ID: 925121990

View in Genome Browser
Species Human (GRCh38)
Location 2:1426725-1426747
Sequence TAGATCATCAGGAAACATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925121986_925121990 12 Left 925121986 2:1426690-1426712 CCTGAAGAAGGCACTTCATTTAG 0: 1
1: 0
2: 0
3: 22
4: 164
Right 925121990 2:1426725-1426747 TAGATCATCAGGAAACATGATGG 0: 1
1: 0
2: 2
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925121990 Original CRISPR TAGATCATCAGGAAACATGA TGG Intronic
907145009 1:52223684-52223706 TAAATGCTCAGGAAACATTAGGG + Intronic
908527000 1:64997856-64997878 TCCATCAGCAGGAAACAAGAGGG - Intergenic
912173676 1:107132141-107132163 TCTATCATCCAGAAACATGAAGG + Intergenic
912768938 1:112444581-112444603 TACATTGTCAGAAAACATGATGG - Intronic
914358619 1:146910581-146910603 TGGCTCATCAGGGAACATGGAGG + Intergenic
916952695 1:169796729-169796751 TAGATCACCTGGAACCTTGAAGG - Intronic
917811309 1:178661029-178661051 TAGTGCATCAGAAAACAGGAGGG - Intergenic
918762311 1:188427026-188427048 TTGATCAAGAGGAAAAATGAAGG + Intergenic
919855958 1:201706311-201706333 TAAATGATCTGGAAACAAGAAGG - Intronic
922962871 1:229663298-229663320 AATATCAGCAGGAAACAAGAGGG - Intergenic
923206821 1:231767282-231767304 AAGATCTTCAAGAAATATGATGG + Intronic
924525591 1:244844955-244844977 TAGATTATATGGAAATATGAGGG - Exonic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1065933760 10:30502151-30502173 TAAAACATTAAGAAACATGATGG - Intergenic
1066512872 10:36121072-36121094 AAGATCCTAAGGACACATGAGGG + Intergenic
1067775495 10:49161992-49162014 AAGTTCATGAGAAAACATGAAGG - Intronic
1071056250 10:81511539-81511561 TACATAATCAAGAAACGTGAAGG - Intergenic
1071060099 10:81559828-81559850 TATATCATCAGTAAACATAAAGG - Intergenic
1073668930 10:105565363-105565385 TAAAACATCAGGGAACCTGATGG - Intergenic
1078500313 11:11867378-11867400 TAGAGCATTAAGAGACATGAAGG - Intronic
1078962570 11:16295491-16295513 TATATCTACAGGAAAGATGAGGG - Intronic
1079388554 11:20001590-20001612 TAGGTCTTCAGTAAACATCAGGG + Intronic
1079883259 11:25952976-25952998 CAGATCAGGAGGAAACCTGAGGG - Intergenic
1081468378 11:43346288-43346310 GAGATCACCTGGACACATGAAGG - Intergenic
1086814141 11:91347526-91347548 TAGATCATCAGGCAGCATTAAGG - Intergenic
1088435987 11:109813611-109813633 TAGATCATCTGGAAAGATGAAGG - Intergenic
1088575111 11:111264135-111264157 GTGACCATCAGTAAACATGAGGG + Intronic
1091287832 11:134418157-134418179 TAGATATTGAGAAAACATGATGG + Intergenic
1095553898 12:43476796-43476818 GAGATCAGCTGGACACATGAAGG + Intronic
1100424818 12:94474681-94474703 TAGATCAACAGGAAGCAGAAGGG - Intergenic
1101743814 12:107522669-107522691 TAGGCCCTCAGGAAACATAAAGG + Intronic
1104405899 12:128516433-128516455 AAGAACATCAGGACACAGGATGG + Intronic
1104739464 12:131162529-131162551 CATATGATCAGGAAACATGCAGG - Intergenic
1105059257 12:133133565-133133587 TCTATCATCCGTAAACATGAAGG - Intronic
1106414403 13:29534364-29534386 TAAATCCTCTGGAAACATAACGG + Intronic
1106745793 13:32705140-32705162 AAGATCATCAGAGAACAAGATGG - Intronic
1107890692 13:44911680-44911702 TAGAACATCATCAAACCTGAGGG + Intergenic
1108327047 13:49344017-49344039 CAGGTCATCAGGAAACTTTATGG - Intronic
1109234178 13:59794987-59795009 TAGGTCATTAGGAAACAAAATGG + Intronic
1109983982 13:69951334-69951356 TACATCATCAGGAAACTAGAAGG + Intronic
1113046235 13:106158348-106158370 TCAATGATCAGGAAACACGAGGG + Intergenic
1114902188 14:27076611-27076633 TAGTTCATCATGAAAAATGTGGG + Intergenic
1115136137 14:30110216-30110238 AAGACCATAAAGAAACATGACGG - Intronic
1115201549 14:30859319-30859341 TATATAATTATGAAACATGACGG - Intergenic
1116024495 14:39498379-39498401 TAGATTGTCAGGAACCCTGAAGG + Intergenic
1117582933 14:57171235-57171257 TATATCCTCATGAAAAATGATGG - Intergenic
1117644707 14:57839532-57839554 GAGAACATAAGGACACATGAGGG + Intronic
1117871849 14:60209431-60209453 GAGATCATCAGGAATTAGGAGGG - Intergenic
1118953114 14:70452915-70452937 GAGATGATCTGGAACCATGAGGG + Intronic
1119144393 14:72297614-72297636 GAGATCACCTGGACACATGAAGG - Intronic
1119176934 14:72575297-72575319 TAGGTCATCAGGGAACATTGAGG + Intergenic
1120532523 14:85649402-85649424 AAGATAATCAGGAACCAAGATGG + Exonic
1123784839 15:23660829-23660851 GAGACAATCAGGGAACATGAAGG - Intergenic
1124015341 15:25869193-25869215 TAGCTCATCAGGTAACCTTAAGG - Intergenic
1126222191 15:46226822-46226844 AAGATCATCAGGAAATTTTATGG - Intergenic
1126243911 15:46480616-46480638 TAGATCATCAGAAAACAGACTGG - Intergenic
1129151286 15:73689460-73689482 CAGATTATCAGGAAAAAGGAAGG + Intronic
1130835378 15:87645001-87645023 TGAATCATCATGAAACAAGAGGG - Intergenic
1131216145 15:90537096-90537118 TTCATCATCTGTAAACATGAAGG + Intronic
1132412885 15:101598243-101598265 TAGAACATCAGGAAAGAAGAAGG - Intergenic
1144048123 17:11471399-11471421 CAGAGCATCAGGAAACTTGGGGG + Intronic
1145406126 17:22596621-22596643 AAGGTCATCTGGAAACATCAAGG + Intergenic
1151299825 17:73216018-73216040 TAGATTATCAAGAGCCATGAGGG + Intronic
1153008773 18:519196-519218 CAGATCATCAGAGAACAGGAGGG - Intergenic
1155068194 18:22287016-22287038 GAGATCATTAGAAAACATGACGG - Intergenic
1155232708 18:23790184-23790206 TAGGACATCAAGAAGCATGAGGG + Intronic
1155994636 18:32317610-32317632 TAAATAACCAGCAAACATGAAGG + Intronic
1156239540 18:35240049-35240071 TAAATGGTCAGTAAACATGAAGG + Intergenic
1156865229 18:41881522-41881544 TATGTCATCATGAAAAATGATGG - Intergenic
1158070556 18:53465417-53465439 TTTCTCATCAGGAATCATGAAGG - Intronic
1158184512 18:54756190-54756212 AAAATCAACAGGAAAGATGAAGG + Intronic
1159590444 18:70329055-70329077 TATTTCATCACGAAATATGATGG + Exonic
1163805803 19:19396561-19396583 AAGTGCCTCAGGAAACATGATGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165282411 19:34808676-34808698 TTGAACATTAGGAAACATTAGGG + Intergenic
1167342181 19:48922441-48922463 TGGAGCATCAGGAATCCTGAGGG - Exonic
1167687019 19:50962763-50962785 TAGATCAGCAGGATCCATGAAGG - Intronic
1167769790 19:51507998-51508020 GAGTTCACCAGGAAGCATGAAGG + Intergenic
925121990 2:1426725-1426747 TAGATCATCAGGAAACATGATGG + Intronic
926868445 2:17385934-17385956 AATTTCATCAGTAAACATGATGG - Intergenic
928208827 2:29308358-29308380 TAGAACATTAGGAAAAATGCAGG - Intronic
929919577 2:46162608-46162630 TAGAACATCTGGAAAAAGGAAGG + Intronic
932034639 2:68230616-68230638 TGGAACATCAGGAAAGAGGAAGG - Intronic
933345476 2:81079818-81079840 TTTCTCATCAGAAAACATGAAGG + Intergenic
933550925 2:83774122-83774144 GAGATCACCTGGACACATGAAGG + Intergenic
935442060 2:103110536-103110558 TAGACCATTAGAAAGCATGAAGG - Intergenic
935542402 2:104364307-104364329 TAGAGGATCAGGAAAAATAATGG + Intergenic
936900718 2:117479293-117479315 AAGAGCATCAGGTAACATAAAGG - Intergenic
938094179 2:128450967-128450989 TAGATCATCAGGAAATATTATGG - Intergenic
940423002 2:153500312-153500334 TAGATCAAAATGAAACAAGAGGG + Intergenic
941164249 2:162068464-162068486 GAGATCATTGGGAACCATGATGG - Intronic
941433599 2:165440685-165440707 TAGATCAGCAGTAAATGTGAAGG + Intergenic
942811508 2:180005809-180005831 TTCATCATCTGGAAACATGTAGG - Intronic
943969180 2:194381326-194381348 TGGATCATCTGAAAACATCAGGG - Intergenic
945398367 2:209349443-209349465 TAGATGATCAGGAAACTGGCTGG - Intergenic
946701890 2:222423451-222423473 TGGACAATCAGGAAACATGCAGG + Intergenic
947295234 2:228623656-228623678 AAGATCATGAGGGAACAGGAAGG + Intergenic
947318857 2:228895134-228895156 GACATCAATAGGAAACATGAAGG - Intronic
1169014505 20:2280642-2280664 CAGATGCTCAGGAAACATGCTGG + Intergenic
1171273383 20:23834173-23834195 GAAATAAACAGGAAACATGATGG - Intergenic
1171385682 20:24768066-24768088 CAGGCCATCAGGCAACATGAGGG - Intergenic
1172037952 20:32023268-32023290 GAGATCATCATGAAAACTGATGG - Intronic
1173316532 20:41949959-41949981 TAAATTATCAGAAAACAAGAGGG - Intergenic
1173397367 20:42691888-42691910 GAGAACATGAGGAAACAGGAAGG + Intronic
1173536703 20:43820282-43820304 GAGATCACCTGGACACATGAAGG + Intergenic
1173919644 20:46734029-46734051 TAGATCCTCAGGAACCTTCAGGG - Exonic
1176845982 21:13877044-13877066 CAGACCATAAGGAAACATAATGG + Intergenic
1176848718 21:13896588-13896610 CAGACCATAAGGAAACATAATGG + Intergenic
1180520036 22:16189527-16189549 GAGATCACAAGGAAACAGGAAGG + Intergenic
1181543366 22:23586517-23586539 AACCTCATCAGGGAACATGAGGG - Intergenic
1183367780 22:37416436-37416458 CAGGTCCTCAGCAAACATGACGG + Intronic
1185316135 22:50179887-50179909 TTTATCATCAGGAGACAGGATGG + Exonic
949894860 3:8761472-8761494 TAGATCATCGGGAAAACTGCTGG + Intronic
951445691 3:22777548-22777570 CACACCATCAGGAACCATGATGG + Intergenic
951785163 3:26410525-26410547 TATTTCATCAGGGAAAATGAAGG + Intergenic
952075568 3:29692655-29692677 TGGATCATGAGGATAAATGATGG - Intronic
953496520 3:43392107-43392129 TAAATAATCAGGAGACAGGAGGG - Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954902108 3:54028757-54028779 AAGATAATCATGAAATATGAGGG - Intergenic
955790158 3:62580670-62580692 TATCTCATCAGGAACAATGAAGG + Intronic
956999197 3:74864876-74864898 TGGATCATCAGCTAACATTAGGG - Intergenic
957852938 3:85833781-85833803 ATCATCATCAGAAAACATGATGG + Intronic
958471668 3:94528768-94528790 TAGACCATAAAGAACCATGAGGG + Intergenic
959102648 3:102030457-102030479 AAGATCATGAGGAAACATTTTGG + Intergenic
959209280 3:103356259-103356281 CAGATCCTCAGCCAACATGATGG - Intergenic
959474265 3:106790374-106790396 GAGGCCATCAGTAAACATGAAGG + Intergenic
959845201 3:111024536-111024558 GAGATCACCTGGACACATGAAGG + Intergenic
960412399 3:117343355-117343377 TGGATAATCAGGAAAAAGGAAGG + Intergenic
960546453 3:118920061-118920083 GAGATCACCTGGACACATGAAGG + Intronic
961727381 3:128941079-128941101 TAGAACTTCAGGAAACATTAAGG - Intronic
962584825 3:136831607-136831629 TAGGTCACCAGGAAAGTTGAAGG + Intronic
963446662 3:145419084-145419106 TAGAGCATCAAGATACATGACGG - Intergenic
963781747 3:149493559-149493581 TGGAGCATTAGGAAAGATGATGG + Intronic
964244732 3:154638273-154638295 TAGGTCATCAGGAGACCTTAGGG + Intergenic
965243553 3:166234253-166234275 AACATCATCAGTAAAAATGATGG + Intergenic
965845648 3:172958346-172958368 TAGCCCTTCAGGAAAAATGAAGG + Intronic
966798376 3:183738592-183738614 GAGATCACCTGGACACATGAAGG - Intronic
967947076 3:194812461-194812483 GAGATCATGAGGAAAGATGCAGG + Intergenic
971849581 4:31966953-31966975 GAGATCACCTGGACACATGAAGG - Intergenic
974830511 4:67182851-67182873 GAGATCACCTGGACACATGAAGG + Intergenic
975392164 4:73833151-73833173 AAGGTCATCAGTAAACATGACGG - Intergenic
975406911 4:74000084-74000106 AAGGTAATCAGTAAACATGATGG + Intergenic
975932704 4:79545013-79545035 TAGAACATCAGGAATAAAGAAGG - Intergenic
976054590 4:81048643-81048665 TAGATCACTGAGAAACATGATGG - Intronic
976193850 4:82514412-82514434 AAGACCATCAGGAACCATGTTGG + Intronic
976204175 4:82609078-82609100 TTGATCCTCAGGGCACATGAAGG - Intergenic
976793422 4:88905985-88906007 GAGAGCATCAAGAAACATGCTGG + Intronic
979529778 4:121757532-121757554 TTGCTTATCATGAAACATGAGGG + Intergenic
979598195 4:122557453-122557475 TAGATCAGCAGGAAAAAAAAAGG + Intergenic
979751257 4:124281886-124281908 GAGATCACCTGGACACATGAAGG + Intergenic
980225730 4:129982343-129982365 TAGATCATCAGGATAAAATAGGG + Intergenic
981292100 4:143088320-143088342 TAGAGGATCCTGAAACATGAGGG - Intergenic
982484967 4:155955471-155955493 TAGGTCATCAGGACACATCATGG + Intergenic
983118044 4:163844097-163844119 GAGAGGATCAGGAAAAATGATGG - Intronic
983602353 4:169545243-169545265 GAGATCACCTGGACACATGAAGG - Intronic
985209963 4:187582120-187582142 TTGATCATCATAAAAAATGAAGG - Intergenic
985334746 4:188879766-188879788 TATATCATCTAGAAACAAGAAGG + Intergenic
987999816 5:25333658-25333680 TAGAGCTGCAAGAAACATGAGGG - Intergenic
988991702 5:36677827-36677849 TAGGCCATCAGGAAAACTGAGGG + Intronic
990487712 5:56275767-56275789 AATTTCATCAGTAAACATGATGG + Intergenic
991193106 5:63898883-63898905 TAGAACAGCAGGAAAGAAGAAGG + Intergenic
991663261 5:68971239-68971261 TAGACCACCAGAATACATGATGG + Intergenic
992133021 5:73713946-73713968 TTTATCATCAGGGAAAATGAAGG + Intronic
992536530 5:77710616-77710638 GTTTTCATCAGGAAACATGAGGG + Intronic
993006829 5:82437548-82437570 AAGAGCATCAGGAAAAATGCTGG - Intergenic
993565929 5:89475391-89475413 CAGATCATGAGGCAACATTAAGG + Intergenic
994522707 5:100861692-100861714 TTGATCATCAGTAACCATGTGGG + Intronic
994850121 5:105044084-105044106 TAGATTATCAAGAACTATGAAGG - Intergenic
995578330 5:113566628-113566650 TTGAACATAAGGAAATATGAAGG + Intronic
996165563 5:120218252-120218274 TAGATCCTCAAGAAACATTCAGG + Intergenic
996689836 5:126328579-126328601 TATATCATATGGAAACTTGAAGG - Intergenic
996807838 5:127477742-127477764 GAGATCACCTGGACACATGAAGG + Intergenic
999922587 5:156338111-156338133 AAGATCATTAGGAAACTTGATGG + Intronic
1009539052 6:64927017-64927039 TAGGACATTGGGAAACATGATGG + Intronic
1010567576 6:77434806-77434828 TAGATCTTGAGGAAATATCATGG - Intergenic
1011264698 6:85503127-85503149 GAGAGCATCAGGAAAAATAAAGG + Intergenic
1011793384 6:90925103-90925125 TTGATCATCAGGAAAGACTAAGG - Intergenic
1012138631 6:95592163-95592185 GAGATAATCAGGAAACTTCAAGG - Intronic
1012216886 6:96598019-96598041 TATATGTTCAGGAAACATAAAGG + Intronic
1012595836 6:101038046-101038068 TAAATCATCTGTAAATATGATGG + Intergenic
1017541886 6:155411725-155411747 TAGGTCATAAGTAAAGATGAAGG - Intronic
1018132997 6:160750138-160750160 GGGAACATCTGGAAACATGAAGG - Intronic
1018572710 6:165227490-165227512 TAGATCCTCAGGAAACAGCTGGG - Intergenic
1021422262 7:20459167-20459189 TAGATCTTCATGAATTATGATGG - Intergenic
1021537033 7:21716925-21716947 TTGAGCATCAGGAGACATTAAGG - Intronic
1022251846 7:28616005-28616027 TAAATTGTCAGGAAAAATGATGG - Intronic
1025726543 7:64067229-64067251 TAAAATGTCAGGAAACATGATGG + Intronic
1026249124 7:68651922-68651944 GAGATCACCTGGACACATGAAGG - Intergenic
1028364573 7:90012609-90012631 TAGAGCAACAGGAATAATGAAGG + Intergenic
1030965040 7:115981251-115981273 TACATCAACAGCAAAGATGACGG - Intronic
1032551881 7:132791910-132791932 GAGATCAGCAGGAAGCATGTAGG + Intronic
1035531353 8:354110-354132 CAGAGCATCCTGAAACATGAGGG - Intergenic
1037014860 8:13891196-13891218 TATATAATCAGAAAACATGAAGG - Intergenic
1040643706 8:49372072-49372094 TATCCCATCAGAAAACATGAAGG - Intergenic
1041779790 8:61564965-61564987 CAGATCATCAGTCAACATGGAGG - Intronic
1041840418 8:62264141-62264163 TAGTTCAGAAGGAAAAATGAGGG + Intronic
1043056675 8:75448234-75448256 GAGATCACCTGGACACATGAAGG + Intronic
1045984866 8:108238161-108238183 TAGATCTTCAGGTCACATGTAGG - Intronic
1046803680 8:118456512-118456534 TATATCATTAGGAAACATTATGG - Intronic
1047200124 8:122758315-122758337 GAGGTCATCAGGAAGCATGCCGG + Intergenic
1047523261 8:125611959-125611981 TAGATGATGAGGAAAAATGGAGG + Intergenic
1047569925 8:126086397-126086419 TTGATCATCAGGAAAGAAGATGG + Intergenic
1048381961 8:133873240-133873262 TAGATCATCAGGAAGGAGAATGG + Intergenic
1051440150 9:17074844-17074866 TAGTTCATCAGGAAACACTGTGG - Intergenic
1051949893 9:22619012-22619034 TGGGTCTTCAGGAAAAATGATGG + Intergenic
1055575252 9:77654834-77654856 TAATTCATCAGGAAAAAGGATGG - Intergenic
1055664059 9:78535723-78535745 GAGATCACCTGGACACATGAAGG + Intergenic
1055671043 9:78606462-78606484 AAGTTCATTAGGAAACAAGAAGG + Intergenic
1056601540 9:88050816-88050838 CAGGTCATCAGGACACATGGTGG - Intergenic
1057066889 9:92061543-92061565 TAGATTATCAGGAAGGAGGAAGG + Intronic
1058816933 9:108693105-108693127 AAGAACATCAGGAAAACTGACGG + Intergenic
1059163550 9:112057894-112057916 TAGATAATTAGGAAACATCATGG - Intronic
1185510548 X:660967-660989 TACATCTTAAGGAACCATGAGGG + Intergenic
1186106925 X:6217251-6217273 TATAACATCAGGATACATGTTGG + Intronic
1188253394 X:27928167-27928189 GAGATCACCTGGACACATGAAGG + Intergenic
1188520701 X:31034444-31034466 TAGTTGACTAGGAAACATGAAGG - Intergenic
1189482191 X:41400587-41400609 TATATCATGTGGAAGCATGAGGG - Intergenic
1192833188 X:74772089-74772111 GAGATCAACAGAAAAGATGAAGG - Intronic
1193356808 X:80528944-80528966 TAGATCAACAGGAGACAGGAGGG + Intergenic
1195074674 X:101315161-101315183 TAGATCAGCAGCAGCCATGAAGG + Intergenic
1195486483 X:105413601-105413623 TAGCTCATCAGGACTCATGCTGG + Intronic
1201857106 Y:18556842-18556864 GAGATCTTCTGGAAACATGGAGG - Intronic
1201876215 Y:18763538-18763560 GAGATCTTCTGGAAACATGGAGG + Intronic