ID: 925121909

View in Genome Browser
Species Human (GRCh38)
Location 2:1425494-1425516
Sequence ATGACTTTACAGAAGGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 5, 2: 3, 3: 21, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925121909_925121912 -7 Left 925121909 2:1425494-1425516 CCGTACTCCTTCTGTAAAGTCAT 0: 1
1: 5
2: 3
3: 21
4: 240
Right 925121912 2:1425510-1425532 AAGTCATCGTTCTAGATGCCGGG 0: 1
1: 10
2: 9
3: 9
4: 104
925121909_925121911 -8 Left 925121909 2:1425494-1425516 CCGTACTCCTTCTGTAAAGTCAT 0: 1
1: 5
2: 3
3: 21
4: 240
Right 925121911 2:1425509-1425531 AAAGTCATCGTTCTAGATGCCGG 0: 1
1: 7
2: 9
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925121909 Original CRISPR ATGACTTTACAGAAGGAGTA CGG (reversed) Intronic
900757317 1:4445338-4445360 ATGACTAGAAAGAAGGAGAAGGG - Intergenic
904941811 1:34168928-34168950 ATGACTTTTCAGATGGAGGGAGG + Intronic
906334989 1:44921685-44921707 ATGAGTTCACTGAAGGTGTATGG + Intronic
906446290 1:45901298-45901320 ATCACTTTACTGTAGGTGTATGG + Intronic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
909676946 1:78249231-78249253 ATGACTCTTCAGTAGGAGGAAGG + Intergenic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
913698951 1:121355758-121355780 ATGATTTTTCAGTAGGAGTGGGG + Intronic
914138594 1:144924287-144924309 ATGATTTTTCAGTAGGAGTGGGG - Intronic
916286165 1:163108292-163108314 AAGACTTTACAGAAGGCATTGGG + Intergenic
917312085 1:173689094-173689116 ATGACTTTAGAGGAAGAGTAGGG - Intergenic
920486363 1:206374465-206374487 ATGATTTTTCAGTAGGAGTGGGG + Intronic
921041712 1:211439034-211439056 ATGACCTTACAAAAGGTGCAAGG + Intergenic
921178324 1:212612273-212612295 CTGACTTTACATAAGAAGAAGGG + Intronic
922278336 1:224100082-224100104 ATGACTTCAACTAAGGAGTATGG + Intergenic
923301986 1:232649945-232649967 TTGACTTGACTGATGGAGTATGG + Intergenic
924646839 1:245885621-245885643 AAGACTTTAAAGAAAGACTAAGG - Intronic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1065772048 10:29086691-29086713 ATGACTTTAAGGGAGGAGAAAGG + Intergenic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1069034655 10:63633809-63633831 ATGACTTTTCAGCAGCAGAAGGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069190935 10:65488809-65488831 ATGGCTTTATAGAATGAGTTAGG - Intergenic
1069286046 10:66716723-66716745 ATGGCTTTACCCTAGGAGTAAGG + Intronic
1070506153 10:77114648-77114670 ACGACTTTAAGGAAGCAGTAGGG - Intronic
1073694895 10:105853783-105853805 AAGGCTTTAGAGAAGAAGTAGGG + Intergenic
1074938381 10:118209880-118209902 ATGATTTGACAGAAAGTGTATGG + Intergenic
1079068640 11:17322389-17322411 ATGAGTTTACAGTAGGTGTGTGG + Intronic
1080595289 11:33767904-33767926 ATGATTTGGCAGAAAGAGTAGGG - Intronic
1081049483 11:38319827-38319849 CTGGCTTTACAGAATGAGTTTGG - Intergenic
1081242169 11:40720403-40720425 ATGACTATACAGTAGGAATCAGG - Intronic
1081368636 11:42269574-42269596 GTGACTTTACATAATGAGTTTGG - Intergenic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083551699 11:63594829-63594851 ATGACAATACAGAAGGAGGTGGG + Intronic
1086248946 11:84790883-84790905 ATGACTTCACTGTAGGTGTATGG + Intronic
1087924570 11:103904366-103904388 ATGGGTCTACAGAAAGAGTAGGG - Intergenic
1088046882 11:105463640-105463662 ATGAATTTACTGTAGGTGTATGG - Intergenic
1092042631 12:5398047-5398069 AAGACTTTTCAGAAGAATTAGGG - Intergenic
1092265126 12:6975029-6975051 ATGACTGGACAGAAGGACTGTGG + Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1094124193 12:27005740-27005762 ATGACTTGACAAAATAAGTAGGG + Intronic
1094336401 12:29360767-29360789 ATTAGTTTACAGAAAGAGAAGGG + Intronic
1094753435 12:33439500-33439522 ATGAGTTTCCACAAGGAGGACGG - Exonic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1097925069 12:65118041-65118063 AAGACCTTATAGAAGCAGTAAGG - Intronic
1105057131 12:133112268-133112290 ACGAAGTTAAAGAAGGAGTAGGG - Exonic
1107287364 13:38809621-38809643 ATGAGTTTACTGTAGGTGTACGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108898055 13:55360080-55360102 ATTACTTTACAGAAGAAGAGAGG - Intergenic
1110633912 13:77742944-77742966 TTGACTTGTCAGAAGGAGAAAGG - Intronic
1110877133 13:80523788-80523810 TTGGCTTTGCAGAATGAGTAAGG + Intergenic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1113984336 13:114301851-114301873 ACGGCTTTCCAGAAGGAGTGAGG + Exonic
1115814621 14:37149992-37150014 TTTTCCTTACAGAAGGAGTAGGG + Intronic
1116666041 14:47776932-47776954 TTGAGGTTACAGAAGGAATAGGG + Intergenic
1118824564 14:69368543-69368565 ATGAAGTTACAGAAGGACTGTGG - Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1125190851 15:36991218-36991240 TTGATTTTACAGAAGAATTAAGG - Intronic
1125272909 15:37959341-37959363 TTGACCTTACAGAATGAGTTTGG - Intronic
1125346212 15:38721618-38721640 AAGACCTTAGAGAAGGAGAAAGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126018031 15:44372299-44372321 ATGGCTATAGAGAAGGAGTATGG - Intronic
1126279633 15:46929827-46929849 CTGACTTTACAGAATGAGTTAGG + Intergenic
1126927557 15:53607368-53607390 ATGAGTTCACAGTAGGTGTATGG - Intronic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1128780054 15:70353386-70353408 AGGAATTCAAAGAAGGAGTAAGG + Intergenic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1131415619 15:92253921-92253943 ATGAGTTTACTGTAGGTGTATGG + Intergenic
1134010203 16:10846353-10846375 ATGTCTTCACAGAAGGTGTTAGG - Intergenic
1137901236 16:52271564-52271586 ATGACATCACAGAAGGAGGATGG + Intergenic
1138166776 16:54809389-54809411 AGGACTTCACAGTAAGAGTATGG + Intergenic
1138606291 16:58091501-58091523 ATGACTTTATAAAATGATTAGGG - Intergenic
1138714416 16:59004828-59004850 TTGTCTTTAGAGAAGGAGAAAGG + Intergenic
1138916728 16:61473289-61473311 CTGACTTCACAGAATGAGTACGG - Intergenic
1140787241 16:78354381-78354403 ATGACTTTCCAGAGGGACTCAGG + Intronic
1141402776 16:83764907-83764929 AAGACTTTAAAGCAGGAGAATGG - Intronic
1144505442 17:15825959-15825981 CTGACTTTATAGAATGAGTTAGG + Intergenic
1145054585 17:19692671-19692693 TTGGCTTTACAGAATGAGTTTGG - Intronic
1145254004 17:21312940-21312962 TTGAGGTTACAGAAGGAATAAGG + Intronic
1146169122 17:30619593-30619615 ATTACATTACAGAAGTTGTAGGG + Intergenic
1146170440 17:30627856-30627878 ATTACATTACAGAAGTTGTAGGG - Intergenic
1146921633 17:36716624-36716646 CTGGCTTTAAAGAAGGCGTAGGG - Intergenic
1148536266 17:48441628-48441650 ATGGCCTTAGAGAAAGAGTATGG - Intergenic
1149150611 17:53559292-53559314 ATTATGTTACAGAAGGAGTAGGG - Intergenic
1156426664 18:37020698-37020720 ATTGCTTTCCAGAAGGTGTATGG + Intronic
1156711186 18:39947881-39947903 ATGACTTTCCATAACAAGTATGG - Intergenic
1158524551 18:58200872-58200894 ATTACTTTGCAGTAGGAGTCAGG + Intronic
1159099188 18:63939394-63939416 GTGACTTTACAGATGGAGAGTGG - Intergenic
1159146571 18:64462189-64462211 ATGACTTCACTGAAGGAGGTGGG + Intergenic
1165001991 19:32771808-32771830 ATTACTTTAAAGAAGGGTTAGGG + Intronic
1165796335 19:38522055-38522077 ATGATTTTTCAGGAGGAGGAAGG + Intronic
925121858 2:1424793-1424815 ATGACTTTACAGAAGGAGCACGG - Intronic
925121868 2:1424949-1424971 ATGACTTTATAGAGGGAGCATGG - Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121887 2:1425183-1425205 ATGACTTTACAGAAGGAGCATGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925121938 2:1425962-1425984 ATGACTTTACAGAAGGAGCATGG - Intronic
925121942 2:1426040-1426062 ATGACTTTATGGAAGGAGCACGG - Intronic
925121958 2:1426274-1426296 ATGACTTTATAGAAGGAGCATGG - Intronic
925121962 2:1426352-1426374 ATGACTTTATGGAAGGAGCACGG - Intronic
925121969 2:1426430-1426452 ACGACTTTACAGAAGAAGCATGG - Intronic
925121974 2:1426508-1426530 ATGACTTTACAGAAGGAGCATGG - Intronic
925121979 2:1426586-1426608 ATGACTTTACAGAAGGAGCATGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
927268996 2:21185448-21185470 ATGACTTTGCAGATGCAGCATGG - Intergenic
927422682 2:22949467-22949489 ATGACTTGACAGATGAAGGAAGG + Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
932299498 2:70656153-70656175 CTTACTTTACAGATGAAGTAAGG - Intronic
933524654 2:83420355-83420377 TTGATTTCACAGAAGGAGTTAGG - Intergenic
934726906 2:96627712-96627734 ATGACTTTATATAAGAAGAAAGG + Intronic
935093510 2:99920198-99920220 ATAACTTTACAGGATGAGTTGGG - Intronic
935831031 2:107000659-107000681 ATGACCTTAGAGAGGGAGGATGG + Intergenic
935869441 2:107429237-107429259 ATGACTCTACAGGGGGAATATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936885415 2:117305162-117305184 ATGAGTTTACTGTAGGAGTGTGG - Intergenic
936978531 2:118242613-118242635 ATAACTCTCCAGAAGGAGCATGG - Intergenic
937509344 2:122576187-122576209 ATGGCTTCCCAGAAGGGGTAAGG + Intergenic
937602819 2:123759451-123759473 ATGACTTCATAGAATGAGTTAGG - Intergenic
938990720 2:136626458-136626480 AGGACTTTACAGAAGGTCAAGGG - Intergenic
939373675 2:141335709-141335731 ATGACTTCAGAGAAAGAGGAAGG + Intronic
941253960 2:163204350-163204372 ATATCTTTAAAGAATGAGTAAGG + Intergenic
941980707 2:171453461-171453483 ATGAAATTACAAAATGAGTAAGG + Intronic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943739528 2:191396301-191396323 ATTGGTTTCCAGAAGGAGTATGG + Intronic
945956666 2:216092644-216092666 ACATCTTTAAAGAAGGAGTAAGG + Intronic
946583849 2:221161382-221161404 TTGATTTTACAGGAGGAGTTTGG - Intergenic
946643858 2:221813112-221813134 AAAACTTTACAGAAGAGGTAGGG - Intergenic
1170331292 20:15213656-15213678 ATGACTTCACTCAAGGAATAAGG - Intronic
1170489488 20:16858129-16858151 ATGACTTCCCAGAAGGAAAATGG + Intergenic
1170509257 20:17059930-17059952 ATGACTTTTCAGAAGGCCTCTGG + Intergenic
1171478638 20:25434918-25434940 ATGACTTGATGGAAGGAGTTTGG - Intronic
1171564320 20:26164972-26164994 ATTACTTTACAAAAGGAAAATGG + Intergenic
1173174892 20:40756973-40756995 ATGAATTCACAGAAGAGGTAAGG - Intergenic
1173921639 20:46750572-46750594 ATGACTTTAGAGAAGGCCAAAGG - Intergenic
1177090591 21:16762631-16762653 ATGAGTTTACTGTAGAAGTAAGG - Intergenic
1177284732 21:19035264-19035286 ATGACTTCATAGAAGGATTTAGG + Intergenic
1181908733 22:26220829-26220851 ATGAATTGAGAGAAGGAGAAAGG + Intronic
1183847176 22:40551866-40551888 ATGAATTTATGGAAGGAATAGGG + Intronic
1183973068 22:41493048-41493070 ATCACTTAGCAGAAGGCGTAAGG + Intronic
1184000115 22:41667133-41667155 AAGACATTACAGAAGGGGAAAGG - Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949875131 3:8621522-8621544 ATGACATTGCAGAAGGAAGAGGG + Intronic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
951044118 3:18019372-18019394 ATCACTTCACAGGAGAAGTAAGG + Intronic
953110138 3:39927677-39927699 CTGACTTTGCAGAATGAGTTAGG - Intronic
954501890 3:51025329-51025351 AGGAGTTTACAAAAGGAGTGGGG + Intronic
958562187 3:95760313-95760335 CTGACTTTACAGAATGAGTTAGG - Intergenic
959362195 3:105407190-105407212 GTGACTTCACAGAAGGATTTAGG - Intronic
959371918 3:105537566-105537588 ATTACTCTACAGAAGGAATCTGG - Intronic
959411173 3:106023999-106024021 ATCACTTTGCAGAATGATTAAGG - Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
962111078 3:132449092-132449114 CTGATTTTACATCAGGAGTAAGG + Intronic
963922255 3:150916872-150916894 ATGAATGTACTGAAGGAATAAGG - Intronic
964988857 3:162780860-162780882 ATGACTTCATAGAATGAGTTAGG - Intergenic
965527529 3:169737063-169737085 ATGAGTTTACTGCAGAAGTATGG - Intergenic
965680935 3:171250538-171250560 ATGGCTTTAGAGAAGTAGGATGG - Intronic
965942117 3:174197469-174197491 AAGACTTTATAAAAGGAGAATGG + Intronic
966744736 3:183264714-183264736 ATGAGTTGACAGCAGGGGTAAGG + Intronic
967633710 3:191777095-191777117 ATGACATTACGGGAGGATTATGG - Intergenic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
971277263 4:25210144-25210166 TTGAGTTTACAGAAAGAATAGGG + Intronic
971986782 4:33836294-33836316 ATTACTTTACAAAAGGAAAATGG - Intergenic
972167689 4:36307483-36307505 AGGACTTTACAGAAGTAATCAGG - Intronic
972745646 4:41930033-41930055 ATGACTATACAGGAGAAGGATGG - Intergenic
973627447 4:52787273-52787295 ATTACTTTAAAGATGGAGTCTGG + Intergenic
974191776 4:58513780-58513802 ATGACTTTGCAGAAGTAATTAGG - Intergenic
975961384 4:79910580-79910602 ATGACATTATAGAGGGAATATGG - Intronic
979449263 4:120850724-120850746 ATGACTTAACAAGAGGAGTGAGG - Intronic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
980101937 4:128550564-128550586 AAGGCTTTACAGAAGCAGCAGGG + Intergenic
980303471 4:131025000-131025022 AGGACTTTAAATAAGGAATATGG + Intergenic
980528279 4:134017412-134017434 ATGACTAGACAGAAGAAGTAGGG - Intergenic
980595089 4:134944356-134944378 ATTCCTTTACGGAAGTAGTACGG - Intergenic
980664208 4:135907457-135907479 ATGACTTCATAGAATGAGTTAGG + Intergenic
981453497 4:144926967-144926989 TTGACTTCACAGAATGAGTTTGG + Intergenic
984266958 4:177507047-177507069 ATGCCTTTAGAGCAGGAGTAGGG + Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
988002868 5:25371898-25371920 ATGAGTTTACTGTAGGTGTATGG - Intergenic
988017411 5:25577018-25577040 ACCACTTAACATAAGGAGTAGGG - Intergenic
990609924 5:57446713-57446735 ATGACTTGGAGGAAGGAGTAAGG + Intergenic
992261517 5:74975326-74975348 ATGTCTTTCCAGAAGGGGTTCGG - Intergenic
992462152 5:76971284-76971306 GTACCTTTACAGAAGGAGAAAGG + Intronic
992689637 5:79230122-79230144 ATGCCTTTTCAGAAGGAAGATGG - Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
994127641 5:96186854-96186876 CTGGCTTTACAGAATGAGTTAGG + Intergenic
995274734 5:110265278-110265300 ATTACTTTACAGAATGGGTATGG - Intergenic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
997290268 5:132727429-132727451 AGGACTTTCCAGAAGAGGTAAGG + Intronic
1000418371 5:161008477-161008499 ATGACATTTTAGAGGGAGTAAGG - Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1004133514 6:12944539-12944561 CTGACTTTACTGAAAGAGTTGGG + Intronic
1004941869 6:20567595-20567617 ATGTCTTCATAGAAGGAATATGG + Intronic
1007036133 6:38675514-38675536 ATGAATTTAAAGAATGAGCAAGG + Intergenic
1008703863 6:54133859-54133881 ATGACTTTAGAGAGAGTGTATGG + Intronic
1010116162 6:72315097-72315119 ATGATTTTATACAAGGAGAATGG + Intronic
1010352852 6:74896149-74896171 CTGACGTCACAGAAGGAGTTTGG + Intergenic
1012007748 6:93735651-93735673 ATGAGTATATAGAATGAGTAGGG - Intergenic
1012530330 6:100228120-100228142 ATAACACTACAGAAGGAGAAGGG + Intergenic
1013909663 6:115258711-115258733 ATGAGTTCACAGTAGGTGTATGG - Intergenic
1015616453 6:135080847-135080869 AAGACTTTACAGAATTAGTTTGG + Intronic
1015980159 6:138830478-138830500 ATGACTCTAGAGCAGGGGTATGG - Intronic
1017154830 6:151313665-151313687 CTGACTTAACAAAAGGAGTGAGG + Intronic
1019036429 6:169063389-169063411 ATAACTTCACAGAAAGGGTAGGG - Intergenic
1021295743 7:18904182-18904204 ATGAATTTACTGAAATAGTAAGG + Intronic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1025273412 7:57549247-57549269 ATTACTTTACAAAAGGAAAATGG - Intergenic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1029042490 7:97592418-97592440 TTGGCCTTACAGAGGGAGTAGGG - Intergenic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1029936560 7:104431204-104431226 ATCAATTTACAAAAGCAGTAGGG - Intronic
1030977392 7:116143752-116143774 ATATGTTTGCAGAAGGAGTAGGG - Intronic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032939518 7:136772582-136772604 CTGACCTCACAGAATGAGTATGG - Intergenic
1033289284 7:140069358-140069380 CTGACTTTACAGAAATAGAAAGG + Intergenic
1035118431 7:156544697-156544719 TTTACTTTACAGAAGAAGAATGG - Intergenic
1041562742 8:59238621-59238643 ATGACTTTAGATAAGAAGGAAGG + Intergenic
1043006804 8:74829991-74830013 AAGATTTTAGAGAAGGATTAGGG + Intronic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1044897891 8:96911978-96912000 ATCACTTTACAGATGGGGAAAGG - Intronic
1045981151 8:108189477-108189499 TTCACTTTTCAGAATGAGTAAGG - Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050319963 9:4441956-4441978 TTGGCTTTAGAGAAAGAGTAAGG + Intergenic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1052096562 9:24391194-24391216 AGGAATTTACAGAAGTAGTCTGG + Intergenic
1052113300 9:24617011-24617033 ATCACTTTACAGATTGAATAAGG - Intergenic
1053449762 9:38183306-38183328 ATGAGTTTACAGCAGGAATAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055806902 9:80105764-80105786 GTGACTTTTCAGAAAAAGTAAGG + Intergenic
1056638863 9:88353094-88353116 ATGATAGGACAGAAGGAGTATGG - Intergenic
1057137702 9:92705368-92705390 ATGACCTTACAGAAAGAAAAAGG - Intergenic
1057137996 9:92707887-92707909 ATGACCTTACAGAAAGAAAAAGG - Intergenic
1057138017 9:92708159-92708181 CTGATTTTACAGAAGTATTAAGG - Intergenic
1058356641 9:104091647-104091669 AGGACTTTACCGCAGAAGTAAGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059573856 9:115469038-115469060 TTCCCTTTACAGAAGAAGTAAGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1203625097 Un_KI270750v1:9912-9934 ATTACTTTACAAAAGGAAAATGG - Intergenic
1186134054 X:6500235-6500257 ATCATTTTACAGAAGGTGAAAGG + Intergenic
1186388721 X:9136733-9136755 AAGTCTTTGCAGAACGAGTAGGG - Intronic
1186826702 X:13347395-13347417 TTGCCTTTACAGAAGGAGCCAGG + Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1188984679 X:36758578-36758600 ATGACCTGACAGAAAGAGTGTGG - Intergenic
1192232143 X:69272763-69272785 AGGACTGGACAGACGGAGTAGGG + Intergenic
1192802634 X:74481216-74481238 CTGACTTCACAGAATGAGTTGGG + Intronic
1194805513 X:98322187-98322209 ATGGCTTCATAGAAGGAGTTAGG - Intergenic
1194898286 X:99472404-99472426 ATGACTTCATAGAATGAGTTAGG - Intergenic
1196062628 X:111427361-111427383 ATGACTTCTTAGAAGGAGAAAGG + Intergenic
1196205860 X:112938551-112938573 ATGAGTTCACTGAAGGTGTACGG - Intergenic
1196406277 X:115365919-115365941 ATGACTCGACAGAGGGAGTTTGG - Intergenic
1197010460 X:121555776-121555798 ATGAGTTTACAGTAGGTGTATGG - Intergenic
1197362294 X:125519800-125519822 ATGACTCTAGAGAAAGAGTCTGG - Intergenic
1198160961 X:134007640-134007662 ATGACTGTACTGATGGGGTAAGG - Intergenic
1199219636 X:145302783-145302805 CTGACTTCATAGAAGGAGTTAGG + Intergenic
1199378408 X:147139098-147139120 ATGACTTGAAAAAAGAAGTAAGG - Intergenic
1199765756 X:150940713-150940735 GTCACATTACAGAAGGGGTAAGG - Intergenic
1201492488 Y:14557418-14557440 CTGAGTTTACAGAAAGAGTGGGG + Intronic