ID: 925117678

View in Genome Browser
Species Human (GRCh38)
Location 2:1394326-1394348
Sequence CAGTTTCATTTTGACGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925117674_925117678 17 Left 925117674 2:1394286-1394308 CCTTGTAATGGAACGTATAAAGG 0: 1
1: 0
2: 1
3: 3
4: 69
Right 925117678 2:1394326-1394348 CAGTTTCATTTTGACGACCATGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925117678 Original CRISPR CAGTTTCATTTTGACGACCA TGG Intronic
907813570 1:57896190-57896212 CAGTTTCTTTATGTCAACCAAGG + Intronic
911180034 1:94852310-94852332 CATTTTAAATTTGACGATCAGGG + Intronic
911415651 1:97569132-97569154 CTGCTTCATTTTTACAACCAAGG - Intronic
912533712 1:110346795-110346817 CAATTTCATTTTGACTATCACGG + Intergenic
916504365 1:165414669-165414691 TAGTTTCATTTTGATAATCATGG + Intronic
916943188 1:169697921-169697943 GAGTTTCATTTTGAAGAAAAAGG + Intronic
919459833 1:197863481-197863503 CATTTTAATTTTGACTACCATGG + Intergenic
920241158 1:204551680-204551702 ATGTGTCATTTTGAAGACCAAGG + Exonic
921059136 1:211567834-211567856 GAGTTTCAATTTGACTATCAAGG + Intergenic
921299822 1:213740560-213740582 CATTTTAATTTTGAGGACCCTGG - Intergenic
921480111 1:215655061-215655083 CAAAATCATTTTGATGACCATGG - Intronic
1069607270 10:69747597-69747619 CAGTTTCTGTTTGAAGAACAAGG - Intergenic
1075318368 10:121469852-121469874 CAGCTTCATTTAGAAGACAAGGG + Intergenic
1076396357 10:130140619-130140641 CAGTTTCATTATTACTAACATGG - Intronic
1080363165 11:31540164-31540186 CATCTTCATTTTGACTACTATGG + Intronic
1085651117 11:78269441-78269463 CAGATTCATTCTGATGACCTTGG - Intronic
1088987423 11:114921889-114921911 CAGTTTGATTGTGAAGGCCATGG - Intergenic
1091585159 12:1811701-1811723 CAGCTTCATTTGGACGCCCGCGG + Exonic
1092347085 12:7724321-7724343 CAGTTCCATTTTTATGACAAAGG + Intergenic
1097344747 12:58478290-58478312 CAGTTGTATTTTGAAAACCAAGG - Intergenic
1097400047 12:59117536-59117558 CTGCTTCATTTTCACAACCAGGG + Intergenic
1101804378 12:108050781-108050803 CAGTTTCATTTAGAATTCCAAGG + Intergenic
1103755720 12:123205042-123205064 CAGTTTAAATTTGAGGCCCAAGG - Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1109885418 13:68535498-68535520 CACTTTCACTTTGACTAGCATGG - Intergenic
1111192393 13:84826348-84826370 CAGTTTCATTCTTACGAATATGG + Intergenic
1111544147 13:89708180-89708202 CAGTTTCATTTTTACTGACAAGG + Intergenic
1112561997 13:100523420-100523442 TAGAGTCATTTTGCCGACCATGG + Intronic
1112678953 13:101740019-101740041 CTGTTTCACTCTGACTACCAGGG + Intronic
1118227679 14:63917957-63917979 CAGTTACATTTTGAAAACTAGGG + Intronic
1119592198 14:75900267-75900289 CACTTTCATTTTGAGGACAAGGG - Intronic
1127199856 15:56633515-56633537 CAGTCTCACTGTGACGTCCAGGG + Intronic
1127435594 15:58954866-58954888 CAAGTTCATTTTGAAGATCATGG + Intronic
1130881497 15:88059763-88059785 CAGTTACATTTTGAGGCCCTGGG - Intronic
1131840856 15:96435764-96435786 CAGTTTCACTCTGTCGTCCAAGG - Intergenic
1132035220 15:98477842-98477864 CATTTTCATTTTGATGACAGTGG - Intronic
1135173818 16:20210305-20210327 CAGTTTCATTTTGAACACTCTGG - Intergenic
1139441483 16:66969971-66969993 CAGTTTCATGTTGACGATGATGG - Intronic
1140275138 16:73502274-73502296 CAGTGTCAGATTGAGGACCATGG + Intergenic
1142546678 17:708787-708809 TTGTTTCATTATTACGACCAAGG - Intronic
1151264430 17:72943401-72943423 CAGTTTCATTTTGCAAAACATGG + Intronic
1152675012 17:81635554-81635576 CAGTCTCATTCTGTCGCCCAGGG + Intronic
1158277972 18:55789584-55789606 CAGTTTCATTTTAAAGACAGAGG - Intergenic
1158640498 18:59199566-59199588 CAATTTCATTTTTAGGACTATGG + Intergenic
1159690491 18:71482058-71482080 TAGTTTTATTTTGATGACCCTGG + Intergenic
1160547852 18:79672916-79672938 CCGTTTCGTTTTGACGGCCCTGG + Intergenic
1162256694 19:9496317-9496339 GAGATTCATTTTGTCGCCCAGGG - Intronic
1163597581 19:18229265-18229287 CAGTTTCACTCTGTCGCCCAGGG + Intronic
925117678 2:1394326-1394348 CAGTTTCATTTTGACGACCATGG + Intronic
925892720 2:8448861-8448883 CATTTTCATTTTCACCCCCAGGG + Intergenic
926513861 2:13816293-13816315 CGGTTTCATCATGTCGACCAGGG - Intergenic
926962499 2:18373842-18373864 CAGTATGATCTTGAAGACCAAGG + Intergenic
929338064 2:40776062-40776084 TATTTTCATTCTGACTACCAAGG - Intergenic
930299375 2:49595266-49595288 CTGTATCATTTTTATGACCATGG - Intergenic
932098380 2:68872996-68873018 CATTTTTATTTTCAGGACCAAGG - Intergenic
932449122 2:71798517-71798539 CAGCTTCATAGTGACCACCAGGG - Intergenic
937057085 2:118947534-118947556 ATGTTTCATTTTGTTGACCATGG + Intronic
940083654 2:149833322-149833344 CAGTTTTATGTTGATAACCAAGG + Intergenic
944123401 2:196266118-196266140 CAGGTTCATTTTGAATACCTGGG - Intronic
948940398 2:241192585-241192607 CAGTTTCATTCTGAGGACTGTGG + Intronic
949015790 2:241709631-241709653 CAGTCTCACTTTGTCGTCCACGG + Intronic
1172027785 20:31960819-31960841 CAGTTTTACTTTGTTGACCAGGG - Intergenic
1173226103 20:41163252-41163274 CAGTTCCTTCTTGACTACCAGGG + Exonic
1173967205 20:47121719-47121741 CAGGTTCGTGTTGAAGACCAAGG - Intronic
1174330703 20:49815058-49815080 CAGTTTCGTCGTGACAACCAGGG - Exonic
1174537360 20:51261675-51261697 CTGTTTCACTCTGACTACCAGGG - Intergenic
1182469219 22:30537272-30537294 CAGTTTCAGTTTAGCGAGCATGG - Intronic
952530490 3:34257527-34257549 CAGCCTCATTCTGACCACCAAGG - Intergenic
952943573 3:38460841-38460863 CAGTTCCACTCTGACAACCAAGG + Intronic
954291279 3:49651331-49651353 AAGTTTCTCTTTGAAGACCAAGG + Intronic
958132600 3:89447941-89447963 CGGTCACATTTTGACGAACACGG + Intronic
958487898 3:94734844-94734866 CATTTTCATTTTGACATCAACGG - Intergenic
958830756 3:99085846-99085868 AAGTTTATTTTTGAAGACCATGG - Intergenic
964697623 3:159527290-159527312 AAGTTTTATTTTCACAACCAAGG + Intronic
965516277 3:169624725-169624747 CAGTTCCATGTTCACCACCAGGG - Intronic
967443873 3:189542109-189542131 AAGTATCATTTTTAGGACCACGG - Intergenic
976554676 4:86436225-86436247 GAGTTTCATTTTGGCCACCCAGG - Intronic
977216406 4:94289592-94289614 CATTTACATTATGATGACCATGG + Exonic
977242058 4:94584861-94584883 AAGTTTGATTTTGACTACTATGG + Intronic
978529732 4:109701822-109701844 CAGCTTCACTTTGCCGACCTTGG - Intronic
980853903 4:138416069-138416091 AAGTTTCATTTTGGAGTCCATGG + Intergenic
985287437 4:188350494-188350516 CAGTTTAACTTTGACTACAAAGG + Intergenic
985993180 5:3580126-3580148 CACTTGGATTTTGAAGACCAAGG + Intergenic
990728595 5:58784205-58784227 CATTTTCATTTTGGAGACCCTGG + Intronic
990773430 5:59277336-59277358 CAGTTTCCTTATGACTGCCAGGG + Intronic
992541995 5:77775219-77775241 CAGATTCATTTAGCCGACTAAGG + Intronic
994923506 5:106083038-106083060 AAGTTTCATTTTGAAGAACTAGG - Intergenic
998000270 5:138619691-138619713 AATTTTCATTTTGGCGAGCAAGG - Intronic
999954183 5:156682495-156682517 CAGTTTGATTTTGTAGAACAGGG - Intronic
1001179959 5:169511042-169511064 CACTTTTATTTTGAGGCCCAAGG - Intergenic
1010195117 6:73231402-73231424 CAGTTTCATTTTTAAAATCAAGG + Intronic
1013345214 6:109253502-109253524 CAGTTTCATTTTCAGGGCCCAGG - Intergenic
1022652726 7:32292115-32292137 CAGTTTCATTATGACTTTCATGG + Intronic
1022998857 7:35786840-35786862 CAGTTCCATTTTGAGGACTAGGG - Intergenic
1024377510 7:48656199-48656221 CAGTTTCCTATTGACCAACAGGG - Intergenic
1028942111 7:96533189-96533211 CAGTTTCATTTTGATGAAAAAGG - Intronic
1029835391 7:103304141-103304163 CAGTTTCACTTAGATTACCAGGG - Intronic
1030968908 7:116029037-116029059 CAGTTTAATTTTAACGACTGCGG - Intronic
1036992856 8:13618830-13618852 CAGTTTCATTTTGAGTACTCTGG + Intergenic
1037449466 8:19002120-19002142 CAGTTTCATTTTGCCTTCAAGGG - Intronic
1040400138 8:47042056-47042078 CAGTTTTGTTTTGAAGAACATGG - Intergenic
1041442591 8:57913340-57913362 CAGTCTCATTTTTACTAGCATGG + Intergenic
1042258018 8:66826669-66826691 CAGTCTCATTTTGTCACCCACGG + Intronic
1048948871 8:139476207-139476229 CAGTTTAAATTTGACTCCCAAGG + Intergenic
1048981646 8:139705728-139705750 CAGATTCATTTTGGAAACCAAGG + Intergenic
1052157146 9:25206149-25206171 CAGTTTCTTTATCACGATCATGG - Intergenic
1052548271 9:29909377-29909399 CAGTTTTATTATGAGTACCAAGG + Intergenic
1052761436 9:32596290-32596312 TAGTTTCATTTTTACAACCAAGG - Intergenic
1187005020 X:15224349-15224371 CAGTTTCATTCTGTTGACGAGGG - Intergenic
1187958824 X:24547543-24547565 CATTTTAATTTTGAATACCATGG + Intergenic
1190465639 X:50723041-50723063 CAGTTTCTTTTTGAGGACAATGG - Intronic
1190502859 X:51096699-51096721 CGGTTTCATTCTGAAGGCCAAGG + Intergenic
1190713345 X:53084777-53084799 CAGCTTCATTTTGTAGCCCATGG - Exonic
1194729481 X:97437089-97437111 CAGCATCATCTTGATGACCAAGG + Intronic
1196503597 X:116413567-116413589 CATTGGCATTTTGATGACCATGG + Intergenic
1199680673 X:150222252-150222274 CAGTTTCTTTTTGACTTCCTAGG + Intergenic