ID: 925121983

View in Genome Browser
Species Human (GRCh38)
Location 2:1426664-1426686
Sequence CTGTCTTTACAGAAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925121983_925121985 -9 Left 925121983 2:1426664-1426686 CCATGCTCCTTCTGTAAAGACAG 0: 1
1: 0
2: 6
3: 32
4: 307
Right 925121985 2:1426678-1426700 TAAAGACAGACACCTGAAGAAGG 0: 1
1: 0
2: 0
3: 30
4: 305
925121983_925121989 27 Left 925121983 2:1426664-1426686 CCATGCTCCTTCTGTAAAGACAG 0: 1
1: 0
2: 6
3: 32
4: 307
Right 925121989 2:1426714-1426736 GATGAATTTATTAGATCATCAGG 0: 1
1: 0
2: 1
3: 11
4: 156
925121983_925121988 5 Left 925121983 2:1426664-1426686 CCATGCTCCTTCTGTAAAGACAG 0: 1
1: 0
2: 6
3: 32
4: 307
Right 925121988 2:1426692-1426714 TGAAGAAGGCACTTCATTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 287
925121983_925121987 4 Left 925121983 2:1426664-1426686 CCATGCTCCTTCTGTAAAGACAG 0: 1
1: 0
2: 6
3: 32
4: 307
Right 925121987 2:1426691-1426713 CTGAAGAAGGCACTTCATTTAGG 0: 1
1: 0
2: 4
3: 13
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925121983 Original CRISPR CTGTCTTTACAGAAGGAGCA TGG (reversed) Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900836744 1:5010717-5010739 GTGTCCTTAGAGAAGGAGAAGGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901363226 1:8721863-8721885 CTGTCTTGACAGCAGTAACACGG + Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
903166357 1:21523413-21523435 GAGTCTTTACAGAAGGAGGCAGG - Intronic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
906818889 1:48908112-48908134 CTGTCTTCCCAAAAGGAACAGGG - Intronic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
908222387 1:62020481-62020503 CTTTCTTTATGGAAGGAGGAGGG - Intronic
908475160 1:64480047-64480069 CTGTCTTTGGAGCAGAAGCAGGG - Intronic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909412677 1:75373632-75373654 CTGCCTTTCCTGCAGGAGCAGGG + Intronic
910316271 1:85887181-85887203 CTGACTTTAAAGAGGGAACAAGG - Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911241032 1:95466950-95466972 CTGTCTTTGCAGAATGAGTTTGG + Intergenic
912747731 1:112259384-112259406 CTCTCTCTCCAGAAGGAGCCAGG - Intergenic
913093640 1:115496633-115496655 CTGAGTTTATACAAGGAGCAAGG - Intergenic
916146144 1:161741501-161741523 CTATCTTTAGAGAGGGAGCTGGG - Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917673274 1:177294586-177294608 CTGTCTTTATAGAATGAGTTAGG + Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918428272 1:184432840-184432862 CTGTCTTTATTGAAGGAAAAGGG + Intronic
920527988 1:206683007-206683029 CTGCCTTTTCAGAGGCAGCAAGG - Intronic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921032705 1:211347642-211347664 CTGGCTGTTCAGCAGGAGCAAGG + Intronic
921178324 1:212612273-212612295 CTGACTTTACATAAGAAGAAGGG + Intronic
921549236 1:216512908-216512930 CTGGCTTTAAAGACGGAGGAGGG + Intronic
922000513 1:221473061-221473083 CCCTCTTCAAAGAAGGAGCAGGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922961073 1:229646007-229646029 CTGTCTTTACAGGAAGAGGGAGG - Intronic
923055424 1:230423146-230423168 CTGTTTTTACAGTTGCAGCAAGG + Intronic
923166556 1:231369437-231369459 AAATCTTTACAGAAGCAGCAGGG + Intronic
923234889 1:232022628-232022650 CTGTCTGTCCAGAGAGAGCAGGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064743187 10:18453945-18453967 CTGTTTTTAAACAAGTAGCATGG + Intronic
1064957322 10:20925111-20925133 TTGTCTCTACAAAAGGAGCCTGG - Intronic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1068896285 10:62206384-62206406 TAGTCATTACAGAAGTAGCAGGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070697639 10:78574671-78574693 CTGTATTTACATAGAGAGCAAGG + Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071554606 10:86592647-86592669 CTTTCTTGAGACAAGGAGCAGGG + Intergenic
1074081806 10:110173887-110173909 CTGTCTTTAAAGAAAGAGATTGG + Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1075329908 10:121566521-121566543 CTGTCCCTACAGAAGAAGCCTGG - Intronic
1075990705 10:126836395-126836417 CTGCCCTTGCAAAAGGAGCAAGG + Intergenic
1076253088 10:128998182-128998204 CTGTCTTTTAAGAAGAAGCCAGG - Intergenic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1079455272 11:20630940-20630962 CCTTCTTTACAGAGGGACCAAGG + Intronic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080832641 11:35910387-35910409 CTCTCTTTATAGAAGTAGAAAGG - Intergenic
1080919549 11:36695161-36695183 CTTTCTTAACAGAAGGGTCATGG + Intergenic
1081049483 11:38319827-38319849 CTGGCTTTACAGAATGAGTTTGG - Intergenic
1081255337 11:40886059-40886081 CCAAGTTTACAGAAGGAGCAAGG - Intronic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1084409992 11:69001366-69001388 CTGTCTTCACAAAAGGAAAACGG - Intergenic
1088395909 11:109369338-109369360 CTGGCTTCACAGAATGAGCTAGG + Intergenic
1088807291 11:113364213-113364235 CTGCCTTCACAGAAGGAGAGGGG + Intronic
1088992096 11:114962542-114962564 CTGTCTTTACTGAGGGAGAAGGG - Intergenic
1090711029 11:129385392-129385414 CTGTCCTTTCAGAAGGAAAAAGG + Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093115782 12:15209145-15209167 TTGTCTTTGGAGAAGCAGCATGG - Intronic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099040671 12:77650250-77650272 ATATCTTTAAAGAAGAAGCATGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103407829 12:120687871-120687893 CTGTCTCGACAGGAGAAGCAGGG - Intronic
1104743501 12:131195540-131195562 CTGTGTTTACAGCTGGATCACGG - Intergenic
1104790832 12:131481144-131481166 CTGTGTTTACAGCTGGATCACGG + Intergenic
1105240680 13:18607121-18607143 CTGTCTTCATAGAATGAGTATGG - Intergenic
1106033193 13:26020810-26020832 CTTTCTTTACAGAACGAGAAGGG - Exonic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106895138 13:34291802-34291824 CAGTCTTTGCAGCAGGAGCTGGG + Intergenic
1107296954 13:38919537-38919559 CTGTCTTTATAGAATGAGTTAGG + Intergenic
1107318102 13:39155929-39155951 CTGCCATTAAAAAAGGAGCAAGG - Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108904834 13:55455451-55455473 CTGTCTATAAAGCAGCAGCAAGG - Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115242595 14:31264560-31264582 CTGTCCTTAGAGAAAGAGTATGG + Intergenic
1115814621 14:37149992-37150014 TTTTCCTTACAGAAGGAGTAGGG + Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118702223 14:68444733-68444755 CTGTTCTCACAGTAGGAGCAGGG + Intronic
1119031751 14:71198113-71198135 CTCTTTTTGCACAAGGAGCATGG - Intergenic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1120290533 14:82564513-82564535 TTTTCTTTACACAAGAAGCAGGG - Intergenic
1120609789 14:86625370-86625392 CTGTCTTTAAAGAAAGTTCAGGG + Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1122761939 14:104035126-104035148 CTTTCTTTCCAAAAGGAGCAAGG - Intronic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1123474698 15:20581655-20581677 CTTTCTTCAAAGGAGGAGCAGGG - Intergenic
1123643313 15:22418702-22418724 CTTTCTTCAAAGGAGGAGCAGGG + Intergenic
1124683878 15:31761941-31761963 CTGTCTTTACAGATTTATCAGGG - Intronic
1126279633 15:46929827-46929849 CTGACTTTACAGAATGAGTTAGG + Intergenic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127804818 15:62509724-62509746 CTGTCTGTAAAGGAGGCGCACGG - Intronic
1127827475 15:62717758-62717780 CTGTCTTTACTGAACTACCAGGG - Intronic
1128291665 15:66482857-66482879 CAGTCTTTACAGAAGTGGCGGGG + Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1128607374 15:69047072-69047094 CTGTCTCTTCACCAGGAGCAGGG + Intronic
1128885858 15:71287246-71287268 TTGTCTTTACAGAAGGAAATGGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1131544588 15:93305419-93305441 CTGTCTTTTCAGCAGGCTCATGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1137079881 16:36035069-36035091 CTGTTTTTACAGAATCTGCAAGG + Intergenic
1137836109 16:51594137-51594159 TTGTCTTTGCAGAGGGATCATGG + Intergenic
1138405383 16:56788660-56788682 CTGGCTTTGCAGTAGTAGCACGG + Intronic
1138714416 16:59004828-59004850 TTGTCTTTAGAGAAGGAGAAAGG + Intergenic
1138916728 16:61473289-61473311 CTGACTTCACAGAATGAGTACGG - Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1140446015 16:75028594-75028616 TTGTCTTAAAAGAAGTAGCAGGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1146921633 17:36716624-36716646 CTGGCTTTAAAGAAGGCGTAGGG - Intergenic
1147214341 17:38890658-38890680 CTGACTTTATCAAAGGAGCAGGG + Intronic
1149277963 17:55065972-55065994 CTTTCTTTGCAAAATGAGCATGG + Intronic
1153027966 18:688399-688421 CTGCCTTTAGAGAAAGAGCCTGG + Intronic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1154448200 18:14451968-14451990 CTGTCTTCATAGAATGAGTATGG + Intergenic
1156157370 18:34319175-34319197 CTGGCTTTCCAGTAGGAGCGGGG - Intergenic
1156943398 18:42796871-42796893 CTGTCTTTACTTAAGGAGGCAGG - Intronic
1157813020 18:50711111-50711133 TTCTCTTTGCAGAGGGAGCAGGG - Intronic
1159820584 18:73137456-73137478 CTTTCTTTACTGAAGGGGAAAGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1161444390 19:4310329-4310351 CTGTCTTCACACCAGGGGCAGGG - Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1163232180 19:16012352-16012374 CTGTTTTGAAAGAAGGATCAGGG + Intergenic
1164300024 19:23953892-23953914 CTGTCTTTACAGATGGTTCAAGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
925121858 2:1424793-1424815 ATGACTTTACAGAAGGAGCACGG - Intronic
925121868 2:1424949-1424971 ATGACTTTATAGAGGGAGCATGG - Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121887 2:1425183-1425205 ATGACTTTACAGAAGGAGCATGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925121938 2:1425962-1425984 ATGACTTTACAGAAGGAGCATGG - Intronic
925121942 2:1426040-1426062 ATGACTTTATGGAAGGAGCACGG - Intronic
925121958 2:1426274-1426296 ATGACTTTATAGAAGGAGCATGG - Intronic
925121962 2:1426352-1426374 ATGACTTTATGGAAGGAGCACGG - Intronic
925121969 2:1426430-1426452 ACGACTTTACAGAAGAAGCATGG - Intronic
925121974 2:1426508-1426530 ATGACTTTACAGAAGGAGCATGG - Intronic
925121979 2:1426586-1426608 ATGACTTTACAGAAGGAGCATGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925385096 2:3456581-3456603 CTGTCTTTAAAAAAAAAGCATGG - Intronic
925703032 2:6658096-6658118 CTCTCTGTTCAGAAGTAGCAAGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
927586612 2:24312825-24312847 GTTTCTTTAAAGAAGGAGCAGGG + Intronic
927654140 2:24931066-24931088 CTGCCTTTTCAGCAGGAGCCCGG + Intergenic
928247074 2:29639803-29639825 GTGTCTTTACATAGGGAACAGGG + Intronic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929215563 2:39408190-39408212 CTGACTTTACAGACAAAGCATGG - Intronic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
932498657 2:72160634-72160656 CTTTCTTCACAGAAGAAGCTGGG - Intergenic
934965969 2:98722921-98722943 CTGTCTTGCCAGGAGGAGCATGG - Intronic
935142701 2:100368030-100368052 CTATCTTTCCAGGAGGGGCAGGG + Intergenic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
939350905 2:141036539-141036561 CTGCCTCTAGAAAAGGAGCAGGG + Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
943284953 2:185985904-185985926 CTGTCTTTACAGAAAAAGTTTGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
945217305 2:207447267-207447289 CTGTAACTACAAAAGGAGCAGGG - Intergenic
947246659 2:228055998-228056020 CTGTCATTGAAGATGGAGCAAGG - Intronic
1170648306 20:18216144-18216166 CTGTCTCTTCACAAGGAGAAGGG - Intergenic
1172033236 20:31995809-31995831 CTGTCATTATGGAAGGGGCAAGG - Intronic
1174145970 20:48452825-48452847 GCTTCTTTTCAGAAGGAGCAGGG - Intergenic
1174439958 20:50543254-50543276 CTTTCCTTACAGAAGGACAAAGG + Intronic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1177722845 21:24929312-24929334 CAGATTTTATAGAAGGAGCAGGG - Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178894503 21:36547900-36547922 CTTTCTTTTCAAAAGAAGCAAGG - Intronic
1181384652 22:22535213-22535235 TTTTCTTGACAGAAGGAGCTAGG - Intergenic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1183836715 22:40460313-40460335 CTGTCTTTCCTGTAGTAGCAGGG - Intronic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953216662 3:40924632-40924654 GTCTCTTTACAGAACAAGCAAGG + Intergenic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956791730 3:72685251-72685273 CTGACTTCACAGACGTAGCAGGG + Intergenic
957558764 3:81794906-81794928 GTGTCTTTATATAAGCAGCAAGG + Intergenic
958562187 3:95760313-95760335 CTGACTTTACAGAATGAGTTAGG - Intergenic
958706325 3:97661089-97661111 CTGGATTTACAAAAAGAGCAGGG - Intronic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
961561178 3:127731480-127731502 CTGTCTTTCCAGGATCAGCAAGG - Intronic
963970619 3:151425681-151425703 TTGTGGTTACAGCAGGAGCATGG + Intronic
965023296 3:163263871-163263893 CTGTCCTTATAGAATGAGCTGGG + Intergenic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
966995942 3:185280707-185280729 CTGTTTTAATAGAAGGGGCAGGG + Intronic
967773398 3:193359209-193359231 CAGCATTTACAGAAGGATCAAGG - Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
972498070 4:39652464-39652486 CTGGCTTTACAGACAGAGAAGGG - Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
977168650 4:93732032-93732054 CAGTCTTTACAGAGGAACCACGG - Intronic
978232785 4:106421067-106421089 CTGTCTTTGAAGACGGAGTAAGG + Intergenic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
980101937 4:128550564-128550586 AAGGCTTTACAGAAGCAGCAGGG + Intergenic
980718103 4:136654623-136654645 CAGTCTTTACAGAAGGCACTGGG - Intergenic
982911650 4:161149364-161149386 CTGTGTTTACTTAAGGTGCAAGG - Intergenic
984891542 4:184498610-184498632 CTGTCTTCTTGGAAGGAGCAGGG - Intergenic
985822989 5:2173057-2173079 CTGTATTTACAAAGGGCGCATGG + Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
987947632 5:24632498-24632520 TTTTGTTGACAGAAGGAGCATGG + Intronic
988092314 5:26560001-26560023 CTGGCTTTACACAGGAAGCATGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988768707 5:34409289-34409311 CTCTGCTTTCAGAAGGAGCAAGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990725811 5:58753631-58753653 CTGTCTTCACAGGAAGAGGAGGG + Intronic
992462152 5:76971284-76971306 GTACCTTTACAGAAGGAGAAAGG + Intronic
992850226 5:80799443-80799465 CTGTCTTTAAAGAAGAATTATGG - Intronic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993550788 5:89271207-89271229 CTGTCTGTAGAAAATGAGCAGGG - Intergenic
994127641 5:96186854-96186876 CTGGCTTTACAGAATGAGTTAGG + Intergenic
994129408 5:96207801-96207823 CTGGCTTTATAGAATGAGCTGGG + Intergenic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
994987493 5:106955948-106955970 CTTTGTTTAGAAAAGGAGCATGG - Intergenic
995646911 5:114323123-114323145 CTCTTTTTCCAGGAGGAGCATGG - Intergenic
995664307 5:114523965-114523987 CTGACTTTTTAGATGGAGCATGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
998065752 5:139156977-139156999 CTGTGTATAGAAAAGGAGCAAGG - Intronic
999880648 5:155860025-155860047 CTGTATTTACAGCAGGAGAGGGG - Intergenic
1000222043 5:159223634-159223656 GTGTGTTTACAGAAGGCGAAAGG - Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1003120291 6:3313866-3313888 CTGTCTCTACAGAATTAGCTGGG + Intronic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1005451049 6:25972738-25972760 TAGTCCTTACAGAGGGAGCATGG + Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006677027 6:35771758-35771780 CTGTCCTCACAGACAGAGCAGGG + Intergenic
1007216064 6:40239188-40239210 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1007995623 6:46304819-46304841 CTGTCTTTAACGAAAGAGCATGG - Intronic
1009325355 6:62342359-62342381 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1010853526 6:80808416-80808438 CTGTCTTAGCAGACAGAGCAAGG - Intergenic
1010988766 6:82455889-82455911 CTGTCTTTGTAGAATGAGCTAGG + Intergenic
1012530914 6:100235288-100235310 CTCTCTTTACAAAAGGAAGAGGG + Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1014291461 6:119563312-119563334 CTGTCTTTAAAGATGGTGCATGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016725277 6:147358029-147358051 CTGTCATTACAGACAGAGCTGGG + Intronic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017413942 6:154199922-154199944 CTCTCTTTAGATAAGGAGGAAGG + Exonic
1018061524 6:160093311-160093333 CTGTCATTAGCCAAGGAGCAAGG + Intronic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019739533 7:2665836-2665858 CCGTCCTTCCAGAAGCAGCATGG + Intergenic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1022898043 7:34772830-34772852 CTGTTTTTACACAATGAGAAAGG - Intronic
1023535413 7:41203559-41203581 CTGTGTCTACATAAGGGGCAAGG + Intergenic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1024220797 7:47284945-47284967 CTGACTTTTCAGAACCAGCAAGG + Intronic
1025195104 7:56926529-56926551 CAGGCTTTACAGAATAAGCATGG - Intergenic
1025676848 7:63650414-63650436 CAGGCTTTACAGAATAAGCATGG + Intergenic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029673392 7:102049443-102049465 CAGGCTTTACAGAATAAGCATGG - Intronic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1033289284 7:140069358-140069380 CTGACTTTACAGAAATAGAAAGG + Intergenic
1034234714 7:149557707-149557729 CTGTCTTTACTGCAGGAAAAAGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038032474 8:23654668-23654690 TCGTCTTCACGGAAGGAGCAGGG - Intergenic
1039939813 8:42080405-42080427 GTGTCTTTACAAAAGAAGGAAGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1044244399 8:89925269-89925291 CTGTCTTTTCTGAAGGATCAAGG + Exonic
1045000048 8:97870600-97870622 TTGTCTTTGCAGAAATAGCAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046109918 8:109710280-109710302 CAGTCTTGACAGGATGAGCAGGG - Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047796907 8:128267025-128267047 CTGTTTTTTCATAAGGATCAGGG - Intergenic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1048923007 8:139247578-139247600 GTGTCTGTACAGAGGGAGAAAGG + Intergenic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1051455270 9:17248241-17248263 CTGTCCTTACAGAATGAGTTAGG + Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1056859385 9:90165769-90165791 CTTTCTTTACAGCAGGATCCTGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059438708 9:114290798-114290820 CTTTCTTAACAGGGGGAGCAGGG + Exonic
1059493930 9:114693942-114693964 CTATCTATACAGTGGGAGCAAGG - Intergenic
1060442971 9:123658798-123658820 CTGTCCTTAGAGAAGGAGAGAGG + Intronic
1060779771 9:126402878-126402900 GGTTCTTTACACAAGGAGCACGG + Intronic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1203466112 Un_GL000220v1:89029-89051 CTGTCTTTACATAATGATTAAGG + Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186826702 X:13347395-13347417 TTGCCTTTACAGAAGGAGCCAGG + Intergenic
1188619966 X:32208395-32208417 CCTTCTTTACAAAAGGAGCCAGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189194806 X:39143854-39143876 CTGTGTTTGCAGTGGGAGCATGG + Intergenic
1195918982 X:109963752-109963774 CCATCTGAACAGAAGGAGCAGGG - Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197034917 X:121861593-121861615 CTGGCTTTACAGAATGAGCTGGG - Intergenic
1198740194 X:139834084-139834106 CTGGCTCTACAGAAGAGGCACGG + Intronic
1199249552 X:145644548-145644570 CTGTCTTGAAAGAAAGAGCAAGG + Intergenic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200778042 Y:7187300-7187322 CTCTCTTTACAGCAGCAGTAGGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201975446 Y:19843735-19843757 CACTGTTTACAGAAAGAGCATGG + Intergenic