ID: 925119621

View in Genome Browser
Species Human (GRCh38)
Location 2:1407827-1407849
Sequence CAGTGTAATCTTGAAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925119621 Original CRISPR CAGTGTAATCTTGAAGATGT GGG (reversed) Intronic
901016085 1:6231765-6231787 CAGTGTATTCATGAGGTTGTTGG - Intronic
901096268 1:6682715-6682737 CAGTCTAGTCTTGAACCTGTGGG - Intronic
901321152 1:8340695-8340717 CAGTGTAATTTATTAGATGTTGG + Intronic
904654779 1:32036467-32036489 CAGTTTAATCTTCAAAATGAGGG - Intronic
905320428 1:37112743-37112765 AAGTTAAATCTTGTAGATGTGGG - Intergenic
909655863 1:78031866-78031888 CAGTGTAATCTTAATGTTTTAGG + Intronic
912073352 1:105841078-105841100 ATGTGTAATCTTGAAGTTGCAGG - Intergenic
913496113 1:119429828-119429850 CAGTCTCATCTGGAAGTTGTGGG - Intergenic
915889458 1:159758851-159758873 CACTGTAACCTTGAATTTGTGGG - Intergenic
916005535 1:160656058-160656080 CACTGTAATCTTGAACTTCTGGG - Intergenic
916188471 1:162156285-162156307 CAGTTTAATCTAGAAAATGAGGG - Intronic
916744755 1:167676605-167676627 CAGTGTAATTTGGGAGATGATGG - Intronic
917961130 1:180145671-180145693 CATTCTCATCCTGAAGATGTGGG + Intergenic
921857624 1:220004101-220004123 CACTGTAACCTTGAACTTGTGGG + Intronic
921864517 1:220074145-220074167 CAGTGTAATCTAAATTATGTAGG - Intronic
923935007 1:238749597-238749619 CATTGATAACTTGAAGATGTAGG + Intergenic
924007711 1:239630660-239630682 CAGTTTACTCTTGAAGTTCTAGG + Intronic
924217982 1:241845094-241845116 CAGTGTAAAGGTGAAGATGAAGG - Intergenic
924488909 1:244515399-244515421 CAGTGTAGTTTTGAACATATTGG + Intronic
1068248316 10:54403257-54403279 AATTGGAATCTTGTAGATGTTGG + Intronic
1068782687 10:60938675-60938697 CAGGTTACTCTTGCAGATGTCGG - Intronic
1069432273 10:68348439-68348461 CACTGTAACCTTGAACATATGGG - Intronic
1071675127 10:87648330-87648352 CAATGAAATCTTAAAGTTGTGGG - Intergenic
1071732438 10:88261898-88261920 CAATGTAATCTTTTAGATGGAGG + Intergenic
1072000139 10:91186861-91186883 CAGTGTAATCTTCAAGGTGAGGG + Intronic
1073941513 10:108704148-108704170 CAGAGTAATCTTTAAGGTATTGG - Intergenic
1074993500 10:118733799-118733821 CAGTGTAGTCTTGAACTTCTGGG - Intronic
1077960985 11:7076822-7076844 CAGTGTCTTCTTGCACATGTGGG + Intergenic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1080689914 11:34548005-34548027 CTGTGTAATATTAAACATGTTGG - Intergenic
1080955467 11:37089090-37089112 GAGTTTAATTTTGAAGATGGGGG + Intergenic
1083546367 11:63551999-63552021 CAGTGCAAGCTTGAAGCTGTGGG + Intergenic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1086339001 11:85827833-85827855 CAGTGTTAGGTTGAAGATCTAGG + Intergenic
1086947427 11:92856990-92857012 CAGTGAAATTTGGCAGATGTAGG + Intronic
1087904545 11:103680450-103680472 CAGCCTGACCTTGAAGATGTAGG - Intergenic
1093384833 12:18539867-18539889 AAAAGTAATCTTGAAGATTTCGG - Intronic
1099275841 12:80575504-80575526 CAGTGTAACCTTAAACATCTGGG - Intronic
1106612622 13:31298140-31298162 CAGTCCCATCTTGAAGCTGTCGG + Intronic
1106663532 13:31827262-31827284 CAGTGTAATGGTGGAGATTTTGG + Intergenic
1107967144 13:45607503-45607525 CTGTGTAATCTTCAAGACATGGG + Intronic
1110547221 13:76768801-76768823 AAGTGTAGTCCTGAGGATGTTGG - Intergenic
1111279658 13:86004498-86004520 CAGGGTAATCTTTGAAATGTTGG + Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112606224 13:100909524-100909546 CACTGTAACCCTGAACATGTGGG + Intergenic
1114134931 14:19836501-19836523 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1114705272 14:24719937-24719959 CAGTGTAGTCTTAAAGGTCTGGG - Intergenic
1115012316 14:28564156-28564178 CAGTGTAATTTTTAAGAAGCAGG - Intergenic
1118274048 14:64369931-64369953 CAGTGTAATCTTGAATTCCTGGG - Intergenic
1119029261 14:71178917-71178939 CACTGTAATCTTGAACTTCTGGG + Intergenic
1120353371 14:83393810-83393832 AAGTGTAATGTTGCAGTTGTTGG + Intergenic
1120475526 14:84982213-84982235 GAGTGTAATATTTGAGATGTGGG - Intergenic
1123577990 15:21692066-21692088 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1123614615 15:22134548-22134570 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1125332365 15:38594751-38594773 CAGAGTCATTTGGAAGATGTGGG + Intergenic
1127984339 15:64057763-64057785 CATTGCAATCTTGAAATTGTGGG - Intronic
1128098156 15:64974553-64974575 CAGTGAAATTTTGAAAATGTTGG - Intronic
1129018017 15:72486454-72486476 CAGTGGAAGCTTGAAAGTGTAGG - Intronic
1129436021 15:75541161-75541183 CAGTGTAACCTTGAAGTCCTAGG + Intronic
1129567434 15:76637628-76637650 CACTGTAATCTTGAACAACTTGG - Intronic
1129803578 15:78436094-78436116 CACTGTAATCTTGAATTTCTGGG + Intergenic
1130028472 15:80290494-80290516 AAGTGTGATCGTGAAGAAGTAGG + Intergenic
1130859870 15:87876267-87876289 AAGTGTAATCTTGATGCTTTTGG - Intronic
1130891334 15:88136397-88136419 CACTGTAGTCTTGAAGAAGAGGG - Intronic
1131225740 15:90623299-90623321 CAGTGGAACCTTGAGAATGTCGG + Intronic
1202986860 15_KI270727v1_random:426311-426333 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1139221856 16:65191139-65191161 CAGTGTAATCTTGAACTCCTGGG - Intergenic
1142793112 17:2284225-2284247 CATTGTAATGTTGAGGATATAGG - Intronic
1146395267 17:32460132-32460154 CACTGTAACCTTGAACATCTGGG + Intronic
1146608911 17:34287578-34287600 CAGTTTGGTCTTGAAGCTGTGGG - Exonic
1149489078 17:57068998-57069020 CTGTGTAAACTTGAATAAGTTGG + Intergenic
1149950597 17:60980744-60980766 CAGTCTAGTCTTGAACTTGTGGG + Intronic
1153314296 18:3706902-3706924 CACTGATATCTTGTAGATGTTGG - Intronic
1155178106 18:23319146-23319168 CATAGTAATTTTGAAGAGGTTGG + Intronic
1155260247 18:24035114-24035136 CAGTGTAACCTTAAACTTGTTGG + Intronic
1155505128 18:26525795-26525817 CACTGTAAACTTGAACTTGTGGG + Intronic
1156693053 18:39731880-39731902 CTGTTTGAACTTGAAGATGTTGG - Intergenic
1156698333 18:39795098-39795120 CAGAGTAATCCTAAAGATCTGGG - Intergenic
1157175780 18:45450669-45450691 GAGTGTAACCTTGCAGATATGGG - Intronic
1157438750 18:47693512-47693534 CAGTGTACTTTGGAAGAGGTGGG + Intergenic
1157532774 18:48435950-48435972 TATTGGAAGCTTGAAGATGTTGG + Intergenic
1158906044 18:62012852-62012874 CAGTGTGATTTGGAAGATGCTGG - Intergenic
1159186041 18:64975690-64975712 TAGTGTAATAATGAAAATGTTGG + Intergenic
1163211773 19:15846063-15846085 GAGTGTAATCTTGGGGCTGTTGG - Intergenic
1166545681 19:43633754-43633776 CACTGCAACCTTGAACATGTGGG + Intronic
1168133163 19:54333742-54333764 CTGTGTAATCCTGGAGGTGTGGG + Exonic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
925511661 2:4633584-4633606 CAGTGTAAAATTGACTATGTAGG + Intergenic
930086094 2:47498300-47498322 CAGTGTGGTCTTGCAGTTGTGGG - Intronic
930614020 2:53574666-53574688 CACTGGAATCGTGAAGATGGGGG - Intronic
932894495 2:75626005-75626027 CAGGGTAAACCTGAAGATATTGG - Intergenic
933220901 2:79686776-79686798 CAGTGTGTTCCTGATGATGTGGG + Intronic
933512740 2:83261883-83261905 CAGTGTGTCCTTGAACATGTTGG - Intergenic
934694673 2:96390976-96390998 CATTGTAATCTTGAACCTCTGGG + Intergenic
937396437 2:121540201-121540223 CTGTGGAATGTTGAAGTTGTGGG + Intronic
938951047 2:136254780-136254802 CAGTGTGATCTTAATGAGGTAGG + Intergenic
939401968 2:141706101-141706123 CAGAGTCATCCTGAAGATTTTGG - Intronic
940118791 2:150239782-150239804 CAGCGTGATCATGAAGTTGTAGG - Intergenic
941611001 2:167662424-167662446 CAGTGGGATGTTGATGATGTGGG - Intergenic
941877041 2:170444556-170444578 CACAGTTATCTTGAAGGTGTTGG + Intronic
943170649 2:184394201-184394223 CAGGGTAATCTTCGTGATGTGGG + Intergenic
943174650 2:184455188-184455210 GAGTGTACTGGTGAAGATGTTGG - Intergenic
943482628 2:188440384-188440406 CCGTGTAACCTTGAAGATTGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
947777826 2:232728435-232728457 AAGAGGAATCTTGAAGAAGTAGG + Intronic
948158941 2:235808465-235808487 CAGTGTCAGCGTGAAGATGTGGG + Intronic
1169003225 20:2183618-2183640 CAGTGGGATCCTGAAGCTGTTGG - Intergenic
1171075980 20:22123839-22123861 CAGAGTAATGTTTGAGATGTTGG - Intergenic
1173596230 20:44260031-44260053 CAGGGTAATCTCCAAGATGTGGG - Intronic
1173694095 20:44992580-44992602 CACTGTAATCTTGAACTTCTGGG + Intronic
1178290720 21:31365782-31365804 CAGTGAAATCTTGCAGTTGTTGG - Intronic
1178323509 21:31624418-31624440 CAGTTTGATATTGAAGTTGTAGG + Intergenic
1179587317 21:42381779-42381801 CAGGGTAACATTGAAAATGTAGG + Intronic
949300900 3:2582694-2582716 GAGAGTGATCTTGAAGATGCAGG + Intronic
949573415 3:5315180-5315202 CACTGTAGTCTGGAATATGTGGG + Intergenic
952019913 3:29005937-29005959 TTGTGTATTCTTGTAGATGTGGG + Intergenic
952271342 3:31834886-31834908 CTGTGTAACCTAGAAAATGTAGG + Intronic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956459672 3:69458820-69458842 CAGTCTAACCTTGAAGCTGATGG + Intronic
959765865 3:110027265-110027287 CAGTGTAATCTTGCAGTGGCAGG - Intergenic
960369570 3:116817345-116817367 CAGTGTCATCCTGCAGAAGTTGG + Intronic
960705115 3:120474198-120474220 CTGTAAAATCTTGAGGATGTGGG + Intergenic
963949534 3:151183797-151183819 TAGTGTAATCCTGAAGATGCAGG + Intronic
964279000 3:155041582-155041604 CACTTTAATCTTGAAGATGGTGG + Intronic
964602878 3:158521913-158521935 CAGTTTAATCTAGCAAATGTGGG + Intronic
964878625 3:161398550-161398572 CAGTGTAGTATTGAAGTTCTGGG + Intergenic
965655465 3:170978712-170978734 TTGTGTAACCCTGAAGATGTCGG - Intergenic
965925668 3:173976443-173976465 CAATGTACTGATGAAGATGTGGG + Intronic
966302732 3:178497039-178497061 CAGTGAAAGCTTCAAGCTGTCGG - Intronic
967317391 3:188162243-188162265 CAGTCTTATCTTGCAGATATTGG + Intronic
967926257 3:194650679-194650701 CAGTGTAGCCTTGAAGAAATGGG - Intronic
969164128 4:5290472-5290494 CAGTGATATCTTGATGATCTTGG - Intronic
971840416 4:31844443-31844465 CACTGTAATCTTGAACTTATGGG - Intergenic
972055711 4:34799691-34799713 CAGTTGAATCCTGGAGATGTTGG - Intergenic
973875363 4:55212844-55212866 CTGTGTAAACATGAAGATGCAGG + Intergenic
974688061 4:65257479-65257501 GAGAGTAAATTTGAAGATGTGGG + Intergenic
975999325 4:80354360-80354382 CAGTTAAATGTTGAAGAAGTAGG + Intronic
977267098 4:94868071-94868093 CAGTCTAATCTAGAAGTTTTGGG + Intronic
979971421 4:127140440-127140462 CAGTGTAGTCTACCAGATGTTGG - Intergenic
980231645 4:130053089-130053111 AAGTGTAAACTAGCAGATGTGGG + Intergenic
981265169 4:142774244-142774266 CAGTGCAATCATGGAGGTGTTGG + Intronic
984541238 4:181039976-181039998 CAGTTTAATCTTGAAACTGTTGG + Intergenic
985826227 5:2193518-2193540 CATTGGAATCTAGAAGATGAGGG - Intergenic
986088379 5:4477008-4477030 TAGTTTAATCCTGGAGATGTGGG - Intergenic
988355938 5:30174717-30174739 CAGTGGTGTCTTGAAGCTGTGGG - Intergenic
989678613 5:44003771-44003793 CAGTGTATCCTTGAAAATTTGGG - Intergenic
990694714 5:58402820-58402842 CAGAGTAAACGTGAAGAGGTAGG + Intergenic
991444430 5:66684017-66684039 CACTGTAATCTTTTAGATGTTGG + Intronic
992301865 5:75390877-75390899 CACTGTAATCTTGAACTTCTGGG + Intronic
992949527 5:81844635-81844657 CACTGTAATCTTGAACTTGTGGG - Intergenic
995089959 5:108162418-108162440 CACTGTAACCTTGAACTTGTGGG - Intronic
997489972 5:134266118-134266140 CAGTGTAAGCTTGGAAATGCAGG + Intergenic
998240009 5:140432781-140432803 CAGTGTAATTTTGAACTTCTGGG + Intronic
1000650774 5:163815740-163815762 CAGTGTCAACTTGAAGAATTTGG + Intergenic
1001456207 5:171862156-171862178 CAGTTTGATATTGAAGCTGTAGG + Exonic
1001608049 5:172977788-172977810 CACTGTAACCTTGAACTTGTGGG + Intergenic
1004730261 6:18350895-18350917 CTGTAGAATGTTGAAGATGTGGG - Intergenic
1010018362 6:71130635-71130657 CAGTATATTCTTGAACATGAGGG - Intergenic
1010247096 6:73671619-73671641 CAGGGTGATCTTGAACTTGTTGG + Intergenic
1017869094 6:158471055-158471077 CAGTGCAAGTTGGAAGATGTGGG + Intronic
1021562987 7:21987308-21987330 CAAGGTAATTTTGATGATGTCGG - Intergenic
1022217500 7:28278826-28278848 GAGTGGAATATTGAAAATGTAGG - Intergenic
1023945750 7:44801774-44801796 GAGTGGAATATTGAAAATGTAGG + Exonic
1027811902 7:82913632-82913654 AAGTCTAATATTGAAGATGAGGG - Intronic
1028112159 7:86953896-86953918 CAGTTTAGACTTCAAGATGTTGG - Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1028671129 7:93401249-93401271 CAGTGAAATCTTCAAAGTGTTGG + Intergenic
1029093365 7:98066021-98066043 ATGTGTAACCTGGAAGATGTTGG + Intergenic
1031138478 7:117913469-117913491 CAGTGTAATGTTCAACAAGTGGG + Intergenic
1031913425 7:127540887-127540909 AAGTGTTAACTTGTAGATGTTGG + Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038563530 8:28600678-28600700 CACCCTAATCTTGAAGATCTGGG + Intronic
1041658265 8:60375792-60375814 CAGTGTGATATTTAAGCTGTAGG - Intergenic
1043351216 8:79362998-79363020 CAGTGTAATCTCGAACTTCTGGG + Intergenic
1044266416 8:90187097-90187119 CACTGTAATCTTGAAGTCCTGGG + Intergenic
1044613754 8:94119476-94119498 CAGTATAATATTGACGGTGTTGG + Intergenic
1045957716 8:107928422-107928444 CAGTGTAATCTGGAATACTTTGG - Intronic
1046523448 8:115355072-115355094 GAATGTAATCTTATAGATGTGGG - Intergenic
1047906120 8:129475041-129475063 CAGGTTATTCTTGATGATGTGGG - Intergenic
1048725254 8:137375924-137375946 TAGTGCATTCTTGAAGGTGTTGG - Intergenic
1052220988 9:26022145-26022167 CAGTATGATATTGAAGATGCTGG + Intergenic
1052994262 9:34541824-34541846 GAGTGAAATGTTGAACATGTAGG + Intergenic
1055279788 9:74661214-74661236 CAGTGTAATAATGAAAATATGGG - Intronic
1057074686 9:92132091-92132113 CTGTGTTATCTTGAAGTTGTTGG + Intergenic
1057084611 9:92197513-92197535 CTGTGTTATCTTGAAGTTGTTGG - Intergenic
1185697941 X:2209561-2209583 CAGTATAATCATGAACCTGTAGG + Intergenic
1186066212 X:5767761-5767783 CAGAGAAACATTGAAGATGTTGG - Intergenic
1186812946 X:13207940-13207962 CAGTTTCCTCTTGGAGATGTGGG + Intergenic
1192534269 X:71913931-71913953 CCCTGTAACCTTGAAGATGGTGG - Intergenic
1192909136 X:75584588-75584610 CAGTGAAATCTTGATGGAGTGGG + Intergenic
1193664750 X:84301320-84301342 CTGTGTCATCTTGAATTTGTCGG - Intergenic
1193886727 X:86991962-86991984 CAGTGCAAGCTAAAAGATGTTGG - Intergenic
1195991505 X:110687027-110687049 CTGTGTACTCTGGAAGATGGGGG + Intronic
1196596080 X:117547063-117547085 CAGAGTAACATTGAAGAGGTAGG + Intergenic
1197204004 X:123774113-123774135 CAGTTTAGTCATTAAGATGTTGG - Intergenic
1199519090 X:148714931-148714953 TAGTTTAGTCTTGATGATGTGGG + Intronic
1201406913 Y:13658917-13658939 CAGTTGAGGCTTGAAGATGTAGG + Intergenic