ID: 925118073

View in Genome Browser
Species Human (GRCh38)
Location 2:1397385-1397407
Sequence GCAGGCACTCAGGGCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925118073_925118084 21 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118084 2:1397429-1397451 AGATACACCATTCCCTCCCCAGG 0: 1
1: 0
2: 5
3: 28
4: 192
925118073_925118080 -3 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118080 2:1397405-1397427 TGCAGATGCCGTGGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 254
925118073_925118078 -6 Left 925118073 2:1397385-1397407 CCCTGAGTGCCCTGAGTGCCTGC 0: 1
1: 0
2: 1
3: 30
4: 209
Right 925118078 2:1397402-1397424 GCCTGCAGATGCCGTGGCCCAGG 0: 1
1: 0
2: 2
3: 25
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925118073 Original CRISPR GCAGGCACTCAGGGCACTCA GGG (reversed) Intronic