ID: 925122944

View in Genome Browser
Species Human (GRCh38)
Location 2:1433074-1433096
Sequence CAGTCTCCTGTTTCATTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925122944 Original CRISPR CAGTCTCCTGTTTCATTAGC TGG Intronic
901515162 1:9740393-9740415 CTGGCTCCTGATTCATCAGCTGG + Intronic
902372348 1:16014526-16014548 CAATCTCCATTTTCATTAACGGG - Exonic
905475207 1:38221491-38221513 CAGTCTCCTGGTTCATTAGGAGG - Intergenic
905936181 1:41826115-41826137 CAGTCTCCTCTCTCATAAGTGGG + Intronic
907488054 1:54790641-54790663 CAGTCTCCTTTTTCCTTCCCAGG - Intronic
907834247 1:58093959-58093981 CAGGCTCCTGCATTATTAGCTGG + Intronic
908535487 1:65072869-65072891 CAGTCTCTTCTTTCCTTTGCAGG + Intergenic
908766839 1:67561885-67561907 GAGTCTTCTGTTTCATTTGCTGG + Intergenic
913690340 1:121273827-121273849 AAGTCTCATGCTTCAGTAGCAGG + Intronic
914147203 1:145006132-145006154 AAGTCTCATGCTTCAGTAGCAGG - Intronic
915720212 1:157979053-157979075 CAGTCTCCCATTTCATTAACTGG - Intergenic
915964200 1:160292291-160292313 CTGTCTCCTGTTAAAGTAGCTGG + Intronic
918109915 1:181446422-181446444 CAGACTGCTGTTTCATTACAGGG + Intronic
920477660 1:206292315-206292337 AAGTCTCATGCTTCAGTAGCAGG + Intronic
923758742 1:236819656-236819678 CATCCTCCTCTTTCATTTGCAGG - Intronic
1063570394 10:7210187-7210209 CAGTCACCTGTGTCATCGGCTGG - Intronic
1064705686 10:18070114-18070136 GACTCTCCTGTTTCAGTAGCAGG + Intergenic
1066637040 10:37514047-37514069 CATTCTCCTGCCTCAGTAGCTGG + Intergenic
1067763231 10:49065660-49065682 CAGTCTCTTGATGCATTACCTGG - Intronic
1067947108 10:50696534-50696556 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1070882420 10:79861524-79861546 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1071430989 10:85606726-85606748 CTGTCTCCTCTTTCCTTGGCTGG - Intronic
1071648990 10:87377835-87377857 CAGCCTCCTTTCTCATTAGGTGG - Intergenic
1071829276 10:89355675-89355697 CCGCATCCTGTTTCATCAGCTGG - Intronic
1071878709 10:89871148-89871170 CATTCTCCTGCTTAATGAGCTGG - Intergenic
1072628096 10:97127178-97127200 CATTCTCCTGCCTCAGTAGCTGG - Intronic
1073796977 10:106999393-106999415 CTGTGTCCTGTTTCATTAACAGG + Intronic
1073840210 10:107490248-107490270 TTGTCTCCTGTTTGATTAGCAGG + Intergenic
1074123199 10:110508506-110508528 CAGTCTCTCCTTCCATTAGCAGG - Intronic
1074650156 10:115513157-115513179 CAGTTTCCAGTTTTATTAGAAGG + Intronic
1075933066 10:126315646-126315668 CAGCCTGCTGTTTCATTGGCAGG - Intronic
1076561046 10:131364061-131364083 AAGTCTCCAGTGTCATTAGGCGG + Intergenic
1076822814 10:132948874-132948896 CCGTCTTTTGTTTCATTTGCAGG + Intergenic
1079062900 11:17265036-17265058 CAATCTCCTCTTTCATTTGGTGG - Intronic
1079887647 11:26007642-26007664 AAGTTTCCTGTTTCCTTTGCTGG - Intergenic
1081144921 11:39551050-39551072 AATTCTCCTGTGTCAGTAGCTGG - Intergenic
1083313775 11:61801625-61801647 CATTCTCCAGTTTCAGAAGCAGG - Exonic
1085204987 11:74726268-74726290 CAGTCCCCTGTTTCCTTTGTGGG + Intronic
1087774730 11:102246844-102246866 GATTCTCCTGTCTCAGTAGCTGG - Intergenic
1088262902 11:107961056-107961078 CAGTCTCCTGTTTCTTGAATAGG + Intronic
1088719838 11:112582597-112582619 CAGTCTCCTGTTTTAGTCACTGG + Intergenic
1089263339 11:117238707-117238729 CAGAATCCTGGTTCATCAGCAGG + Exonic
1090458159 11:126867259-126867281 AATTCTCCCGTTTCAATAGCAGG + Intronic
1090602796 11:128390197-128390219 CAGTCTTCTGTATCATTTTCAGG - Intergenic
1091069806 11:132552332-132552354 CAGTGTCCTGTTTCCTTCTCCGG - Intronic
1091847702 12:3669985-3670007 CTGTCTAATGTTTCATTTGCAGG + Intronic
1093712264 12:22340398-22340420 AACTCTCCTGTTTCATCATCAGG + Intronic
1093783794 12:23169123-23169145 CAGTTTCCTGTTGCATTATGTGG + Intergenic
1093940876 12:25052546-25052568 GAGTCGCCTCTTTCATCAGCAGG - Exonic
1100521277 12:95378507-95378529 CATTCTCCTGCCTCAGTAGCTGG + Intronic
1100597549 12:96084672-96084694 CTTTCTTCTGTTTCATTGGCAGG - Intergenic
1101633499 12:106518068-106518090 CAGCCTCCTGTTTCATTGTCTGG - Intronic
1101975141 12:109351064-109351086 CATTCTCATGTTCCATTAGTAGG + Intronic
1102667582 12:114588754-114588776 CTGTCTCCTGTTTCTTTTTCAGG - Intergenic
1106052392 13:26203845-26203867 CATTCTCCTGCCTCAGTAGCTGG - Intronic
1106247029 13:27959288-27959310 GAGTCTCCTGTCTCAGCAGCAGG - Intergenic
1106941048 13:34779528-34779550 CGGTGTCCTGTTTCTTAAGCAGG + Intergenic
1108459347 13:50649617-50649639 CTGCCTCCTGTTTCATCAGTAGG + Intronic
1108694097 13:52887526-52887548 CTGAATCCTGTTTTATTAGCAGG + Intergenic
1110177782 13:72578107-72578129 CAGCCTCCTGACTGATTAGCTGG - Intergenic
1110396897 13:75040683-75040705 CTGCATCCTGTTTTATTAGCAGG + Intergenic
1114502757 14:23183321-23183343 CAGTCTCCTGTTTTATTAGGGGG - Exonic
1117201366 14:53393360-53393382 CATTCTCCTGCCTCAGTAGCTGG - Intergenic
1118289493 14:64506228-64506250 CAGTTTCCTGTTTCTTTAAGAGG - Intronic
1120733905 14:88032391-88032413 CAGTCTCCTTTTCAATTAGTGGG + Intergenic
1121635348 14:95450220-95450242 CCTTCTCCTGTTTCAGTTGCTGG + Intronic
1122205009 14:100144024-100144046 AAGTCACCTGCTTCATTAGACGG + Exonic
1122365730 14:101193914-101193936 CAGTTTCTTGTTTCATTCTCAGG + Intergenic
1123036027 14:105472302-105472324 CAGGCTGCTGTCTCATCAGCAGG - Intergenic
1125095224 15:35842710-35842732 GAGTTTTCTTTTTCATTAGCTGG - Intergenic
1126272437 15:46835959-46835981 CTGTCTTCTGTTTAATTAGCTGG - Intergenic
1126734957 15:51721672-51721694 CAGTTTCCTGTTTCATAAAACGG - Intergenic
1130543503 15:84838958-84838980 CAGTCTCCTGCTTCTTTCTCAGG + Exonic
1130642482 15:85691678-85691700 CAGTCTCATGTCTCATTTGCTGG + Intronic
1132069091 15:98759795-98759817 CAGACACCTCTTTCATTAGCAGG - Intronic
1134387515 16:13787594-13787616 CAATGTTCTGTTTCATGAGCTGG + Intergenic
1135322838 16:21508375-21508397 CAGCCTCCTGCCTCAGTAGCTGG + Intergenic
1136334323 16:29601560-29601582 CAGCCTCCTGCCTCAGTAGCTGG + Intergenic
1137929346 16:52572053-52572075 CAGCCTCCTGTCTGAATAGCTGG + Intergenic
1138430088 16:56963002-56963024 CAGTCTCGTGGTTCACTAGAGGG - Exonic
1139261913 16:65602260-65602282 CAATTTCCTCTTTCATTAACTGG + Intergenic
1140554847 16:75910009-75910031 CAGCCTGCTGTTTCTTTTGCAGG - Intergenic
1142035032 16:87857395-87857417 CAGCCTCCTGCCTCAGTAGCTGG + Intronic
1142731550 17:1862003-1862025 CATTCTCCTGCTTGAGTAGCTGG + Intronic
1142891262 17:2944986-2945008 CATTCTCCTGCCTCAGTAGCTGG + Intronic
1143742415 17:8964443-8964465 CAGTCTCCTGATTCATAAAATGG - Intronic
1144091111 17:11857397-11857419 CCATCTCCTGTGTTATTAGCAGG - Intronic
1144235265 17:13254757-13254779 CAGTTTTCTGTTTCAGTATCAGG - Intergenic
1146148321 17:30442435-30442457 TAGTCACCTGTTTCATAAACTGG - Exonic
1146631340 17:34472097-34472119 CTGTCTCCTCTTTCCTCAGCTGG + Intergenic
1147416591 17:40295744-40295766 CAGTTTACTTTTCCATTAGCTGG + Intronic
1147814950 17:43202727-43202749 CAGTCTCTTTTTTCAGAAGCAGG + Intronic
1150611202 17:66734587-66734609 CTGTATCCTGTTTTATCAGCAGG + Intronic
1152212804 17:79011784-79011806 CTGCATCCTGTTTCATCAGCAGG - Intergenic
1157678968 18:49588794-49588816 CAGTCTCCTTCCTCCTTAGCAGG - Intronic
1157873998 18:51254870-51254892 CAGCCTCCTGACTCAGTAGCTGG + Intergenic
1158311624 18:56165739-56165761 CACTCTCCTGTTTGCTCAGCTGG - Intergenic
1161797648 19:6396460-6396482 GAGCCTCCTGTCTCAGTAGCTGG - Intergenic
1162559085 19:11405635-11405657 CAGCCTCCTGCCTCAGTAGCTGG + Intronic
1163207654 19:15815375-15815397 CAGTGTGCTGTTTGCTTAGCAGG - Intergenic
1163272234 19:16261240-16261262 GAGTGTCCTGTTTCTTGAGCTGG + Intergenic
1163357169 19:16821381-16821403 CAGAATCCTGTTTTATCAGCAGG - Intergenic
1165737962 19:38189237-38189259 CAGTCTCCTATCTTAGTAGCTGG + Intronic
1166196769 19:41211483-41211505 CACTCTCCTGCCTCAGTAGCTGG - Intergenic
1166598645 19:44073660-44073682 CAGCCTCCTGTGTGAGTAGCTGG + Intronic
1167480607 19:49728432-49728454 CTGTCTCCTGTGTTATCAGCAGG - Intergenic
1168271749 19:55253809-55253831 CACTCTCCTGCTCCATTCGCAGG - Intronic
925122944 2:1433074-1433096 CAGTCTCCTGTTTCATTAGCTGG + Intronic
925383160 2:3442446-3442468 CAGTCCCCTGTGTCATTATGCGG + Intronic
928544392 2:32315632-32315654 CACTCTCCTGCCTCAGTAGCTGG - Exonic
928557097 2:32438412-32438434 CAGTCTATTGTTGCATTACCAGG - Intronic
933504783 2:83163038-83163060 CAGTCTCCTTTATGATTAACAGG + Intergenic
938366159 2:130736183-130736205 CATTCTCCTGCCTCAGTAGCTGG - Intergenic
939571745 2:143848155-143848177 CAGCCTCCTGATACGTTAGCAGG + Intergenic
940024498 2:149191913-149191935 CAGTGTCCTTTTTCCTTTGCTGG - Intronic
945070584 2:205984983-205985005 CATACTCCTGTTTAATTAACAGG - Intergenic
945262776 2:207860118-207860140 CAGCCTCCAGTTTCCTGAGCAGG - Intronic
946039623 2:216772705-216772727 CAGTCTCCTCTTTCATAAAGTGG - Intergenic
946444285 2:219724912-219724934 CAGCCTCCTGTTTATTTATCTGG - Intergenic
947251470 2:228109850-228109872 GATTCTCCTGTCTCAGTAGCTGG - Intronic
1169192050 20:3664064-3664086 CAGTCTACAGTTTCGTTAACAGG - Intergenic
1173155089 20:40601854-40601876 CATTCTCCTGTCTTAGTAGCTGG - Intergenic
1174521128 20:51131625-51131647 CATCCTCCTCTTTCATTTGCAGG + Intergenic
1174988428 20:55481952-55481974 CATTCTCCTGCCTCATTGGCTGG - Intergenic
1177629657 21:23710328-23710350 TAGTCTCCCTTTTGATTAGCAGG - Intergenic
1178081429 21:29070363-29070385 CACTGTCCTGTCTAATTAGCGGG - Intronic
1178588027 21:33886091-33886113 CAGTCTCCTGAATGAATAGCTGG - Intronic
1178678199 21:34648750-34648772 CATTCTCCTGGTTCTTGAGCCGG + Intergenic
1180518829 22:16174901-16174923 CAGTCTCCTGTAGCATTCCCAGG - Intergenic
1180663257 22:17487584-17487606 CACTCTCCTGCCTCAGTAGCTGG - Intronic
1181568143 22:23751941-23751963 GATTCTCCTGTCTCAGTAGCTGG - Intergenic
1182115417 22:27753582-27753604 AAGGCTCCTGTTTCATGGGCAGG - Intronic
1182560634 22:31156260-31156282 CAGGCTCCTGGTGGATTAGCAGG - Intergenic
1184609386 22:45592915-45592937 CAGTCTCTTGATTCATCATCTGG + Intronic
950934627 3:16825901-16825923 TAGTCTGCTGCTTCATTAGATGG + Intronic
951797772 3:26560300-26560322 CATTCTCATCTTTCATTAGAAGG + Intergenic
953964724 3:47295363-47295385 CAGTGTCCTCTTGCATCAGCTGG + Intronic
954540144 3:51388106-51388128 CTGTATCCTCTTCCATTAGCTGG - Intronic
954873236 3:53783890-53783912 CAGTCTCCTGCTTCTTGACCAGG - Intronic
956340138 3:68213176-68213198 CAGTTTCCACTTACATTAGCTGG - Intronic
959320836 3:104873092-104873114 CTGTCTCCTTTCTCATTAGTTGG - Intergenic
959651798 3:108757526-108757548 CAGTCACCTGTTACCCTAGCTGG - Intergenic
963429630 3:145181845-145181867 AAGTCTCCTGGTTGAATAGCAGG + Intergenic
963565479 3:146923918-146923940 CAGTCTCCAATTTCATTACTAGG - Intergenic
963887660 3:150599909-150599931 CCGTATCCTGTTTTATCAGCTGG + Intronic
966035865 3:175413674-175413696 CAGCCTCCAGTTTCACTACCTGG + Intronic
966039982 3:175471367-175471389 CATTCTCCTGCCTCAGTAGCTGG - Intronic
969218322 4:5741287-5741309 CAGTCTCCTGTTTCAATGGATGG - Intronic
970331704 4:14993075-14993097 CAGTCTCTTGCTTCATTAGTTGG - Intergenic
974818783 4:67039730-67039752 CAGTCTCCTGGGGCATAAGCAGG + Intergenic
975730672 4:77334470-77334492 CGGTATCCTGTTTCAATTGCAGG + Intronic
978079115 4:104569938-104569960 CAGTGTCCTCTCTCATTTGCTGG - Intergenic
982463850 4:155705432-155705454 CATTCTCCTGCCTGATTAGCTGG - Intronic
984390443 4:179124445-179124467 CTGCATCCTGTTTTATTAGCAGG + Intergenic
984420814 4:179518657-179518679 CAGTCCCCACTTTCATAAGCAGG + Intergenic
985101020 4:186458746-186458768 CTGTGTCCTGTTTTATCAGCTGG + Intronic
985866254 5:2516694-2516716 CAGTCTCCTGATTCGATGGCAGG + Intergenic
985914895 5:2910015-2910037 TAGTCTCCTGCTTTATTAGTGGG + Intergenic
987323940 5:16795162-16795184 CAGTCTCCTGTCTCATTAAATGG + Intronic
988388482 5:30597523-30597545 CTGCATCCTGTTTTATTAGCAGG - Intergenic
990128709 5:52552136-52552158 CAGCCTACTCTTTCATTTGCTGG - Intergenic
991165938 5:63565561-63565583 CATTCTCCTATTTCATCATCGGG - Intergenic
992034941 5:72763783-72763805 TAGTGTCTTGTTTCAGTAGCTGG - Intergenic
992542498 5:77778727-77778749 CAGCATCCTGTTTTATCAGCAGG - Intronic
992966273 5:82004025-82004047 GATTCTCCTGTCTCAGTAGCTGG - Intronic
994094744 5:95838774-95838796 CAGTCACGTGTCTCAGTAGCAGG + Intergenic
995243585 5:109912685-109912707 GAGTCTCCTGTCTTATTTGCAGG + Intergenic
996658328 5:125968045-125968067 CAATCTCCTCTTTCATTGGCAGG + Intergenic
996988801 5:129602458-129602480 CAGTGTCTTCTTTTATTAGCAGG + Intronic
997194207 5:131966881-131966903 CAGCCCCCTGCTCCATTAGCAGG + Intronic
997647913 5:135493201-135493223 CAGTTTCCTGCTTCATTTCCAGG - Intergenic
999841555 5:155432948-155432970 CAGTCTCCTCATTCATAAGAAGG - Intergenic
1003670221 6:8150309-8150331 GACTCTCCTGGTTCATTAGTAGG + Intergenic
1004419926 6:15460126-15460148 CAGTTACCTGTTTCATTTGTTGG + Intronic
1005804923 6:29465557-29465579 CAGCATCCTGTTTTATCAGCAGG - Intergenic
1006915238 6:37589686-37589708 CAGGCCCCTGCTTCCTTAGCTGG - Intergenic
1008045205 6:46844770-46844792 CATTCTCCTGCTTCCTTTGCAGG + Intergenic
1008067900 6:47069986-47070008 CAGTATCATGTTCCTTTAGCAGG - Intergenic
1011992013 6:93533400-93533422 CATTCTCCTAATTCATTAGGTGG + Intergenic
1012909065 6:105099438-105099460 CAGTCTCCTGTTACGTTAAATGG - Exonic
1013911924 6:115285889-115285911 CATTCTCCTGCCTCAGTAGCTGG - Intergenic
1017787753 6:157770312-157770334 CAGTCTCCTGTCTCCATGGCTGG - Intronic
1018003854 6:159602555-159602577 TAGTCTCCTTTTTCATTTGCAGG - Intergenic
1019111404 6:169718853-169718875 TATTCTCCTGTTTCATCAGGTGG + Exonic
1019585646 7:1801107-1801129 CAGTCTCCTGTTTCCCAAGCTGG - Intergenic
1021301331 7:18976468-18976490 CAGTCTCTTGTCTCCTTTGCAGG - Intronic
1023137535 7:37067527-37067549 CAGTCATCTGTTTCATCATCAGG + Intronic
1023316624 7:38944349-38944371 CAGCCTCCTGCCTCAGTAGCTGG - Intergenic
1023731100 7:43193258-43193280 CTGCGTCCTGTTTCATCAGCAGG + Intronic
1025227291 7:57176876-57176898 GATTCTCCTGTCTCAGTAGCTGG + Intergenic
1026142752 7:67720294-67720316 CTGTGTCCTGTTTTATCAGCAGG - Intergenic
1026374831 7:69739945-69739967 CAGTCCTCTCCTTCATTAGCTGG - Intronic
1026917970 7:74133927-74133949 CAGCATCCTGTTTTATCAGCAGG - Intergenic
1028444710 7:90908370-90908392 GAGTGTACTGTTTAATTAGCTGG - Intronic
1030015651 7:105217890-105217912 CAGTCTCCTGTATAATTCCCAGG + Intronic
1030203643 7:106930959-106930981 CATTCTCCTGCCTCAGTAGCTGG + Intergenic
1033311507 7:140265211-140265233 CAGTCTCCGGTCTCATTGGTTGG + Intergenic
1035922407 8:3691983-3692005 CAGCATCCTGTCTCATGAGCTGG - Intronic
1036459874 8:8942567-8942589 CTGTATCCTGTTTTATCAGCAGG + Intergenic
1041068814 8:54106457-54106479 CTGCATCCTGTTTCATCAGCAGG + Intergenic
1044556311 8:93565948-93565970 CTGTCTTCTGTTTCCTCAGCTGG + Intergenic
1044912125 8:97071437-97071459 CTGTCCCCTATCTCATTAGCAGG + Intronic
1045842135 8:106592958-106592980 CAGTCTCCTGTTCCTTTTTCAGG + Intronic
1048541766 8:135348605-135348627 AAGTCTCCTGTTTCAGTAAATGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1052815646 9:33100880-33100902 CAGCATCCTGTTTTATCAGCAGG + Intergenic
1055007318 9:71523249-71523271 CACTCTTCTGTTTCTTAAGCTGG + Intergenic
1055343833 9:75313326-75313348 CAGTCTCCTGTAGCATTCCCAGG - Intergenic
1055460682 9:76517574-76517596 CAGGCTACTGTTTTATTAGATGG - Intergenic
1056019826 9:82430278-82430300 CAGCCTCCTTTTTCATTAGGTGG + Intergenic
1056575912 9:87856155-87856177 CAGCCTCCTTTCTCATTAGGTGG + Intergenic
1057072012 9:92106752-92106774 CAGCCTCCTTTCTCATTAGGTGG - Intronic
1057958524 9:99432512-99432534 CAGTCTACTGTTTAATTCTCTGG + Intergenic
1058529287 9:105889817-105889839 CAGTCATATGTTTCTTTAGCAGG - Intergenic
1058827798 9:108790420-108790442 CTGTATCCTGTTTTATCAGCAGG - Intergenic
1062021078 9:134319697-134319719 CAGCCTCCTGTTTCATTTGCAGG - Intronic
1186602877 X:11057114-11057136 CTGTATCCTGTTTTATCAGCAGG + Intergenic
1186865523 X:13717284-13717306 CAGTCGCCTGTGTCAATAGCAGG + Intronic
1186882611 X:13881164-13881186 CAGTTGCCTGTTTCAGTTGCTGG - Intronic
1187462973 X:19503999-19504021 CAGCCTCCTGTTTGTGTAGCTGG - Intronic
1188284345 X:28310132-28310154 CCGTATCCTGTTTTATCAGCAGG - Intergenic
1188740802 X:33778377-33778399 CTGTTTTCTGTTTCATCAGCTGG + Intergenic
1193311440 X:80015025-80015047 CAGTTTCATCTTTCATTAACTGG + Intronic
1193702405 X:84779530-84779552 AATTTTCCTGTTTCAATAGCAGG - Intergenic
1193879545 X:86904690-86904712 CAATCTCCTATTTCATTCACTGG - Intergenic
1194314272 X:92355310-92355332 CATTCTCCTGCCTCAGTAGCTGG - Intronic
1196299611 X:114039231-114039253 CATTCTCCTGCCTCAGTAGCTGG - Intergenic
1198310575 X:135423912-135423934 CAGTTTCCTCTGTCATTAGGAGG - Intergenic
1200330544 X:155292142-155292164 TATTCTCCTGTTTCATCAGGTGG - Intronic
1201297285 Y:12474652-12474674 CAGTATCCTGTTTTCTTAGAAGG + Intergenic