096-123823118 TGGCCCAGGGAATGCTGCTGAGG + Intronic
1103898645 12:124291730-124291752 GGCCAGAGGGAAGGGTGTTGAGG - Intronic
1103945300 12:124522908-124522930 TGCCACAGGGAAGGGGATTTGGG - Intronic
1105247852 13:18668500-18668522 TGACTCAGGGTAAGGTGCTGGGG + Intergenic
1105546080 13:21352064-21352086 TGCCCCAGAGCAGGCTGCTGAGG - Intergenic
1106567255 13:30896898-30896920 GGAGACAGAGAAGGGTGCTGAGG + Intergenic
1106765331 13:32907767-32907789 GGCCATAGGGCCGGGTGCTGTGG + Intergenic
1106919043 13:34542979-34543001 TGACTTAGGGGAGGGTGCTGTGG - Intergenic
1107499806 13:40962136-40962158 TGCCTCTGGGAAGGGCACTGTGG - Intronic
1107567220 13:41617635-41617657 TGTCACAGGGCGGGGGGCTGGGG - Intronic
1107683554 13:42873654-42873676 TGCATCAGGGAAGGAGGCTGGGG - Intergenic
1108579987 13:51819787-51819809 TGCCACTAGGAAGGGTGATGTGG + Intergenic
1109612115 13:64779670-64779692 TGCTACAGGGCTGGGTGCAGTGG - Intergenic
1111489927 13:88958982-88959004 GGCCACAGGGCAGTGTGCTTAGG - Intergenic
1111818809 13:93189098-93189120 CCCCACAGGGAAGGTTGTTGTGG - Intergenic
1113670615 13:112173124-112173146 TGACCCAGGGGAGGGTGTTGGGG + Intergenic
1113974097 13:114213419-114213441 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1113974144 13:114213579-114213601 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1113974189 13:114213740-114213762 TTCCACAGGGATGGGGTCTGTGG - Intergenic
1113974259 13:114213965-114213987 TTCCACAGGGATGGGGTCTGTGG - Intergenic
1114563972 14:23614599-23614621 TTCCTCAGGGCAGGGTGATGGGG + Intergenic
1114704017 14:24707402-24707424 TGGCACAGGTAAGGGTGGAGTGG - Intergenic
1115135569 14:30103468-30103490 TGCCAGAGGGTAGGGGGCTGGGG + Intronic
1117841899 14:59869752-59869774 TGCAAGAGGGTTGGGTGCTGTGG - Intronic
1119354905 14:73998157-73998179 TGCCACCAGAAGGGGTGCTGAGG + Intronic
1119943996 14:78672650-78672672 TGCTAGAGGGAAGAGTCCTGTGG - Intronic
1121183340 14:91946095-91946117 AGCCAAAGGGAATGGGGCTGCGG - Intronic
1121521116 14:94586905-94586927 TGGCACATGGCAGGGCGCTGTGG - Intronic
1121710830 14:96038370-96038392 TGTCACAGGCAAGGAAGCTGTGG - Intergenic
1121803198 14:96792774-96792796 TGACACAGGAAAGGGTAATGAGG - Intergenic
1122315019 14:100820863-100820885 TGTCAAAGGGAAGGGGGCCGAGG - Intergenic
1122597388 14:102902848-102902870 TGAAACAGGGAAGCCTGCTGTGG + Intronic
1122715286 14:103693256-103693278 AGCCACCGAGAAGGGGGCTGGGG - Intergenic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122793714 14:104195266-104195288 TGAGGCAGGGAAGGGTGGTGCGG + Intergenic
1122853082 14:104547200-104547222 TGTCACAGAGAGGGGTGCTGCGG - Intronic
1122862051 14:104587134-104587156 TGTCACAGACAAGGATGCTGAGG + Intronic
1122993675 14:105250915-105250937 TGCCACTGGGAGGGGATCTGGGG - Exonic
1123983217 15:25622263-25622285 TCCCACAGTGTAGGGTGCAGAGG + Intergenic
1124150854 15:27176795-27176817 TGCCATAGGGTGGGGAGCTGAGG + Intronic
1124372687 15:29112313-29112335 TGCCACAGGGAATGTTTCTGTGG - Intronic
1125858222 15:42972184-42972206 TGCCAGGGGTAAGGGTGTTGGGG - Intronic
1127809732 15:62554199-62554221 TGCCACAGTGAGGGGGGCAGGGG - Intronic
1128467517 15:67925328-67925350 TGCCACGGGAAAGGGTGGCGTGG - Intergenic
1128549034 15:68585804-68585826 TGATTCGGGGAAGGGTGCTGGGG + Intronic
1128673355 15:69591078-69591100 TGCCACAGGGGTGGCTGCAGGGG + Intergenic
1130895802 15:88169650-88169672 GGCCACAGGGAAGCATGGTGGGG + Intronic
1131093636 15:89642169-89642191 GGCCTCAGGGTGGGGTGCTGGGG - Intronic
1132093129 15:98961679-98961701 TGCCTCAGGGAAGGGCTGTGTGG - Exonic
1132305994 15:100812970-100812992 TGCCACAGGCAAGGAGGATGTGG - Intergenic
1133035002 16:3029508-3029530 TGGCACAGGTAAGGGGGCTGGGG + Intronic
1133150248 16:3822844-3822866 CAAAACAGGGAAGGGTGCTGAGG + Intronic
1133225062 16:4337089-4337111 TGCCACAGGCCAGGGCACTGAGG - Exonic
1134090849 16:11390980-11391002 CAGCACAGGGAAGGGGGCTGGGG - Intronic
1134209536 16:12264492-12264514 CTCCACAGGGCCGGGTGCTGTGG + Intronic
1134629240 16:15745094-15745116 GGCCCCTGGGAAGGGGGCTGGGG + Intronic
1135221908 16:20621332-20621354 TGGCCCAGGGTAGGGTCCTGGGG + Intronic
1135327090 16:21533350-21533372 GCCCACAGGGAAAGGAGCTGAGG + Intergenic
1135906666 16:26518415-26518437 GGCCTCAGTGAAGGATGCTGTGG - Intergenic
1136374187 16:29855434-29855456 TACCACTGTGAATGGTGCTGCGG - Intergenic
1136991187 16:35152273-35152295 TCCCACAGGGAGGGGTACAGGGG - Intergenic
1138091538 16:54178714-54178736 TGCCACAGAGAATGTTGCTTGGG + Intergenic
1138093559 16:54195037-54195059 GGCCACAGGGAGGCCTGCTGGGG + Intergenic
1138294190 16:55872774-55872796 GGTGTCAGGGAAGGGTGCTGAGG - Intronic
1139401485 16:66685381-66685403 TGGCTCAGGGAAGACTGCTGTGG + Intronic
1139482677 16:67239213-67239235 TGCCCCAGGGAAGTGTGCCAGGG - Intronic
1139671036 16:68492678-68492700 TGGCACAGGGTGGGGAGCTGTGG + Intergenic
1139706565 16:68745013-68745035 TGCCACTGTGCAGGGTGCTCAGG + Intronic
1139710004 16:68768907-68768929 TGCCTGGGGGAAGGGTGCTCTGG - Intronic
1140556806 16:75930684-75930706 CTCCAGAGGGAAGAGTGCTGTGG + Intergenic
1141148421 16:81547853-81547875 TGCCCCAGGGCCAGGTGCTGTGG + Intronic
1141324136 16:83039646-83039668 AGGCACTGGGCAGGGTGCTGAGG - Intronic
1141515989 16:84545393-84545415 TGTCACAGAGAAGGGTGGGGAGG + Intronic
1141691852 16:85601129-85601151 AGGCCCAGGGAAGGGTGGTGGGG + Intergenic
1141853823 16:86667265-86667287 GGACACAGGGAAGGGTGGTTTGG + Intergenic
1141894975 16:86953601-86953623 TGCCAAAGGGGAGGGAGCTCTGG + Intergenic
1142134024 16:88443511-88443533 AGCCACAGGAGAGAGTGCTGCGG + Intergenic
1142165257 16:88583418-88583440 TGCCCCAGAGCAGGGTGATGTGG - Intronic
1142193999 16:88731223-88731245 GGCCACAAAGAAGGGTGCTGAGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142738407 17:1916324-1916346 TGGCAGAGGGAGGGGTGATGTGG + Intergenic
1143119751 17:4599458-4599480 TGCCGCTGGGGTGGGTGCTGGGG - Intronic
1143741728 17:8959266-8959288 TCCCACAGGGAGCTGTGCTGGGG + Intronic
1143848858 17:9794404-9794426 TGTCACAGGGCAGGGGCCTGGGG - Intronic
1144148711 17:12422816-12422838 TGCCACAGTGCAGCATGCTGGGG + Intergenic
1144838483 17:18171134-18171156 TGTCAGAGGGAAGAGGGCTGGGG + Intronic
1146545040 17:33731047-33731069 TGCCCCATGGAAGTGGGCTGAGG + Intronic
1146888899 17:36492143-36492165 AGTCACAGGAAAGGGTTCTGAGG - Intronic
1147320978 17:39645845-39645867 TGTCACAGGGATGGGTGTTGAGG - Intronic
1147954051 17:44122705-44122727 GGCCCCAGGGAAGGGTGGGGTGG + Intronic
1148052637 17:44776667-44776689 TGCCCCAGGGAGGAATGCTGGGG - Intronic
1148821851 17:50364483-50364505 TGGCACAGGGAAGGGACCAGAGG - Intergenic
1148866073 17:50629366-50629388 GGCCACAGAGAGGGCTGCTGGGG - Intergenic
1149523909 17:57339493-57339515 TGCCACAGGGAGGGGGCCCGAGG - Intronic
1150011223 17:61506034-61506056 GGCCTCAGGGAGGGGTGATGTGG - Intergenic
1151291996 17:73157028-73157050 TGCCAAAGGGAAGTGAGGTGAGG + Intergenic
1151546847 17:74798559-74798581 AGCCACAGAGCAGGGTGCTGGGG + Intronic
1152691966 17:81722426-81722448 CACCACAGGGCAGGGTGCAGAGG + Intergenic
1154440997 18:14390634-14390656 TGACTCAGGGTAAGGTGCTGGGG - Intergenic
1154948436 18:21184811-21184833 TGCAACCTGGAAGGGGGCTGGGG + Intergenic
1155547553 18:26930842-26930864 TGGCAGAGGGGAGGGAGCTGGGG + Intronic
1156339719 18:36200332-36200354 TGCCACAGGGGAGGGGTCAGAGG + Intronic
1157495630 18:48155150-48155172 GGCCCCAAGGAAGTGTGCTGGGG + Intronic
1157564883 18:48673098-48673120 TGCCACAGAGATGGGGGCAGGGG - Intronic
1157893135 18:51437901-51437923 TGCTACAGGGAAGAGTGATGAGG - Intergenic
1158778286 18:60614471-60614493 TTCCACAGGGCAGGGGGCCGAGG - Intergenic
1158844663 18:61429006-61429028 TGTCACAGGGTGTGGTGCTGTGG - Intronic
1159816548 18:73080669-73080691 GGCCACAGGGAAGGTGACTGCGG + Intergenic
1160406445 18:78649604-78649626 TGCAACTGGGAAGGATGCAGTGG + Intergenic
1160510036 18:79448275-79448297 AGCCATCAGGAAGGGTGCTGGGG + Intronic
1160873730 19:1287928-1287950 TGCCACAGGGCTGTGGGCTGCGG + Intronic
1161531968 19:4795129-4795151 TGACTCAGGGTAAGGTGCTGGGG + Exonic
1162013544 19:7831546-7831568 TCCCACAGGGGTAGGTGCTGGGG - Intronic
1162081450 19:8220251-8220273 AGCCTCGGGGAGGGGTGCTGAGG - Intronic
1162155835 19:8677515-8677537 TGCCCCAGGGAACAGTCCTGAGG + Intergenic
1162531376 19:11238153-11238175 TGCCCCAGGGAAGGGGGGTAGGG - Exonic
1162821405 19:13225598-13225620 TGGCACAGAGAAGGGGGGTGAGG + Intronic
1163082895 19:14956435-14956457 TGCAACCAGGAATGGTGCTGGGG + Intronic
1163093144 19:15035391-15035413 GGCCAATGGGAAGGGTGATGGGG - Intergenic
1163440021 19:17317904-17317926 AGCCTCTGGGAAGGGAGCTGGGG - Intronic
1164402201 19:27910072-27910094 TGCCACGGTGGAGGGGGCTGGGG - Intergenic
1164641301 19:29827927-29827949 TGCCAGAGGGCCGGGTGCGGTGG - Intergenic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1166151977 19:40881442-40881464 GGCCACAGTGAAGGGAGATGGGG + Intronic
1166738382 19:45099497-45099519 TCCAACAGGGCAGGGGGCTGGGG - Intronic
1166751450 19:45165630-45165652 GGCCACAGGAAAGGGGGCTGTGG + Intronic
1166755321 19:45187216-45187238 TGGGACAGGGATGGGGGCTGGGG + Intronic
1167096895 19:47379496-47379518 TGAGTCAGGGAAGGGGGCTGGGG - Intronic
1167455594 19:49595616-49595638 TGCCACTGGGAAGGCCTCTGGGG + Exonic
1167646899 19:50710861-50710883 AGCCAGAGGAAAGGGGGCTGTGG - Intronic
1167704479 19:51071241-51071263 TGCCACCAGAAAAGGTGCTGAGG + Intergenic
1167713318 19:51125418-51125440 GGCCACAGGGAAAGGTCATGGGG + Intronic
1167851449 19:52205547-52205569 TGGCAGAGGGAACAGTGCTGAGG + Intronic
1202647037 1_KI270706v1_random:152548-152570 AGCCACAGGGGATGGGGCTGAGG + Intergenic
925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG + Intronic
925589119 2:5492881-5492903 TGCCACAGGGACGTGTGATGGGG - Intergenic
925640518 2:5982040-5982062 GGCCACAAGGCAGGATGCTGAGG + Intergenic
925730975 2:6918984-6919006 TGCCCCAGTGAATGGGGCTGGGG + Intronic
925827174 2:7860765-7860787 CTCCACAGGGAAGGGGGCAGTGG + Intergenic
926053132 2:9757370-9757392 AGCCATGGGGAAGGCTGCTGAGG - Intergenic
926261550 2:11268179-11268201 TGCCACAGGAACCAGTGCTGAGG + Intronic
926553726 2:14332169-14332191 AGACACTGGGAAGGGTGGTGGGG - Intergenic
927066117 2:19472672-19472694 GGCAACAGAGAAGGGAGCTGAGG + Intergenic
927152457 2:20203860-20203882 TGCCACCGAGAGGGCTGCTGAGG - Exonic
927740688 2:25566862-25566884 TGCTAAAGGGAAGTGAGCTGTGG + Intronic
927765499 2:25803567-25803589 TGCATCAGGGACTGGTGCTGTGG + Intronic
929656790 2:43740985-43741007 AGCCACAGGAAAGGATGATGGGG - Exonic
929764929 2:44836540-44836562 TGCCACTGTGCAGGGGGCTGCGG - Intergenic
930534427 2:52629443-52629465 GGCCACAGTAAAGGGTGATGAGG + Intergenic
931140919 2:59456646-59456668 AGACACAGGGATGGGTGGTGGGG + Intergenic
931458808 2:62432964-62432986 TGGAAGAGGGAAGGGAGCTGTGG + Intergenic
932024511 2:68119840-68119862 TGGCATTGGGAAGGGTGCTGGGG - Intergenic
932391417 2:71394024-71394046 TAGCACAGGGAAGAATGCTGGGG - Intronic
934695902 2:96399959-96399981 AAGCACAGGGAAGGATGCTGAGG + Intergenic
935690547 2:105727458-105727480 GGCCGCAGGGAAAGGAGCTGAGG + Intergenic
935725578 2:106021154-106021176 AACCACAGGGAATGGGGCTGAGG + Intergenic
935732295 2:106074074-106074096 TTCCACAGGGAAGGGTGGCAGGG + Intronic
938195681 2:129325561-129325583 TGCAACAGAGAACTGTGCTGAGG - Intergenic
938899963 2:135791451-135791473 TGCCACAGGGGTGCCTGCTGGGG + Intronic
939968464 2:148634411-148634433 TGCCACAGGCACTGGTGGTGTGG + Intergenic
942248582 2:174028699-174028721 TGCCGGAGGGCTGGGTGCTGTGG - Intergenic
942385628 2:175439642-175439664 TGCCATGGGGCAGGGTGCAGTGG + Intergenic
942890169 2:180979929-180979951 TGCCAAAGGGAAGTGTCCTTCGG - Intronic
943516251 2:188890904-188890926 TGCCACGGAGCAGGGTGCAGCGG - Intergenic
944213088 2:197226736-197226758 TTCCACAGGTAAGGAAGCTGAGG + Intronic
944218224 2:197276832-197276854 TGCCACAGGTATTTGTGCTGTGG - Intronic
945476497 2:210287880-210287902 TGCAAAAGGGAAGGGTGATGAGG - Intergenic
946201367 2:218072671-218072693 TGGCAATGGGAAGGGTGCAGGGG - Intronic
946378284 2:219327468-219327490 GGGCAATGGGAAGGGTGCTGGGG + Exonic
946436508 2:219659872-219659894 TGGCACAGCGGAGGGGGCTGGGG - Intergenic
946576469 2:221081374-221081396 GGCCACAGGGAAGTGAGCAGAGG + Intergenic
948464526 2:238145843-238145865 GGCCCCAGGGAAGGGTGGAGAGG - Intronic
948553671 2:238792793-238792815 TGCCACAATGGTGGGTGCTGGGG - Intergenic
948831269 2:240599321-240599343 TGCCCCAGGCCAGGGGGCTGAGG + Intronic
948834026 2:240615856-240615878 TGCAGCAGGGAAGGGAGATGAGG + Intronic
1168954902 20:1828023-1828045 TGCCAAAGGGAGGGGTGGGGCGG + Intergenic
1169075425 20:2757129-2757151 TGAGACAGGGGAGGGGGCTGTGG + Intronic
1169340886 20:4795435-4795457 TCCCAGTGGGGAGGGTGCTGGGG + Intronic
1169511302 20:6267114-6267136 TGCCACAAGGAAGGCTGCTGTGG + Intergenic
1170588607 20:17754180-17754202 TGCCGCACTTAAGGGTGCTGGGG - Intergenic
1170626917 20:18037163-18037185 TGCAACAGGGCAGGCTGGTGAGG + Intronic
1171317691 20:24209823-24209845 TGCTATCTGGAAGGGTGCTGGGG + Intergenic
1171402315 20:24882788-24882810 TGCCACAGGGCTGGGGGCTGGGG - Intergenic
1172607261 20:36222387-36222409 AGCCACAGGTAAGGCTCCTGAGG + Exonic
1172824253 20:37767030-37767052 TGCCACTGGGGAGGCTGATGTGG + Intronic
1173259196 20:41418393-41418415 GGCAACAGGGAAGGGTATTGTGG + Intronic
1173759614 20:45547964-45547986 TGCCACAGAGCAGGGTGTAGGGG + Intergenic
1174794519 20:53510964-53510986 AGCCACAGGGTGTGGTGCTGGGG - Intergenic
1175645034 20:60663854-60663876 GGCCTCGGGGAAGGGTGCTGGGG + Intergenic
1176030351 20:63008513-63008535 TGGCACAGGGAAGGGCAGTGAGG + Intergenic
1176299250 21:5090847-5090869 TGCCACAGAGAAGGCTCCCGGGG - Intergenic
1176455055 21:6900561-6900583 TGACTCAGGGTAAGGTGCTGGGG + Intergenic
1176833228 21:13765609-13765631 TGACTCAGGGTAAGGTGCTGGGG + Intergenic
1178462831 21:32818535-32818557 TGCAGCAGGGCAGGGAGCTGAGG - Intergenic
1178485559 21:33018010-33018032 TTCCTCAGGGCAGGGTGCGGTGG - Intergenic
1179648814 21:42793327-42793349 TGCGAGAGGGGATGGTGCTGGGG + Intergenic
1179801361 21:43812940-43812962 AGCCTCGGGGAAGGGGGCTGTGG - Intergenic
1179857776 21:44171100-44171122 TGCCACAGAGAAGGCTCCCGGGG + Intergenic
1179958795 21:44756837-44756859 TGCCACAGGGAAGACTGATAGGG + Intergenic
1180354790 22:11829630-11829652 AGCCACAGGGGATGGGGCTGAGG - Intergenic
1180354872 22:11829921-11829943 AGCCACCGGGGATGGTGCTGAGG - Intergenic
1180383379 22:12162410-12162432 AGCCACCGGGGATGGTGCTGAGG + Intergenic
1180383461 22:12162701-12162723 AGCCACAGGGGATGGGGCTGAGG + Intergenic
1180801213 22:18632825-18632847 TACAACTGTGAAGGGTGCTGTGG + Intergenic
1180852442 22:19028382-19028404 TACAACTGTGAAGGGTGCTGTGG + Intergenic
1180984802 22:19898003-19898025 AGCCACAGGGGCGGGAGCTGGGG + Intronic
1181139593 22:20794686-20794708 TGAAACAGGGCAGGGTGGTGAGG - Intronic
1181220508 22:21362436-21362458 TACAACTGTGAAGGGTGCTGTGG - Intergenic
1181381988 22:22512838-22512860 GTCGACTGGGAAGGGTGCTGGGG - Intergenic
1181637177 22:24179954-24179976 GGCTCCAGGGAGGGGTGCTGGGG - Intergenic
1181840838 22:25659110-25659132 TGCCTCAGAGCATGGTGCTGGGG - Intronic
1182016055 22:27040690-27040712 TATCACAGGGAAAGGTGCTCTGG + Intergenic
1182353205 22:29710444-29710466 GGGCACAGGGAAGAGGGCTGGGG - Intergenic
1183049527 22:35249550-35249572 TTCCTCTGAGAAGGGTGCTGGGG + Intergenic
1183165900 22:36147304-36147326 GGCCACAGGGATCAGTGCTGAGG - Intronic
1183228528 22:36566308-36566330 TGCCACTGGGAAGAAGGCTGGGG - Intronic
1183573000 22:38668408-38668430 TCCCACAGGCTAGGGTGCAGTGG + Intronic
1183660366 22:39216425-39216447 AGGCACAGGGCCGGGTGCTGTGG + Intergenic
1184253716 22:43275454-43275476 TCACACAGGGCAGGGTGCAGAGG - Intronic
1184394281 22:44223585-44223607 GGCCACAGGAGAGGGTGATGAGG - Intergenic
1184434081 22:44459486-44459508 GGCCTTAGGGAAGGGTGCAGTGG - Intergenic
1184455530 22:44607667-44607689 TGCGGCAGGGAAGGGAGGTGTGG + Intergenic
1184475989 22:44721731-44721753 GGCCACAGACAAGGGTGCCGAGG + Intronic
1184671443 22:46014017-46014039 TGCCGCAGGGAAGGGAGCGGCGG - Intergenic
1184902489 22:47456532-47456554 TGCCACAGGGGAGGGGCCAGAGG + Intergenic
1184981271 22:48097399-48097421 TGCGACAGGGAAGGGGCCTTAGG - Intergenic
1185245795 22:49772003-49772025 TGCCACTTGCAGGGGTGCTGAGG - Intergenic
1185389148 22:50549470-50549492 GGCCACAGGGAAGGTGCCTGCGG - Exonic
950447327 3:13045791-13045813 GGCCCCAGGGAAGGAGGCTGAGG - Intronic
950550822 3:13664904-13664926 ATCCCCAGGGCAGGGTGCTGAGG + Intergenic
950634885 3:14307716-14307738 TGCCACTGGGAATGTGGCTGTGG + Intergenic
950669408 3:14517133-14517155 ATCCACGGGGAAGGGTGCTGGGG + Exonic
951860319 3:27244751-27244773 GGCCACAGGGAAGGGAGAAGAGG - Intronic
953412316 3:42697415-42697437 TGCCACAGTCAGGGGAGCTGAGG - Intronic
953479104 3:43234056-43234078 TGCCACAGGGAAAGGGGCTTTGG + Intergenic
954144431 3:48627411-48627433 TGAGACAGGGCAGGGTGCCGAGG - Intronic
954372064 3:50174204-50174226 GGCCACAGGGAAGGCTGCATAGG - Intronic
954859341 3:53674691-53674713 TGCTACAGAGAAGGGAGCTGGGG + Intronic
955233461 3:57119917-57119939 TGCCCCAGTGCAGGGTGCTAGGG - Intronic
955364539 3:58299834-58299856 TGGCAGAGGGGTGGGTGCTGGGG + Intergenic
957053546 3:75427743-75427765 TGGCACAGGGCAGGGCACTGAGG - Intergenic
961119809 3:124364348-124364370 TGAGACAGGGAAGGGTCATGAGG - Intronic
961367127 3:126407045-126407067 TCTCACAGGGGAGGGAGCTGAGG + Intronic
961374821 3:126457129-126457151 TGGAACAGGGAAGGGCACTGGGG + Intronic
961525237 3:127492622-127492644 TGCCACAGGGGAGTGGGCAGGGG + Intergenic
961598634 3:128041648-128041670 TGGCAGAGGGCAGGGAGCTGTGG - Intergenic
963368689 3:144369629-144369651 TGCTCAAGGGAAGGCTGCTGGGG - Intergenic
963882031 3:150538921-150538943 TGGCACAGAGAAGGGTGCACTGG + Intergenic
966519176 3:180854690-180854712 TGCCACAGTCCAAGGTGCTGGGG - Intronic
966629994 3:182061884-182061906 AGCCACAGGGAAGTGTTCTGTGG - Intergenic
967266458 3:187696294-187696316 AGCCAGAGGGGAAGGTGCTGGGG + Intergenic
968021042 3:195389817-195389839 TGCCACTGGGAAAGGTTCTGAGG - Intronic
968353480 3:198081252-198081274 AGCCACCGGGAATGGGGCTGAGG + Intergenic
970426337 4:15949576-15949598 TGCCACACGGCCGGGTGCGGTGG + Intergenic
972933603 4:44104607-44104629 AGGCACAGGAAAGGGTGCAGTGG + Intergenic
975826031 4:78320362-78320384 TGCCAAAGTGGAGGGTGATGTGG + Intronic
976475256 4:85475622-85475644 TGCGCCAGGGGAGGGGGCTGCGG + Intronic
976600801 4:86935672-86935694 AGGCACAGGGAAGGGTCCCGGGG - Intronic
978964699 4:114726094-114726116 TGCAGCAGGGAGGTGTGCTGGGG - Intergenic
980323283 4:131307068-131307090 TGCTACAGTGAATGGTGCTGTGG - Intergenic
981603137 4:146514306-146514328 GGCCACAAGGCACGGTGCTGGGG - Intronic
983255404 4:165394448-165394470 GGCCTCTGGGAAGGGTGTTGTGG + Intronic
983455244 4:167954857-167954879 TGTCACAGGGCAGGATACTGTGG + Intergenic
984805663 4:183749107-183749129 CGCGACAGGCAAGGGAGCTGCGG - Intergenic
985097870 4:186430662-186430684 TGACCCAGGGAAGTGTGCTCCGG + Intronic
985218388 4:187676721-187676743 GGCCACTGGGAAGGATGGTGTGG - Intergenic
985505642 5:278782-278804 GGACACAGGGGAGGGTGCTGGGG + Intronic
985659108 5:1147056-1147078 TGCCACATGGATGGAGGCTGAGG - Intergenic
985785058 5:1888976-1888998 GGGCACAGGGAAGGGGGCTCTGG + Intergenic
985790107 5:1921976-1921998 TCCCACCCGGAAGAGTGCTGAGG + Intergenic
986018998 5:3783515-3783537 TGTCACAGGGGAGGATGCTGTGG - Intergenic
987476059 5:18393686-18393708 TGCCTCAGGCAAGGCTCCTGAGG - Intergenic
988158775 5:27492177-27492199 GGCTACAGGGAAAGATGCTGGGG - Intergenic
989030305 5:37111566-37111588 TGCCAAAGGGAAGGGTGCAGTGG + Intronic
989966095 5:50467391-50467413 TTCCAAAGGGAAGGGTGCATAGG - Intergenic
990993194 5:61705001-61705023 AGACACAGGGCCGGGTGCTGTGG - Exonic
992023372 5:72647392-72647414 AGCTACAGGGAAGGGATCTGAGG + Intergenic
994173687 5:96686525-96686547 TTCCAGAGGGATGGGGGCTGAGG + Intronic
994773304 5:104011333-104011355 TACCACAGGGCAGGGAGCGGTGG - Intergenic
996132452 5:119797994-119798016 TGCCGCACGGAAGGGAGCTTAGG + Intergenic
997721448 5:136080975-136080997 TGCCAAAGGCAGGGGTTCTGTGG + Intergenic
997894067 5:137700096-137700118 TGCCCCAGGGCACTGTGCTGAGG - Intronic
998140732 5:139698026-139698048 TGCCTCAGGAGCGGGTGCTGTGG + Intergenic
999453280 5:151694379-151694401 TGCAAGTGGGGAGGGTGCTGAGG - Intergenic
1001797763 5:174516178-174516200 TACAACAGGGAAGGGGGCTTAGG - Intergenic
1002495196 5:179606993-179607015 TTCCACAGGGGAGGCGGCTGAGG - Intronic
1002630969 5:180578089-180578111 TTCCAAAGGGAAGAGTGCAGGGG + Exonic
1002813473 6:656947-656969 TGCCACAGGGAAGGCAGCTGGGG + Exonic
1003558044 6:7158191-7158213 GGCCACAGGCAAGTGTCCTGGGG - Intronic
1004115470 6:12762668-12762690 TGGCACAGGGAGGAGTTCTGAGG - Intronic
1005810271 6:29509885-29509907 TGGCACAGGGCATGGTCCTGGGG + Intergenic
1006316792 6:33296192-33296214 TGCAGCAGGGAAGGGTGTTGGGG - Exonic
1007222755 6:40292104-40292126 TGCCACAAGGCAGGGTGTGGAGG + Intergenic
1008176713 6:48277039-48277061 GGCTACAGGGAAGGTTTCTGGGG + Intergenic
1008678459 6:53845935-53845957 TTCCACATGGGAGGGTGCAGGGG - Intronic
1009485688 6:64219029-64219051 TACAACAGGGAAAGGTGTTGTGG + Intronic
1010511909 6:76730201-76730223 TTCCAGAGGGAAGGGTGTAGGGG + Intergenic
1011746730 6:90413659-90413681 TGCCAGAGGGAAGGATGATGAGG + Intergenic
1012334166 6:98033099-98033121 TGCCACAGGAAAAGTTGCTCTGG + Intergenic
1013241692 6:108252350-108252372 GGCCACAGGGAAGGGTTCCCTGG + Intronic
1015519661 6:134117650-134117672 TGCCACAGGGACGTCTCCTGGGG + Intergenic
1016526236 6:145004648-145004670 TGTCACAGGGAAGACAGCTGTGG + Intergenic
1016869709 6:148804452-148804474 TGCCACATGCAAGGGTGAAGTGG + Intronic
1018434520 6:163748766-163748788 AGCCACAGGGAAGCATGCTCAGG - Intergenic
1019155788 6:170038060-170038082 TGTCACAGGGGAGGGTGTGGGGG + Intergenic
1019366973 7:638369-638391 AGCCCCAGTGAAGGGAGCTGGGG - Intronic
1019391715 7:791363-791385 TGTCCCAGGGAAGGGTGTTCAGG + Intergenic
1019505476 7:1388409-1388431 GGACACAGTGAGGGGTGCTGTGG - Intergenic
1019525090 7:1477221-1477243 TCCCAAAGGGAATGGGGCTGTGG - Intronic
1019716423 7:2541462-2541484 GGCCACGGTGAAGGGCGCTGGGG + Exonic
1020357474 7:7293012-7293034 TCCCACAGAGAAGTATGCTGGGG - Intergenic
1021178900 7:17483351-17483373 TGCCACATGGCAGGGTGGTGAGG - Intergenic
1022056022 7:26735102-26735124 TGAGAGAGGGAAGGATGCTGTGG - Intronic
1023150327 7:37195820-37195842 AGTCACAGGGAAGGCTGCAGTGG + Intronic
1023797789 7:43808197-43808219 TGCCACAGGGAGAGGGGCTGAGG - Intergenic
1023995195 7:45155571-45155593 AGACACAGGGAATGGTGCCGGGG + Intergenic
1024540041 7:50468651-50468673 TGCCACAGAGGAGGTGGCTGGGG + Intronic
1025139714 7:56452026-56452048 TGCCAGTGGGTGGGGTGCTGGGG - Intergenic
1025942045 7:66082022-66082044 GGCCACAGGGAAGGGGCCTTGGG - Intronic
1027754618 7:82196487-82196509 TGCCATTAGGAATGGTGCTGTGG + Intronic
1029778447 7:102705405-102705427 TACCACAGAGACAGGTGCTGGGG + Intergenic
1030128729 7:106179028-106179050 TGAAAGAGAGAAGGGTGCTGAGG - Intergenic
1031973636 7:128080602-128080624 TGCCACGGGGAAGGGAGATGGGG + Intronic
1032500632 7:132397022-132397044 TGGCACAGGGATGGGGGCTGGGG + Intronic
1032851495 7:135799236-135799258 GGCCACAGGGAGATGTGCTGTGG - Intergenic
1033216797 7:139499347-139499369 TGCCTGTGGGAAGGGTGGTGGGG + Intergenic
1033463390 7:141568125-141568147 TGCCAGTGGGAAGGGAGATGTGG + Intronic
1034079851 7:148266508-148266530 TGCCACAGGCAGGGGTGGTTGGG - Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034492980 7:151404274-151404296 TGCCACAGGGCAGAGGGCAGAGG - Intronic
1034893156 7:154858162-154858184 TGCTCCGGGGCAGGGTGCTGTGG + Intronic
1035022601 7:155808341-155808363 AGCCCCAGGGGAGGGAGCTGCGG - Intronic
1036148690 8:6278301-6278323 TGGTACAGGGCAGGGTGCAGTGG + Intergenic
1037673945 8:21038488-21038510 GGCCACATGGCAGGGAGCTGTGG - Intergenic
1038896142 8:31784631-31784653 TGCCAAAGAGCAGGGTTCTGGGG + Intronic
1039798948 8:40937983-40938005 GGCCACAGGGCAAGGTCCTGAGG + Intergenic
1039846700 8:41330549-41330571 GGCCCCAGGGAAGGGAGCAGGGG - Intergenic
1040920818 8:52614603-52614625 TGACCTAGAGAAGGGTGCTGGGG + Intergenic
1042582232 8:70292435-70292457 TGCCTCAGGGCTGGGTGCGGTGG - Intronic
1043318579 8:78952112-78952134 TGTCACAGGGTAGGGGGCTAGGG + Intergenic
1043327625 8:79071909-79071931 CTCCACAGGCAAGGCTGCTGGGG - Intergenic
1044915309 8:97107329-97107351 TGGCACAGGGAAAGGGCCTGAGG + Intronic
1046401128 8:113704484-113704506 TGCCACAGGGAAGCTTTCTCAGG + Intergenic
1046494219 8:114993330-114993352 TGCCACAGGGCAAAGGGCTGCGG - Intergenic
1046970466 8:120217116-120217138 TGCCACAGGGGATGGGGGTGGGG + Intronic
1047533074 8:125694838-125694860 TTCCAAAGGGGAAGGTGCTGTGG + Intergenic
1047934140 8:129760199-129760221 TGAGACTGGGAAGGGTGGTGGGG + Intronic
1047951572 8:129939741-129939763 TGCCACAGGGGCAGGTGTTGAGG - Exonic
1048400941 8:134069909-134069931 AGCCACAGTGAATGGTGATGAGG - Intergenic
1049154332 8:141057580-141057602 TGCCACAAGGAAAGTTGCTGGGG - Intergenic
1049359054 8:142203270-142203292 TGTCCCAGGGGAGGGGGCTGAGG - Intergenic
1049367853 8:142249342-142249364 GGCCACCGGGAAGGCTGCCGAGG + Intronic
1049674380 8:143883263-143883285 CGCCACAGGGAAGGGGCCAGGGG + Intergenic
1053008036 9:34617032-34617054 TGCCACAGGGAGGGATGGAGAGG + Intronic
1053141330 9:35684676-35684698 TCCCACAGGGGAGGGAGGTGAGG - Intronic
1055730812 9:79277863-79277885 TGCCACAGGGCACGGGGCCGGGG + Intergenic
1056008805 9:82303231-82303253 TGTCAGGGGAAAGGGTGCTGTGG + Intergenic
1057048805 9:91906426-91906448 TGCCACTAAGAAGGGTGCTGTGG - Intronic
1057083985 9:92192026-92192048 TGCAGCAGGAAATGGTGCTGAGG - Intergenic
1057274743 9:93670311-93670333 AGCCACAGGGAAGTGGGCAGGGG + Intronic
1057292449 9:93815300-93815322 TCCCACAGGGAAGGGAGGTGAGG - Intergenic
1057797964 9:98171806-98171828 TGCCGCTGGGAGAGGTGCTGGGG + Intronic
1058949474 9:109890307-109890329 GGCCACAGGGAAGAGTACTGTGG + Intronic
1059305491 9:113350212-113350234 TTCCACAGGGGCGGGAGCTGGGG - Intronic
1060408897 9:123386963-123386985 TGCCCCCTGGAAGGTTGCTGTGG + Intronic
1060823455 9:126674269-126674291 TTCCACAGGGCATGGTGTTGGGG - Intronic
1060960908 9:127680015-127680037 GGCCGCAGGGAAGGGAGCTCTGG + Intronic
1061493086 9:130956986-130957008 AGCAGCAGGGAAGGGGGCTGAGG - Intergenic
1061791976 9:133063763-133063785 TGGCACAGGGAAGCGTGGCGGGG + Intronic
1062018368 9:134303817-134303839 TGCCATGGGGAGGGGGGCTGAGG - Intergenic
1062264128 9:135679077-135679099 TGCCATTGGGAACGCTGCTGGGG - Intergenic
1062532895 9:137009482-137009504 TGGCACCGGAAGGGGTGCTGTGG + Intronic
1203697079 Un_GL000214v1:109005-109027 AGCCACCGGGAATGGGGCTGAGG + Intergenic
1185855852 X:3534343-3534365 TAACACTGGGAAGTGTGCTGGGG + Intergenic
1185925060 X:4136719-4136741 TGTCACAAGAAAGGGTGGTGAGG + Intergenic
1187855578 X:23633492-23633514 TTCCACAGGGAAGGTTGAGGTGG - Intergenic
1189056098 X:37700817-37700839 AGCCACAGGGATGGGTGGAGAGG + Intronic
1189247564 X:39575600-39575622 TGCCACACGGCTGGGGGCTGTGG - Intergenic
1189394296 X:40607017-40607039 TGCTACAGGGCCGGGTGCAGTGG - Intergenic
1190282072 X:48937536-48937558 TGGAACAGGGAAGGGATCTGGGG + Intronic
1190774788 X:53544051-53544073 TGCCACAGGGCATCTTGCTGAGG + Intronic
1192726365 X:73757408-73757430 TGACACAGGGCTGGGTGCGGTGG - Intergenic
1193020130 X:76782558-76782580 TGTCACAGGGTTGGGTGCGGTGG - Intergenic
1194720278 X:97332926-97332948 TGCCAAAGGGAAGGTCCCTGGGG - Intronic
1196189185 X:112777235-112777257 TGACACAGGGCAGGGACCTGTGG + Exonic
1197160862 X:123320437-123320459 TGGAAAAGGGAAGGGTGCTGAGG + Intronic
1197171035 X:123434654-123434676 AGCCACAGGTGAGGATGCTGAGG + Intronic
1197776527 X:130121801-130121823 TGCCCAAGGGAAGGGGTCTGGGG + Intergenic
1197936785 X:131747720-131747742 TCCCAGGGGGAAGGGTGCGGTGG + Intergenic
1198878811 X:141256528-141256550 TGCCACCTGGCAGGGTGCAGTGG - Intergenic
1199137033 X:144265863-144265885 TGCCACGGGGTAGGCTGCAGTGG - Intergenic
1199853132 X:151739375-151739397 GGCCATAGGGCAGGGGGCTGGGG - Intronic