ID: 925121148

View in Genome Browser
Species Human (GRCh38)
Location 2:1419475-1419497
Sequence ACTTTTAGGCAATAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925121148_925121154 24 Left 925121148 2:1419475-1419497 CCCTGCCTCTATTGCCTAAAAGT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 925121154 2:1419522-1419544 CATTTCCCTCTCCAACAGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925121148 Original CRISPR ACTTTTAGGCAATAGAGGCA GGG (reversed) Intronic
900701967 1:4054000-4054022 ACTTTCAGGCCAGACAGGCATGG - Intergenic
902922186 1:19672592-19672614 GCTATGAGGCAAAAGAGGCAGGG - Intronic
903165358 1:21516396-21516418 ACTTTTAGTTAGTAGTGGCATGG - Intronic
905956538 1:42001984-42002006 ACTTTTAGTGATTACAGGCAGGG - Intronic
911016412 1:93337840-93337862 TCTTTTAGGAAAAAAAGGCAGGG - Intergenic
911118557 1:94271985-94272007 GCTTTTAGACAATGGGGGCAGGG + Intronic
912026557 1:105182164-105182186 ACTTTTGGGAACTAGATGCAGGG + Intergenic
913684390 1:121217418-121217440 ACTCTCTGCCAATAGAGGCAAGG - Intronic
914036227 1:144005033-144005055 ACTCTCTGCCAATAGAGGCAAGG - Intergenic
914153229 1:145062912-145062934 ACTCTCTGCCAATAGAGGCAAGG + Intronic
916506298 1:165430867-165430889 GCTTCTAGACAATGGAGGCAGGG - Intronic
917165056 1:172102644-172102666 ACTTTGGGACAGTAGAGGCATGG + Intronic
918839178 1:189512872-189512894 ACTTTCAGACAAGGGAGGCAGGG + Intergenic
920471697 1:206235931-206235953 ACTCTCTGCCAATAGAGGCAAGG - Intronic
923352181 1:233119262-233119284 ACTTTTAGGAAAAAAAGGCCAGG + Intronic
1063674233 10:8125749-8125771 ACATTTAGAAAATAGAGGCTGGG - Intergenic
1066129251 10:32374790-32374812 AATATTAAGCAAAAGAGGCAAGG - Intronic
1069184093 10:65400677-65400699 ACTTTTGTTCAATAGAGGCATGG + Intergenic
1073741354 10:106411025-106411047 ACATTTAGCTAATAAAGGCATGG + Intergenic
1073879724 10:107966847-107966869 CCTTTTAGACAATATAGTCAGGG - Intergenic
1080611494 11:33908011-33908033 AATGTCAGGCAATAGAGGAATGG - Intergenic
1081028455 11:38046439-38046461 ATTTTAAGGAAATAGAGGCTAGG - Intergenic
1082970434 11:59015089-59015111 TCTTATAGGCAATAGAGCAATGG - Intronic
1084167459 11:67382524-67382546 ATTTTTAGGAACTAGGGGCAGGG - Intronic
1085505363 11:77055875-77055897 AGTTTTAAGCAATAGAGTAAAGG + Intergenic
1087429881 11:98040182-98040204 ACTTCTAGGCCCTAGAGGGAAGG - Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093240047 12:16659110-16659132 ACTTTGAGGCAGCAGAGGAAGGG + Intergenic
1095354215 12:41252450-41252472 AATTTTAGGCAAAACAGGCCAGG + Intronic
1099608744 12:84838288-84838310 ACTTTTAGGAAATTGAGAAATGG - Intergenic
1101713006 12:107286188-107286210 ACTTTTAGACACCAGAGGCTGGG - Intergenic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1103241283 12:119415505-119415527 AATTTTAGGCAATGGAGTCATGG + Intronic
1104113668 12:125728007-125728029 ACTTTTATGCTATAGAGACAAGG - Intergenic
1106404277 13:29460242-29460264 ACTTGTAGGAAAAACAGGCATGG - Intronic
1110210940 13:72972325-72972347 ACTTTAAGAAAATGGAGGCAGGG - Intronic
1111556518 13:89888305-89888327 AATTTTAGGTAATATAAGCAAGG - Intergenic
1111776741 13:92672876-92672898 ACTTTCAGAGAGTAGAGGCAGGG + Intronic
1114654448 14:24307766-24307788 ACCTTTAGGGGATATAGGCAGGG - Exonic
1115580389 14:34752301-34752323 ATTTTAAGGAAATAGAGGGAAGG + Intergenic
1117379638 14:55148112-55148134 CCTTTTAAACAAGAGAGGCAAGG + Intronic
1121539512 14:94714516-94714538 ACATGTAGTAAATAGAGGCAGGG + Intergenic
1121599873 14:95195413-95195435 ACTTTGGGGAAACAGAGGCAGGG - Intronic
1125039187 15:35163390-35163412 AATTTTAGGCTATAAAGGCCAGG - Intergenic
1125441625 15:39709642-39709664 CCCTTTAGGCAATAGGGGGAGGG + Intronic
1127239704 15:57099155-57099177 CTTTTTAGGCTGTAGAGGCAGGG - Intronic
1127459208 15:59182560-59182582 ACTTTTTGACAATAGAGACAAGG + Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1135004432 16:18806266-18806288 AAGCTTAGGTAATAGAGGCAAGG + Exonic
1135012818 16:18898033-18898055 ACTTTTACACCATAGAGGGAGGG - Intronic
1135319739 16:21485627-21485649 ACTTTTACACCATAGAGGGAGGG - Intergenic
1135337495 16:21615522-21615544 ATTTATAGGCACTAGAGGCTGGG - Intronic
1135372575 16:21917114-21917136 ACTTTTACACCATAGAGGGAGGG - Intergenic
1135439210 16:22453588-22453610 ACTTTTACACCATAGAGGGAGGG + Intergenic
1136561806 16:31043406-31043428 ACTTTTAGGCAACAGGGTCTTGG + Intergenic
1139050336 16:63117265-63117287 ACTTTTATTTTATAGAGGCAGGG + Intergenic
1140794608 16:78425548-78425570 AATTTTAACCAAAAGAGGCACGG - Intronic
1141258816 16:82431739-82431761 ACCTGTATGCAATATAGGCATGG + Intergenic
1143808147 17:9447192-9447214 ACTTTTAAGCAATGGAGGTTTGG + Intronic
1144176128 17:12709429-12709451 ACTTTTAGTCAAGACAGGCAGGG + Intronic
1145189322 17:20824648-20824670 CCTTTTTGGCAATAGAATCATGG + Intergenic
1146313340 17:31788085-31788107 ACTTTTAGGGAGTGGTGGCATGG + Intergenic
1146739605 17:35270871-35270893 TCTTTTAGTCAAAAGAGGTATGG - Exonic
1147564833 17:41529687-41529709 AGGTTTTGACAATAGAGGCAGGG + Intergenic
1149018313 17:51934238-51934260 GATTTAAGGCCATAGAGGCAGGG + Intronic
1149149592 17:53544572-53544594 GCTGTTAGGAAATAGAGGGATGG - Intergenic
1150077576 17:62206299-62206321 CCTTTTTGGCAATAGAATCATGG - Intergenic
1153332450 18:3887793-3887815 ACTTTTACGCAAAAGTGCCATGG - Intronic
1154224029 18:12484883-12484905 TATTTTAGGAAATAGAGACAGGG - Intronic
1156319495 18:36005495-36005517 ATTCTTAGGAAAAAGAGGCAAGG + Intronic
1162248660 19:9424302-9424324 ACTACTAGACAATTGAGGCAAGG + Intronic
1163542738 19:17920971-17920993 AATATTATGCAATAGAAGCAAGG - Intergenic
1164426269 19:28144665-28144687 ACTATGAGGCAATGGAGGCTTGG - Intergenic
1167791328 19:51684523-51684545 ACTTGTAGGAAGTAGAGACAGGG - Intergenic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
926433946 2:12819018-12819040 ACTTTTTGGTAATAGGGGCTTGG + Intergenic
926910586 2:17849183-17849205 CATTTTAGGCAATAGAGGTCAGG - Intergenic
927001779 2:18803057-18803079 CCTTGTAGTCAGTAGAGGCAGGG - Intergenic
931680933 2:64749871-64749893 ACTTTTATTCAATAAAGGCAAGG - Intronic
934810595 2:97273346-97273368 ACTTTGAGGCAGAAGAGGAAGGG - Intergenic
934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG + Intergenic
935682872 2:105652918-105652940 ACTTTTAGCCACAAGAAGCAGGG - Intergenic
937990460 2:127659308-127659330 ACATTTAGGCCAGAGGGGCAAGG + Intronic
938055709 2:128213139-128213161 ACTTTTAAAAAATAGAGACAGGG - Intergenic
941563139 2:167074795-167074817 ACACTCAGGCAATAGAGACAGGG + Intronic
942336009 2:174886588-174886610 ACTCTTTTGCAATAAAGGCATGG + Intronic
942395115 2:175538953-175538975 ACTATCAGGCAATTGAGCCATGG + Intergenic
945557575 2:211298344-211298366 GCTTTTCGGCAAGAGAGGAAGGG + Intergenic
947106406 2:226672425-226672447 ACTTTTAAAAAATAGAGACAGGG - Intergenic
947369991 2:229435544-229435566 ACTTTTAGGCATCAGAGACCTGG + Intronic
947642048 2:231712325-231712347 AGTTGCAGGCAGTAGAGGCAGGG + Intronic
948628615 2:239285925-239285947 ACTGTTTGGAAATAGAGGGATGG - Intronic
1169715755 20:8615970-8615992 AGTTGTAGTCAAGAGAGGCAGGG - Intronic
1170509944 20:17066235-17066257 ATTTCTAGGCAACACAGGCAAGG - Intergenic
1170518110 20:17153060-17153082 AGTTTCAGGCAGTGGAGGCAGGG + Intergenic
1171161682 20:22930779-22930801 TCTTTCAGGAAAAAGAGGCAGGG - Intergenic
1174673206 20:52327724-52327746 ACTGTTTGGCACAAGAGGCATGG - Intergenic
1174729528 20:52902238-52902260 TGTTTTGGGAAATAGAGGCAAGG - Intergenic
1174923792 20:54734084-54734106 GCTTTTAGGAAGTTGAGGCATGG + Intergenic
1175863931 20:62164501-62164523 CCTTTCAGGAAGTAGAGGCAAGG - Intronic
1177101882 21:16908200-16908222 ACTATTACATAATAGAGGCAAGG - Intergenic
1177381349 21:20348110-20348132 ACTTTGAGTCATTAGAGGAAAGG - Intergenic
1178183603 21:30193399-30193421 TCTCTTGGGCAATACAGGCAAGG - Intergenic
951794304 3:26521381-26521403 CCTTTTAGGCAATAGATCAATGG + Intergenic
952029915 3:29129437-29129459 ACATTTAGGCAAAGGAGGCAAGG + Intergenic
953024062 3:39134747-39134769 ACTGCCAGGCAATAGAGGTAGGG - Intronic
954349661 3:50032682-50032704 TCTTTTAAGAAATAGAGACAGGG + Intronic
959427233 3:106205794-106205816 AAATTTAGGCGATAGAGACAGGG - Intergenic
960342980 3:116497614-116497636 ACTTGGAGGCAACAGAGGAAGGG - Intronic
960585127 3:119314139-119314161 ACTTGGAGGCAAGAGCGGCATGG - Intronic
961162903 3:124744828-124744850 ACTTTTAGGCCAGAGATGGAGGG - Exonic
962202307 3:133411670-133411692 ACTTGAAGCCAATAGAGGGAAGG + Intronic
964755548 3:160088297-160088319 ACATTTAGGTAATAAGGGCAGGG - Intergenic
967596046 3:191327979-191328001 ACTTTGAGGCTTAAGAGGCAAGG + Intronic
969391760 4:6896085-6896107 ACATTTAGGCCATAGCAGCAGGG - Intergenic
969567011 4:7984665-7984687 ACTTTTGGCCAGGAGAGGCAGGG + Intronic
969983589 4:11183942-11183964 AGATTTAGGTAATACAGGCATGG - Intergenic
971003893 4:22352277-22352299 ACTTGGAGGCAACAGAGGAAGGG - Intronic
971812402 4:31443227-31443249 AATGTTAGGCAATAAAGACAAGG - Intergenic
973071668 4:45867865-45867887 ATTTTTGGGAAATAGAGGCTTGG + Intergenic
973240451 4:47950834-47950856 ACTTTTAGGAAATAGAGCACTGG - Intronic
973330272 4:48905706-48905728 ACTTTGAGGCATTTGAGCCAAGG + Intronic
974117708 4:57600788-57600810 ACTTTTGAGGAACAGAGGCAGGG - Intergenic
979045093 4:115852444-115852466 ACTTGGAGGCAGCAGAGGCAGGG - Intergenic
982438499 4:155404836-155404858 ACTTTGAGACAATAGATGAAAGG - Intergenic
991400554 5:66246669-66246691 GCTTTAAGGCAAGAGTGGCATGG + Intergenic
993413598 5:87600486-87600508 ACTTAGAGGCAACAGAGGGAAGG + Intergenic
995980485 5:118096961-118096983 ACATTTAGGCAAGTGAGGGAAGG - Intergenic
997633001 5:135384224-135384246 ACTTCTAGGAGATGGAGGCAGGG + Intronic
997968445 5:138379811-138379833 ACTATTAAGTAATAGAGCCAGGG - Intronic
1004821363 6:19371578-19371600 TCTTTTAGGCAATCTAAGCAAGG + Intergenic
1007967746 6:46017582-46017604 ACTTTGAGGAAACAAAGGCATGG + Intronic
1013648160 6:112165897-112165919 ACTTTTAGGTTCTAGAGGCAGGG + Intronic
1014571565 6:123015216-123015238 TCTTTTATGCCATAGAGCCAGGG - Intronic
1015951815 6:138560872-138560894 AAGCTTAGGGAATAGAGGCAAGG + Intronic
1019364171 7:623156-623178 ACTTGTAGTCAACAGAGTCACGG - Intronic
1020601250 7:10276931-10276953 AATTTTAGGCAATTAAGGGAAGG + Intergenic
1020735248 7:11940847-11940869 ACATTAAGGCAAAAAAGGCATGG + Intergenic
1028959803 7:96735871-96735893 ACTTTTAAACAATAGAGTGAAGG - Intergenic
1033310365 7:140256955-140256977 ACTTTTATAAAATAGAGACAGGG - Intergenic
1033312616 7:140272787-140272809 ACTTTTATTTAATAGAGACAGGG - Intergenic
1033869988 7:145740966-145740988 ACTTTTATGCAAACGAGGCAAGG + Intergenic
1034762671 7:153687775-153687797 ACTTTTATCCTATAGAGGCTTGG - Intergenic
1034922340 7:155094197-155094219 ACTCTGAGGGAAAAGAGGCAGGG - Intergenic
1036584020 8:10106427-10106449 ACTTTTAAACAGTAGAGGAATGG - Intronic
1037284838 8:17288178-17288200 ACTATGAGGGAATAGAGGTAAGG - Intronic
1038938255 8:32276211-32276233 ACCTGTAGTCATTAGAGGCAGGG - Intronic
1039679590 8:39715897-39715919 CCTTTGAGGAAATAGAAGCAGGG + Intronic
1039982860 8:42423360-42423382 ACTTTTATAAAATAGAGACAGGG + Intronic
1041238017 8:55824218-55824240 ATTTTTAAACATTAGAGGCAGGG - Intronic
1042309463 8:67365981-67366003 TCTTTTAGGCACTAGAGGTGTGG - Intergenic
1043843133 8:85132725-85132747 ACTGTTAGGCTATACAGGCCAGG - Intronic
1045176450 8:99730312-99730334 ACTCTTAGGAAATAAAGGAAAGG + Intronic
1045493813 8:102691156-102691178 ACTTCTAAGCAACAGAGCCAAGG - Intergenic
1046171777 8:110517571-110517593 ACTTTAAGGCAATATAGGGTAGG + Intergenic
1046420213 8:113972004-113972026 ACTTTTAGAAAATAAAAGCATGG + Intergenic
1047857652 8:128929424-128929446 ACTTTTAGTCAATATTGGGATGG - Intergenic
1048749276 8:137652547-137652569 ATTTATAGGCAATAGAAGAATGG - Intergenic
1056637013 9:88339569-88339591 ACTTGTGGGCATTAGTGGCAAGG + Intergenic
1186595715 X:10979433-10979455 ACTTCTAGTGAATAGAGGCCAGG + Intergenic
1186988765 X:15045197-15045219 ACTTTCAGTGAATAGATGCATGG - Intergenic
1192274898 X:69618426-69618448 ATTTTTGAGCAATAGAAGCAAGG + Intronic
1194129438 X:90062510-90062532 AATTTTTGGAAATAGAGACAAGG + Intergenic
1194156691 X:90398753-90398775 ACTTTTCTGCAAAAAAGGCAAGG - Intergenic
1194403813 X:93468961-93468983 GCTTGTAGGCAGCAGAGGCAGGG - Intergenic
1195641783 X:107183422-107183444 TTTTTTAAGCAATAGAGCCAGGG - Intronic
1196648491 X:118144661-118144683 ACATACAGGCAAAAGAGGCAGGG - Intergenic
1200503039 Y:3975738-3975760 ACTTTTCTGCAAAAAAGGCAAGG - Intergenic