ID: 925118073

View in Genome Browser
Species Human (GRCh38)
Location 2:1397385-1397407
Sequence GCAGGCACTCAGGGCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925118073_925118078 -6 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118078 2:1397402-1397424 GCCTGCAGATGCCGTGGCCCAGG 0: 1
1: 0
2: 2
3: 25
4: 268
925118073_925118080 -3 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118080 2:1397405-1397427 TGCAGATGCCGTGGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 254
925118073_925118084 21 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118084 2:1397429-1397451 AGATACACCATTCCCTCCCCAGG 0: 1
1: 0
2: 5
3: 28
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925118073 Original CRISPR GCAGGCACTCAGGGCACTCA GGG (reversed) Intronic
900139904 1:1135226-1135248 GCAGGCAGTGGGGGCCCTCAGGG + Intergenic
901499668 1:9644032-9644054 GCAGCCACTCTGAGCACCCAGGG - Intergenic
903130438 1:21275859-21275881 GCAGGCACCCAGGCCGCTGAGGG - Intronic
903422331 1:23226889-23226911 GAAGGCACTGAGGTCACTCAGGG + Intergenic
903447561 1:23431862-23431884 CCAGGCTCTCAGGGGTCTCAGGG + Exonic
903771943 1:25769787-25769809 GCAGGCACTCATCGCACACCCGG + Intronic
904463899 1:30696826-30696848 GCAAGGACTCAGAGCCCTCAGGG + Intergenic
904813840 1:33181270-33181292 GCCGGCACTCGGGGCAGTCGCGG + Exonic
905327799 1:37170120-37170142 GCAGGCACACAGTGAACACAGGG - Intergenic
906069801 1:43008205-43008227 GAAGGGCCTCAGGGCACACACGG - Intergenic
907270722 1:53289437-53289459 CCACGCACTCAGGGCGCTCCTGG - Intronic
908152264 1:61314214-61314236 GCAGGCTCTGAGGGCACAGAGGG - Intronic
909203566 1:72725180-72725202 GCAGGCCCCCAGGGCACCCGAGG - Intergenic
912334699 1:108851329-108851351 GCAGGAACTCAGAGAGCTCAGGG + Intronic
916367882 1:164054278-164054300 GAAGGCACTCAAGGCTCTCAGGG + Intergenic
916444461 1:164859297-164859319 GCAGGAATTCAGGGCTCTCCAGG - Intronic
916930592 1:169574527-169574549 GAAGGAAGTCACGGCACTCATGG + Intronic
918438781 1:184544899-184544921 AAAGGCACTCAGGCCACCCACGG - Intronic
919773836 1:201180695-201180717 GAGGGCACTGAGGGCACTCTAGG + Intergenic
919981456 1:202644737-202644759 GCAGTCACTCAGGGCTTTCCAGG + Intronic
920043514 1:203118869-203118891 GCAGGCTCTCAGGGGACCCAGGG + Intronic
1067062532 10:43085191-43085213 GCAGGCACTCTGTGCTCCCAAGG + Intronic
1069749556 10:70736565-70736587 GCAGGCACCCAGGGCACTGCAGG - Intronic
1070101181 10:73388386-73388408 ACAGTGACTCAGGTCACTCAAGG - Exonic
1070538062 10:77394149-77394171 CCAGGCCCTCAGGGCTCTGATGG - Intronic
1072529607 10:96306600-96306622 GCAGGCACTCAGGGAGATGATGG + Intronic
1072606757 10:96990579-96990601 GCAGAAACTCAGAGCTCTCAGGG + Intergenic
1072615096 10:97043791-97043813 GCAGGAACTCTGGGCACCCAGGG - Intronic
1073269372 10:102249274-102249296 TTAGCCACTCAGGGCACCCAAGG - Intronic
1076431085 10:130402822-130402844 TCAAGCACTCAGGGAATTCATGG - Intergenic
1076826918 10:132973827-132973849 GCAGCCGCTCAGGGCAGGCATGG - Intergenic
1077008083 11:368635-368657 TCAGGAACTCAGGGCACTCGGGG - Intergenic
1077113598 11:872928-872950 GGAGGCACCCAGTGCTCTCAGGG - Intronic
1078250521 11:9613389-9613411 GCAGGGCCTCAGGGGACTCCTGG + Intergenic
1080300540 11:30779867-30779889 GCAGGCAGGCAGGGCATTGAAGG - Intergenic
1083887071 11:65578059-65578081 CCAGGCACTGAGTGGACTCATGG - Intronic
1084059546 11:66661455-66661477 CTAGGCCCTCAGGGCACTCAAGG - Intronic
1084183280 11:67457100-67457122 TCAGTCACTCAAAGCACTCATGG - Intronic
1084611015 11:70203117-70203139 GCAGGCTCTCAGGACACCCAAGG + Intergenic
1084648413 11:70474051-70474073 GTAGCTACGCAGGGCACTCAGGG + Intronic
1088267759 11:108003847-108003869 GATGGCACTTAGGGCACACATGG - Intergenic
1090423166 11:126589443-126589465 GCAGGGACTCAGGGCACCATGGG + Intronic
1091815122 12:3431938-3431960 GCAGGCAGTGAGGGCATTAAAGG + Intronic
1096493762 12:52027297-52027319 GCAGGCCCTCAGGTCACTTCAGG - Intronic
1097186816 12:57200525-57200547 GCAGGCACTCACGGCAGTCCGGG - Exonic
1097414370 12:59296110-59296132 GAAGGAACTCAGTGCATTCAAGG + Intergenic
1101700496 12:107169365-107169387 GCAGGCCCTCCAGGCACACAGGG + Intergenic
1102062780 12:109946709-109946731 GCAGGCACACTGAGCACACATGG + Intronic
1102180461 12:110908939-110908961 GCAGGGACCCAGGGGAGTCATGG - Intergenic
1105292230 13:19060488-19060510 GCAGGCACACAGGACTCCCATGG + Intergenic
1105442755 13:20429104-20429126 CCAGGCACTCCGGCCACACATGG + Intronic
1106389141 13:29318450-29318472 TCAGGGACTCAGGGGACTAATGG + Intronic
1106419771 13:29576642-29576664 GGAAGCCCACAGGGCACTCACGG - Intronic
1106593070 13:31114526-31114548 ACAGGCACACAGTGCAGTCAAGG - Intergenic
1107802861 13:44126675-44126697 GCAGGCAATCAGAGGAGTCAGGG + Intergenic
1109981466 13:69913436-69913458 GCAGGCACTTAGGGACCTCTGGG + Intronic
1112558446 13:100490848-100490870 TGAGGCACTGAGGGCACTCAGGG + Intronic
1112740824 13:102471532-102471554 CCGGGCACTCAGGGAACACAAGG + Intergenic
1114810810 14:25896883-25896905 GCAGGAGCTCAGGTTACTCAGGG - Intergenic
1115680302 14:35730615-35730637 GCAGGTTGTCAGGGAACTCAGGG - Intronic
1119817697 14:77585044-77585066 GCCAGCACTCAGAGTACTCACGG + Intronic
1121558681 14:94857984-94858006 TGAGGCACTCAGGGAAGTCACGG + Intergenic
1122264880 14:100541896-100541918 GCAAGCACTCTGGCCACCCAGGG + Intronic
1123149849 14:106170455-106170477 GCAGGCACTCAGGTCACCAGGGG - Intergenic
1123203575 14:106691590-106691612 GCAGGTTCTCAGGACACCCAGGG - Intergenic
1124145753 15:27123868-27123890 GCAGTCCCTGAGGTCACTCAAGG + Intronic
1124567061 15:30825914-30825936 GCTGGGGCTCAGAGCACTCAGGG - Intergenic
1125325896 15:38535557-38535579 GCAGGCACTGTGGGCCCTTAGGG - Intronic
1130540188 15:84816828-84816850 CCAGGGACTCAGGTCACTAATGG + Exonic
1130896299 15:88172925-88172947 GCAGGCACCCAGGAGACTAATGG + Intronic
1132897666 16:2236660-2236682 GCAGGCTCCCAGGGCACTGCTGG - Exonic
1132907442 16:2290107-2290129 GCAGGCAGACAGGGCTCACACGG - Intronic
1136680203 16:31956337-31956359 GCAGGCACTCAGGTCACCAGGGG + Intergenic
1136780544 16:32897881-32897903 GCAGGCACTCAGGTCACCAGGGG + Intergenic
1136889860 16:33961767-33961789 GCAGGCACTCAGGTCACCAGGGG - Intergenic
1138320496 16:56107018-56107040 GCAAGCACTCAGGGAATTTATGG + Intergenic
1139383294 16:66548244-66548266 GCAGGCCCCCAGCGTACTCAGGG - Intronic
1139788514 16:69413366-69413388 GTAGGCGCTCTGTGCACTCAAGG + Intergenic
1140469713 16:75207183-75207205 GCAGGCACACAGGGCTATAACGG - Exonic
1141592319 16:85077215-85077237 GCAGGTGCTGGGGGCACTCACGG + Intronic
1142010157 16:87709805-87709827 GCCTGCACCCAGGGCAGTCAGGG - Intronic
1203083174 16_KI270728v1_random:1161847-1161869 GCAGGCACTCAGGTCACCAGGGG + Intergenic
1143151991 17:4812955-4812977 ACAGGCACACAGGGCAGTCATGG + Intronic
1143560769 17:7693124-7693146 TCAGGCACTCAGGGCTCTGCTGG + Intronic
1146494618 17:33310460-33310482 GGAGGCAATCTTGGCACTCAAGG - Intronic
1147314334 17:39612425-39612447 GCAGGAACACAGGTCCCTCAAGG - Intergenic
1147582963 17:41637157-41637179 GCTGGCACCCAGGGCACTGGGGG - Intergenic
1148694947 17:49553155-49553177 CCAGGCACCCAGGACTCTCATGG - Intergenic
1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG + Intergenic
1149265573 17:54924174-54924196 GAATGAACTCAGTGCACTCAAGG - Intronic
1151205549 17:72503920-72503942 GAAGGCACTCAGAGCACTTTAGG - Intergenic
1152490061 17:80625180-80625202 GCAGGCAGTGAAGGCACTCTAGG + Intronic
1152594979 17:81233566-81233588 ACAGACACCCAGGACACTCAAGG + Intronic
1152645520 17:81466880-81466902 CCAGGCACTCAGGGCCCACTGGG - Intergenic
1152707597 17:81852818-81852840 GCAGACATCCAGGGCACTGAAGG + Intronic
1155594530 18:27469866-27469888 GGATGGACTAAGGGCACTCATGG + Intergenic
1156896924 18:42256747-42256769 ACATGCCCTCAGGGCACCCATGG + Intergenic
1157288271 18:46392398-46392420 TAAGGCCCTCAGGGCCCTCAGGG + Intronic
1158922701 18:62211845-62211867 GTGAGCACTCAGGGAACTCAAGG - Intronic
1159716562 18:71831064-71831086 TCAAAGACTCAGGGCACTCATGG + Intergenic
1160772778 19:840559-840581 TGAGGCACTGAGGGCACTCGTGG + Intergenic
1160855453 19:1215198-1215220 GCAGGCACCCAGGGCATTGAGGG - Intronic
1161615895 19:5270028-5270050 GCCTGCACTCTGAGCACTCAGGG - Intronic
1162389316 19:10379900-10379922 ACAGGGACTGAGGTCACTCATGG - Intronic
1162651487 19:12092191-12092213 GCTGTCACTCAGGGCTCTGAAGG + Intergenic
1163602416 19:18257126-18257148 GGAGGCACTCATGGCTCTCTGGG - Exonic
1163651766 19:18521942-18521964 GAAGGCCCTCAGGGCACTGTCGG + Exonic
1165778174 19:38417181-38417203 GCATGCACACAGGGCCGTCACGG + Intronic
1166210083 19:41301149-41301171 GCTGGCACTAAGGGAACACAGGG + Intronic
1166972972 19:46582762-46582784 GCAGGCACTGATGGCACAGATGG - Intronic
1167473399 19:49687411-49687433 GGTGGCACTCAGGGTAGTCATGG + Intronic
1167688080 19:50968938-50968960 CCAGGCCCTCACTGCACTCAGGG - Exonic
925118073 2:1397385-1397407 GCAGGCACTCAGGGCACTCAGGG - Intronic
925763199 2:7206609-7206631 GCAGGCTCTATGGGCAGTCATGG + Intergenic
926365937 2:12133269-12133291 GGAGACAGTCAGGGCCCTCAGGG - Intergenic
927678979 2:25127735-25127757 GCAGGCTCTCTGGGCACAAAGGG - Intronic
927855223 2:26523571-26523593 TGAAGGACTCAGGGCACTCAAGG - Intronic
927913001 2:26914809-26914831 GCAGGAACTCAGGACTCCCAGGG + Intronic
932816746 2:74867880-74867902 GCAGTCACCCAAGACACTCATGG + Intronic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
934061427 2:88297756-88297778 GGAGCCACTCAGGGGACTGAGGG - Intergenic
935449209 2:103190001-103190023 GCAGGCCCTCAGGGCACCTGAGG - Intergenic
935591591 2:104850712-104850734 GCAGGAAGTCAGGGCACCCCTGG - Intergenic
935690048 2:105722986-105723008 GAAGGCACACAGGGCCCTCAGGG + Intergenic
937675908 2:124589967-124589989 TCAGGAAGTCAGAGCACTCATGG - Intronic
938067267 2:128287867-128287889 GCAGCCCCGCAGGGCCCTCATGG - Intronic
938206971 2:129432147-129432169 GCAGGCAGGAAGAGCACTCATGG - Intergenic
943386362 2:187208029-187208051 GTGGGCCCCCAGGGCACTCAAGG - Intergenic
943474169 2:188333936-188333958 GCAGGGACTCCGTGCACTCCAGG + Intronic
944543790 2:200779306-200779328 GCAGACACTCAGGAAAATCATGG + Intergenic
944595907 2:201260417-201260439 GAAGGCACTCTGCTCACTCAGGG + Intronic
944734834 2:202552712-202552734 ACAGGCAGTGAGGTCACTCAAGG + Exonic
945008223 2:205432428-205432450 GCAGGGACTTAGGGCAAACAGGG - Intronic
945165306 2:206937028-206937050 GCAGTAACCCAGGGAACTCAGGG - Intergenic
945941976 2:215959479-215959501 GCAGGCATTCAGGCCAATTAAGG - Intronic
948541189 2:238692372-238692394 GCAGGCACTGAGGGCGCCCTGGG - Intergenic
948830091 2:240594433-240594455 GCAGGAACTCAGGGCTCTCTGGG + Intronic
948938644 2:241184964-241184986 GCAGGAACCCAGGGGACTCGGGG + Intergenic
948978619 2:241480432-241480454 GCAGCCACTGTGGGCCCTCAGGG + Intronic
1170657766 20:18305677-18305699 ACAGGCACACATGGCATTCAGGG + Exonic
1170931245 20:20771179-20771201 GCAGGCAGGCAGGGCACCCAGGG - Intergenic
1171235852 20:23524088-23524110 GCAGGCACCCAAGGCATCCACGG + Intergenic
1172462566 20:35131258-35131280 GCAGGCACTCAGGCCAGGCGTGG + Intronic
1174097604 20:48101726-48101748 GCTGGCACTTAGTGCACACACGG + Intergenic
1174406690 20:50307348-50307370 GTAGGTGCTCAGGTCACTCAGGG - Intergenic
1175165243 20:57038933-57038955 GCATGTGCTCAGGACACTCAAGG - Intergenic
1175238548 20:57529212-57529234 GCAGGCACTGGGGGAACCCATGG - Intergenic
1175810201 20:61853651-61853673 GCAGACCCTCAGGGCGCACATGG + Intronic
1175961351 20:62638174-62638196 CCTGGAACTCAGGGCACTCCAGG + Intergenic
1176345856 21:5746126-5746148 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
1176352670 21:5866710-5866732 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
1176498971 21:7578329-7578351 GCAGGCCCCCAGGGTACTCAAGG - Intergenic
1176540177 21:8144196-8144218 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
1176559128 21:8327241-8327263 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
1176742307 21:10615898-10615920 CCAGACACTCAGGGAACTGAAGG - Intergenic
1178772153 21:35515543-35515565 GCAGGGTCTCAGGGCCTTCATGG - Intronic
1179965662 21:44803214-44803236 GCAGGGACCCATGGCTCTCATGG - Intergenic
1181028681 22:20139794-20139816 GCTGTCACTCAGTGCACACATGG + Exonic
1182620693 22:31616904-31616926 GAAAGCACTCAGGCCACTCCCGG + Intronic
1184634524 22:45816435-45816457 GGAGGCACTCAGCTCACTGAAGG - Intronic
1184682880 22:46081501-46081523 GCAGGCCATGAGGGCACTCAGGG - Intronic
1184863339 22:47189255-47189277 GCAGCCACGCAGAGCACGCAGGG - Intergenic
1184904682 22:47472992-47473014 GGAGGCGCTCAGGGCACCCTTGG - Intronic
1203245122 22_KI270733v1_random:60563-60585 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
953031887 3:39185053-39185075 GCAGACTGTCAGGGCTCTCAGGG + Exonic
953876324 3:46668763-46668785 GCAGGCTCTCTGGGCAGCCAGGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954627241 3:52029170-52029192 GCAGGCAGGCAGGGCTCTGAAGG + Intergenic
954658844 3:52215564-52215586 ACAGGCACGGAGGGCACCCAGGG + Intergenic
956559215 3:70555153-70555175 GTAGGGACTGAGGTCACTCATGG - Intergenic
956690709 3:71875598-71875620 GCAGGCGCTCAGGGCCACCATGG - Intergenic
959450482 3:106493033-106493055 GCAGGCATTCAGGACATTGAAGG - Intergenic
961041574 3:123682158-123682180 GCAGGCACCCCGGGGACTGAGGG - Intronic
961409363 3:126707486-126707508 GAAGGCACACATGGCAGTCATGG + Intronic
963600405 3:147373428-147373450 GCAGGTACTCAGCGTCCTCAAGG + Intergenic
967146981 3:186614742-186614764 GCAGTCACTCTGGGCACACCTGG + Intronic
968228931 3:196992872-196992894 GCAGGCACTCAGGGAAGACGTGG + Intronic
968800807 4:2742319-2742341 GCAGGCAGTGAGGGCACTGAAGG + Exonic
969036981 4:4262264-4262286 GCAGGCACAAAGGGCACTAGAGG + Intergenic
969533251 4:7740936-7740958 GGAGACACCCTGGGCACTCAGGG - Exonic
969621178 4:8279703-8279725 GCAGGCAGCCACGGCACACAGGG - Intronic
973297805 4:48545382-48545404 GCAGGTTCTCAGGGCACTTTGGG - Intronic
978823171 4:112989707-112989729 GCAGGAAGTCAGGGAACTGAAGG + Intronic
983562700 4:169116834-169116856 CCAGGCACTCAGTAGACTCAAGG - Intronic
984698729 4:182804792-182804814 GCAGGCAGAGGGGGCACTCAAGG - Intergenic
985666933 5:1186201-1186223 CCTGGCACCCACGGCACTCATGG - Intergenic
985928001 5:3032952-3032974 GCAGGCACGCAGGGCAGTGAGGG - Intergenic
987182593 5:15384167-15384189 GCAGGCACTCACAGCACTGTGGG - Intergenic
993539370 5:89129490-89129512 GCAGTCACTCAGTCCACTCTAGG - Intergenic
996173361 5:120323957-120323979 GCTGTCACCCAGGTCACTCAGGG - Intergenic
996411773 5:123166212-123166234 GAAGGAGCTCAGGGCACTAAAGG - Intronic
998142221 5:139706400-139706422 TCAGGCACACAGGGAAGTCAAGG + Intergenic
998375959 5:141690916-141690938 GCAGGCATTCAGGGTAGACAGGG + Intergenic
1000773578 5:165388554-165388576 GCAGGCACACATGGCAGTAATGG - Intergenic
1002329017 5:178428944-178428966 GTAGGGTCTCAGGACACTCACGG - Intronic
1003376610 6:5584165-5584187 GCAGGAACTCAGGGCCCGCAGGG - Intronic
1003567412 6:7232177-7232199 ACAGGCCCTCAGATCACTCATGG + Intronic
1005922514 6:30415110-30415132 GCCGGCACTCAGCCCACACAGGG + Intergenic
1006059680 6:31410943-31410965 GCCGGCACTCAGCCCACACAGGG + Intronic
1006523569 6:34586290-34586312 ACAGGCACTGAGGGCACTCATGG - Intergenic
1007970019 6:46042487-46042509 GGAGGCACTGAGGCCACTCGGGG + Intronic
1013621947 6:111898730-111898752 GCAGGCACTCTGGGCCCACGTGG - Intergenic
1016203710 6:141446388-141446410 GCGGACAGTCAGTGCACTCAGGG - Intergenic
1018013622 6:159693374-159693396 ACAGGCACGCAGGGCACCCCCGG - Intronic
1018050787 6:160006108-160006130 GCAGGCACACGGGGCATGCAGGG - Intronic
1018050805 6:160006168-160006190 GCAGGCGCACAGGGCATGCAGGG - Intronic
1018104576 6:160471123-160471145 CCAGCCACTCAGGACACTGAGGG - Intergenic
1019153989 6:170026557-170026579 CCAGGCACTCAGGGCCCCCCGGG - Intergenic
1022191539 7:28021031-28021053 GCAGGCACTCAGGACCATCTGGG - Intronic
1029193942 7:98791287-98791309 GCAGGCTCTCCAGGCACTCCTGG - Intergenic
1032240354 7:130154626-130154648 GCAGGCACTGCGGGCCCTCCTGG - Intergenic
1034966485 7:155394627-155394649 GCAGGGAGACATGGCACTCATGG + Intronic
1035328775 7:158083112-158083134 TCAGGCACTCAGGGCCCTTCTGG - Intronic
1035665616 8:1377639-1377661 ACAGGCCCTCAGGGCACACTGGG - Intergenic
1035925472 8:3723174-3723196 GGGGCCACTCGGGGCACTCAGGG + Intronic
1036548892 8:9799630-9799652 GAATGTGCTCAGGGCACTCAGGG + Intergenic
1037981604 8:23258326-23258348 CCAGGCACTGAGGTCTCTCAAGG + Exonic
1044909929 8:97046117-97046139 CCAGCCTCTCAGGGCACACATGG - Intronic
1045334714 8:101189250-101189272 GCAGGCACTCAGTGAACGGATGG + Intronic
1047057287 8:121180031-121180053 GCAGGGACTTTGGGGACTCAGGG + Intergenic
1048527140 8:135213493-135213515 GCAGGCAGTCAGGGAACGAAGGG + Intergenic
1049354925 8:142182818-142182840 GCAGTCATTCAGGTTACTCAGGG - Intergenic
1049392855 8:142381075-142381097 GCAGCCAATCAGGGCCGTCAGGG + Intronic
1049603457 8:143518632-143518654 GGAGGCCCTCAGGGCACACCTGG - Intronic
1054736665 9:68759309-68759331 GCAGGGAGTAAGGGGACTCATGG + Intronic
1057268123 9:93632099-93632121 GCAGGCACACAGGGCTCCCATGG - Intronic
1060783292 9:126429781-126429803 GCAGACACACAGGGCACTTGGGG + Intronic
1060832354 9:126724376-126724398 GCAGGCAAGCAGGGCAGTCATGG + Intergenic
1060993546 9:127862453-127862475 CCAGGCCCTCAGGGCCCTCGAGG + Intergenic
1062710445 9:137972424-137972446 TCAGGCAAACAGGGCCCTCAAGG - Intronic
1203461455 Un_GL000220v1:43632-43654 GCAGGCCCCCAGGGTACTCAAGG + Intergenic
1188978848 X:36708059-36708081 GAGGGCTCTCAGGGAACTCAAGG - Intergenic
1191038877 X:56057593-56057615 GCAGGTCCCTAGGGCACTCAAGG + Intergenic
1197173180 X:123456824-123456846 GAAGGCACACAAGGCACACAGGG + Intronic
1197790397 X:130248687-130248709 GCTGGCCATCAGGGCACTCTAGG - Intronic
1199156210 X:144551594-144551616 GCAGGAACTCACGGCCCTGAAGG + Intergenic
1199850360 X:151721624-151721646 GCAGGGAGCCAGGGTACTCATGG - Intronic
1200061150 X:153484411-153484433 GCTGGCACACAGGCCACTCACGG + Intronic
1200118925 X:153781387-153781409 GCAGGGACCCAGGGCAGTCCTGG + Intronic
1200770578 Y:7121168-7121190 ACAGACACTGAGTGCACTCAGGG - Intergenic