ID: 925123510

View in Genome Browser
Species Human (GRCh38)
Location 2:1437771-1437793
Sequence CTGAACACAGAGATGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925123505_925123510 0 Left 925123505 2:1437748-1437770 CCGGCTGGAAGAGGCAGCCTGTG 0: 1
1: 1
2: 2
3: 60
4: 576
Right 925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG 0: 1
1: 0
2: 5
3: 21
4: 303
925123503_925123510 2 Left 925123503 2:1437746-1437768 CCCCGGCTGGAAGAGGCAGCCTG 0: 1
1: 0
2: 4
3: 43
4: 557
Right 925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG 0: 1
1: 0
2: 5
3: 21
4: 303
925123504_925123510 1 Left 925123504 2:1437747-1437769 CCCGGCTGGAAGAGGCAGCCTGT 0: 1
1: 0
2: 7
3: 34
4: 330
Right 925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG 0: 1
1: 0
2: 5
3: 21
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925123510 Original CRISPR CTGAACACAGAGATGGGTCA GGG Intronic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900532623 1:3162187-3162209 CTGGGCACAGAGAGGGGTGATGG - Intronic
900700793 1:4047531-4047553 GAGAACACAGAGATGGGGAAGGG + Intergenic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
903820996 1:26102523-26102545 CAGGACACAGAGCTTGGTCAAGG + Intergenic
905172467 1:36117235-36117257 ATGACCCCAGAGCTGGGTCATGG + Intronic
905797767 1:40825155-40825177 CAAAACAAAGAGATGGGTAAAGG - Intronic
906528182 1:46508604-46508626 CAGAGCACAGAGAGGAGTCAGGG + Intronic
909990667 1:82219574-82219596 CTGGACACAGATAGGAGTCATGG - Intergenic
910244918 1:85128298-85128320 CTGAACACAGAAAGGGCTAAAGG - Intronic
911439422 1:97907076-97907098 CTGGACAAAGCGATGAGTCATGG + Intronic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
914854522 1:151341531-151341553 CTGGCCACAGTGATTGGTCAGGG + Exonic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
915174126 1:154000617-154000639 CTGGACAAAGAGATGATTCATGG + Intronic
915318758 1:155044535-155044557 CACAAGACAGAGATGGTTCAAGG + Intronic
915907546 1:159889888-159889910 CTGAGCACAGTGTTGGCTCATGG + Intronic
916293094 1:163187805-163187827 CTGAACCCAAAGAGGGGTCCTGG + Intronic
920964771 1:210692677-210692699 CAGAACACAGAGAAAGGCCATGG + Intronic
922157946 1:223054499-223054521 CTGAACACAAAGGTGGGTGATGG - Intergenic
922704599 1:227782500-227782522 CTGAGAACAGCGAGGGGTCAGGG - Intergenic
922966852 1:229697655-229697677 CTGAACTCAAAGAGGTGTCATGG - Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
1063001763 10:1931247-1931269 ATGATCACAGAGATGGTTGAAGG + Intergenic
1064348210 10:14552264-14552286 CTGAACCCTAAAATGGGTCACGG + Intronic
1065030981 10:21585645-21585667 CTCAACACAGGAATGGGGCAAGG - Intronic
1065600413 10:27362213-27362235 CTGATCATAGAGAAGGATCATGG + Intergenic
1067292851 10:44957048-44957070 CTGGACGCAGAGATGGGGGAAGG - Intergenic
1067399993 10:45963228-45963250 CTCAAAACAGAAATGAGTCATGG + Intergenic
1067734958 10:48843443-48843465 ATGAACACAGAGATGACACATGG + Intronic
1067868324 10:49932517-49932539 CTCAAAACAGAAATGAGTCATGG + Intronic
1067960498 10:50842788-50842810 ATGAACACAGATATGTTTCAGGG + Intronic
1070174684 10:73959966-73959988 CTGAACACAGACCTGACTCAGGG + Intergenic
1073824374 10:107303663-107303685 CTGAACACATAGATAGCTCTAGG - Intergenic
1075385190 10:122050529-122050551 CTGACCACAGAGACGCGTCCAGG + Exonic
1076341352 10:129748209-129748231 CTGAATACAGAAATAGGTGAGGG - Intronic
1076644492 10:131943281-131943303 CTCAACACAGAGATGGGGGCGGG + Intronic
1078740213 11:14059313-14059335 CTGGGCACAAAGTTGGGTCAAGG + Intronic
1079380000 11:19929798-19929820 TAGAACACAAAGATGAGTCAGGG + Intronic
1080502216 11:32881725-32881747 CTGAACACAGAAAGCGTTCATGG + Intergenic
1080577855 11:33616403-33616425 ATGGCCACAGTGATGGGTCAGGG - Intronic
1080935138 11:36855356-36855378 CTGAACACAGAGCTAGTACATGG - Intergenic
1084469141 11:69345094-69345116 CTGAGCTCAGAGAGGGCTCAGGG + Intronic
1085533047 11:77202958-77202980 CTGGACACAGGGATGGGTGGGGG + Intronic
1085861476 11:80241077-80241099 CTGATGACAGAAATGGGTAAAGG - Intergenic
1088596020 11:111440852-111440874 CAGAAGTCAGAGGTGGGTCATGG + Intronic
1089196172 11:116695094-116695116 TGGAACACAGAGCTGGGTGATGG - Intergenic
1089817816 11:121192177-121192199 CTGAGCACTGAGATGGATTAAGG + Intergenic
1090621052 11:128561556-128561578 CTGAAGAAAGAGTTGGGCCATGG + Intronic
1090840466 11:130483286-130483308 CTGAACAAAGACATGAGGCAGGG + Intergenic
1094307798 12:29040260-29040282 CTGAAATCAGAGGTGGGCCAGGG + Intergenic
1095796241 12:46221930-46221952 CAGAAGACAGAGATGAGACAGGG + Intronic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1098904247 12:76145554-76145576 CTGAACACATAGCTGGGAGATGG - Intergenic
1101490830 12:105208048-105208070 CTGAACACCCAGGAGGGTCAGGG + Intronic
1102704109 12:114866493-114866515 CTGACCACAGTGATTGGTCCAGG + Intergenic
1104662086 12:130618497-130618519 CTGAACACCGGGATGTTTCAGGG - Intronic
1105257219 13:18751737-18751759 CTGCACACAGAGGGGGGTCATGG + Intergenic
1105257704 13:18755265-18755287 CTGCACACAGAGGGGGATCATGG + Intergenic
1105259880 13:18771099-18771121 CTGCACACAGAAGGGGGTCATGG + Intergenic
1105260355 13:18774573-18774595 CTGCACATAGAGTGGGGTCATGG + Intergenic
1105262560 13:18790422-18790444 CTGCACACAGAAGGGGGTCATGG + Intergenic
1106409900 13:29504351-29504373 CTGCACATTGAGATGGCTCAGGG + Exonic
1109478870 13:62920591-62920613 CTGAGCAGAGAGCTGGCTCAGGG - Intergenic
1111249016 13:85579347-85579369 CTTAACACAAAGTTGGTTCAGGG - Intergenic
1111324587 13:86676761-86676783 CTGAACCTAGAGATGAGTAAAGG + Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114539460 14:23443808-23443830 CTAGACACAGAGAGGGGTGAAGG + Intergenic
1114553139 14:23545717-23545739 CAGAACACAGAGATGGCTGGGGG + Intronic
1114628328 14:24143803-24143825 CTGAGCAGAGAAAAGGGTCAAGG + Intronic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1117781783 14:59240568-59240590 CAGAACTGAGAGATGGGACAAGG - Intronic
1122559749 14:102604046-102604068 CTGTACTCAGAGATTGGTCTTGG + Intronic
1124999686 15:34756449-34756471 CTGAACACGGAGGAGGTTCAAGG + Intergenic
1125731043 15:41893018-41893040 CTGTACACAGAGCTGGCTGACGG - Exonic
1127257314 15:57303234-57303256 ATGAAGACAGAGGTGGGTCCTGG - Intergenic
1128999577 15:72320624-72320646 CCGAAGACAGAGATGTGTGATGG - Exonic
1130104653 15:80920307-80920329 CAGCACACAGAGAGGGGTCCAGG - Intronic
1130513474 15:84607838-84607860 TTTATCACAGAGATGGGACAAGG - Intronic
1131259803 15:90882447-90882469 CGGAGCACAGGGGTGGGTCATGG - Exonic
1131481717 15:92787917-92787939 ATGAGAACAGAGATGGGACAGGG + Intronic
1132359431 15:101200590-101200612 CTGCACCCCCAGATGGGTCAGGG + Intronic
1132516365 16:367963-367985 ATGACCACAGGGATGGGACAGGG - Intronic
1132654769 16:1037173-1037195 CTGAGCGCTGAGATGAGTCATGG - Intergenic
1132924842 16:2423934-2423956 CTGGACACAGGGATGAGTCCAGG - Intergenic
1134444731 16:14322236-14322258 GTGAACATGGAGATGGGTCTGGG - Intergenic
1134838967 16:17385942-17385964 CTGAATACAGAGGTGGTTCAAGG + Intronic
1135503993 16:23020523-23020545 CTGAACACAGAGAGTGGCAAAGG + Intergenic
1137517104 16:49155965-49155987 CAGAACACAAAGATGTGTAAGGG - Intergenic
1138473873 16:57259219-57259241 TGGTACAAAGAGATGGGTCATGG - Intronic
1139203882 16:65006580-65006602 CTGAACACAGAGTTGGGAACTGG + Intronic
1139671397 16:68494173-68494195 CTGATCACAGAGCTGGGTGGTGG + Intergenic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141453561 16:84121978-84122000 CTGAAGACTGAAATGGCTCATGG + Intergenic
1144586390 17:16490424-16490446 CTGAACTCAGAGAAGGCACATGG + Intronic
1147061672 17:37884647-37884669 CTCAACACAGGAATGGGGCAAGG + Intergenic
1147191550 17:38740851-38740873 CTGAAGGCAGAGAAGGGTCTTGG - Intronic
1147230840 17:39016642-39016664 TTGAACCCAAAGAGGGGTCATGG + Intergenic
1147666034 17:42148795-42148817 TTTAGCCCAGAGATGGGTCAAGG + Intronic
1151129190 17:71878360-71878382 CTGAACAAAGAGATGATACATGG + Intergenic
1151155747 17:72122211-72122233 CTGTCCACGGAGATGGGGCAAGG + Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152669410 17:81593330-81593352 CTGAGCACAGGGCTGGGTCCAGG - Intronic
1153378188 18:4405721-4405743 CTCAAGACAAAGATGGGTCCAGG + Intronic
1154426142 18:14273702-14273724 CTGCACACAGAGGGGGTTCATGG - Intergenic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1154431154 18:14309631-14309653 CTGCACACAGAGGGGGGTCATGG - Intergenic
1154433830 18:14328936-14328958 CTGCACACAGAGGGGGGTCATGG - Intergenic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1156210059 18:34929656-34929678 CTGGCCACAGAGCTGAGTCATGG + Intergenic
1157623056 18:49027101-49027123 CTGAGCAGAGAGATGTCTCAGGG - Intergenic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1158424836 18:57329619-57329641 CTGAAACCAGAGATGGGTTGGGG + Intergenic
1160544498 18:79643625-79643647 CTGATCACACAAATGGATCAAGG + Intergenic
1161237635 19:3205715-3205737 CTGCGCACAGGGACGGGTCAGGG + Intronic
1161313668 19:3608063-3608085 CTGAACACAGAGAGGGGTTGGGG - Intergenic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1163281295 19:16319658-16319680 GGGGACACAGAGATGAGTCAAGG + Intergenic
1164458619 19:28429110-28429132 CTGACCACAGGCAAGGGTCAGGG + Intergenic
1165953759 19:39489214-39489236 CTGCATCCAGAGAGGGGTCATGG + Intronic
1166255902 19:41604365-41604387 CTGCACAGAGAGAGGGGTCCTGG + Intronic
1166299541 19:41906236-41906258 CTGAAGACAGAGATGTGTTCAGG - Intronic
1167684405 19:50947105-50947127 CTGAATACAGAGAAGGGTGCTGG + Intronic
925026504 2:611727-611749 TTCAACACAGAGAGGGCTCAGGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
925641520 2:5989970-5989992 CTGAACATGGAGATGGTTCTGGG + Intergenic
928446479 2:31337818-31337840 CTGAACACAGACAGGGCACAGGG + Intronic
928764339 2:34624562-34624584 ATGAACACACGGATGGGTGAAGG + Intergenic
929225756 2:39510440-39510462 CTGAACACAGAGTTGGGAGGTGG + Intergenic
929565373 2:42980474-42980496 AGAAACACAGTGATGGGTCAAGG + Intergenic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931638005 2:64357935-64357957 ATGAACACAGAGAGGGATCATGG - Intergenic
931817815 2:65921845-65921867 CTGGCCACTGAGATGGTTCAGGG + Intergenic
936666649 2:114604465-114604487 CTGTACACGCAGATGGGTCAGGG - Intronic
937070569 2:119060039-119060061 CAGAACTCAGAGGTGGATCAGGG + Intergenic
937235887 2:120431798-120431820 TTGGACACAGAGACGGGACAAGG - Intergenic
938157161 2:128951620-128951642 CTGAGCACAGAGGTCGGTAATGG - Intergenic
938770551 2:134497524-134497546 CAGGACACAGAGATAGCTCAAGG + Intronic
938847287 2:135222618-135222640 CTGAACGCAGAGATGGATATGGG + Intronic
939989542 2:148864508-148864530 CTGAACACAGTGATAGGTTTGGG + Intergenic
940004863 2:149001320-149001342 CTGAGCACAGAGATGTGTTGGGG + Intronic
940707830 2:157126419-157126441 CTGAACACACACATGGGTAGTGG + Intergenic
940847297 2:158655933-158655955 CAGAAGACAGAGTTGGGTCAAGG - Intronic
942346878 2:175012669-175012691 CTGGCCACAGTGATGAGTCATGG - Intergenic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
945493679 2:210484307-210484329 TGGAGCACAGAGAGGGGTCAAGG + Intronic
946295918 2:218783370-218783392 CAGAACACAGAAATGAGGCAGGG + Intronic
946654424 2:221930526-221930548 ATGAACACAGAAATGGTCCAAGG + Intergenic
947922802 2:233893038-233893060 ATGGACACAGTGATGAGTCATGG - Intergenic
1168797862 20:623480-623502 CTGTAAACAGAGATGCTTCAAGG + Intergenic
1169024564 20:2358132-2358154 CTGCCCACTGAGTTGGGTCATGG - Intergenic
1170394438 20:15910918-15910940 CAGAGCACAGAGATGGGTAGAGG - Intronic
1171030102 20:21669403-21669425 CTGAAGTCAGAGGTGGGTCAGGG - Intergenic
1171883505 20:30634710-30634732 CTGCACATAGAGGGGGGTCATGG + Intergenic
1173961610 20:47076966-47076988 CTGACCACAGAGATTGGTTTGGG - Intronic
1174127165 20:48315249-48315271 CTGAACCCAGTGATGGGCAATGG - Intergenic
1174555687 20:51393883-51393905 CAGAACACAGGGCTGGGGCAGGG + Intronic
1174582337 20:51580722-51580744 CTGAACAAGGAGTTGGTTCAGGG + Intergenic
1174707778 20:52674775-52674797 CTGGCCACAGTGATGGGTCCAGG - Intergenic
1174846410 20:53947704-53947726 CTGAACCCTGAGCTGGGTAAAGG + Intronic
1175749387 20:61484744-61484766 CTGAACACAGAGGGGGCTCAGGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176687275 21:9862177-9862199 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1176843696 21:13860294-13860316 CTGCACATAGAGGGGGGTCATGG + Intergenic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176846365 21:13879614-13879636 CTGCACATAGAGGGGGGTCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177885815 21:26744101-26744123 CTCAACACAGAGATGCCCCATGG + Intergenic
1178290403 21:31363067-31363089 CTGTACACAGTGATTGGTCCAGG + Intronic
1178686893 21:34718972-34718994 CTGAAGGCAGAGTTGGGACAGGG - Intergenic
1178792919 21:35716645-35716667 TTGAATACAGAGAAAGGTCAGGG - Intronic
1179002599 21:37477276-37477298 AGGAACACAAAGATGGGCCAGGG + Intronic
1179062310 21:37990283-37990305 CGGAACTCAGAGGTGAGTCAGGG - Intronic
1179132963 21:38655328-38655350 TTGCACACAGAGGTGGGTCCAGG + Intronic
1179416670 21:41203812-41203834 CTGAAGACGGGGATGGGTCAGGG + Intronic
1179473124 21:41625521-41625543 CTGCACACAGAGTGGGGACAGGG + Intergenic
1179909531 21:44440691-44440713 CTGTGCTCAGAGCTGGGTCAGGG + Intronic
1180629840 22:17220843-17220865 GTGAAAACACAGAGGGGTCAGGG + Intronic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182551318 22:31102336-31102358 GGGAACACAGTGATGGGGCAAGG - Intronic
1183383619 22:37502860-37502882 CTGGGCTCAGAGATAGGTCAGGG + Intronic
1183398500 22:37587237-37587259 CTGAACCCAAAGAGGGGTCGTGG + Intergenic
1184564234 22:45282353-45282375 CTGAATCCAGAGCTGGGACAGGG + Intergenic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
1185097726 22:48820889-48820911 CTGAGCATGGAGATGGGTCTTGG - Intronic
949735312 3:7164880-7164902 CTCAACCCAGAGATGGGCAAGGG - Intronic
949869302 3:8574231-8574253 CTGGGCACAGAGATTGGTCAAGG - Intergenic
951367195 3:21797868-21797890 CAGAACACAGAGATTGTTTAGGG + Intronic
952033676 3:29174775-29174797 CTGAAACCAGAGATGAGCCAGGG - Intergenic
952309700 3:32177171-32177193 CTGAAGCCAGAGTTGGGTGAAGG + Intergenic
953039438 3:39242068-39242090 CTGACCACAGAGATTGGTCATGG - Intergenic
953280123 3:41547140-41547162 TTGAACACAGAGTAGGTTCAAGG + Intronic
953335764 3:42092538-42092560 CAGAGCACAGAGGTGGGCCAGGG + Intronic
953814626 3:46144410-46144432 GTGGGCACAGAGGTGGGTCATGG - Intergenic
954068988 3:48129173-48129195 CTGAGCACAAATATGGGTCTTGG - Intergenic
954532786 3:51335321-51335343 ATGGACACAGAGATAGGGCATGG - Intronic
954759112 3:52861242-52861264 CTGAACAGAGAGAGGGGAGAAGG + Intronic
956653770 3:71529913-71529935 CTGAACCCAAGGAGGGGTCAAGG + Intronic
959537013 3:107497866-107497888 TTGAAATCAGAGGTGGGTCAAGG + Intergenic
960751621 3:120961211-120961233 GTGAACAAAGAGATGTATCACGG - Intronic
961943793 3:130664320-130664342 CTGGAGACAGTGTTGGGTCACGG + Intronic
962422398 3:135240076-135240098 CCCAACACAGGGAAGGGTCAGGG - Intronic
962710516 3:138081922-138081944 CGGACCCCAGAGATGTGTCAGGG - Intronic
964119446 3:153167235-153167257 CTGAACACAGAGCTAGTTCTAGG + Intergenic
965102788 3:164322822-164322844 CTGATTGCAGAGCTGGGTCAGGG + Intergenic
965334191 3:167416000-167416022 CTAAACACAGAGATTGGTTCAGG - Intergenic
965401504 3:168218268-168218290 CTGAACACATCCATGGGTAAAGG - Intergenic
969173508 4:5382536-5382558 CTGACCACAGAGAGGGACCAGGG - Intronic
970138576 4:12954845-12954867 CATGACACAGAGATAGGTCAAGG - Intergenic
971718596 4:30214904-30214926 CTGAAAACAGAAATGAATCATGG + Intergenic
973014069 4:45114181-45114203 CAGAGTAGAGAGATGGGTCATGG - Intergenic
973224878 4:47772250-47772272 TTTAACACAGTGAGGGGTCAAGG + Intronic
973367156 4:49216982-49217004 CTGCACATAGAGGGGGGTCACGG + Intergenic
973692739 4:53455072-53455094 ATGAAGACAGAGATAGGTGAGGG - Intronic
974973721 4:68863917-68863939 GTGATCACAGAGAAAGGTCAGGG + Intergenic
975159479 4:71109448-71109470 CTGATCACAGAGATGCAACAGGG - Intergenic
977740203 4:100470842-100470864 ATGAACACATAGAGGGGTCAAGG + Intronic
977939036 4:102838332-102838354 CTGAACACAGAGCTGGGAAGAGG - Intronic
979108045 4:116712791-116712813 CTGAACACAGTAATGGGTCATGG - Intergenic
979937053 4:126711012-126711034 ATGAACAGGGAGATGGGTGAAGG - Intergenic
980350677 4:131680284-131680306 CTGCACACAGAGAGGGGCCCTGG - Intergenic
983120533 4:163878531-163878553 AAGAACAAAGAGATGAGTCAGGG - Intronic
984278935 4:177643859-177643881 CTGAGCACTGAGATGGGTTTTGG - Intergenic
986249834 5:6045650-6045672 CAGAACACAGATCTGGGTGATGG - Intergenic
986391014 5:7288481-7288503 CAAAACAAAAAGATGGGTCACGG + Intergenic
986573776 5:9191912-9191934 CTAAACTCACACATGGGTCATGG - Intronic
986573784 5:9191953-9191975 CTAAACTCACACATGGGTCATGG - Intronic
986573792 5:9191994-9192016 CTAAACTCACACATGGGTCATGG - Intronic
986573800 5:9192035-9192057 CTAAACTCACACATGGGTCATGG - Intronic
986573808 5:9192076-9192098 CTAAACTCACACATGGGTCATGG - Intronic
986573816 5:9192117-9192139 CTAAACTCACACATGGGTCATGG - Intronic
988190665 5:27929239-27929261 CTGAACACAGAGAATGGATAGGG - Intergenic
990211188 5:53482649-53482671 CTGATCACAGAGATGGGAGGTGG - Intronic
991575480 5:68099043-68099065 GTGAAAACAGAGATGGGTCAGGG + Intergenic
991596104 5:68307431-68307453 CTGAACACAGAGTTGGGAGGAGG + Intergenic
992677275 5:79117943-79117965 CTGAAAACAAAGATGGGTTGGGG + Intronic
995599493 5:113780158-113780180 CTGAACACACAGAGGGTTCCTGG + Intergenic
996400943 5:123061738-123061760 CTAAACCCAGAGATGGGCAAAGG + Intergenic
997143252 5:131405785-131405807 CAGAACACAGTGTTGGGTCTGGG + Intergenic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
999070336 5:148737427-148737449 CTGGCCACAGTGATGGGCCACGG + Intergenic
999903927 5:156118464-156118486 ATGCACACAGAGAAGAGTCAGGG + Intronic
1002653069 5:180718075-180718097 CACAAAACAGAGATGGGGCAGGG + Intergenic
1003362099 6:5437061-5437083 CTGAAGACAGGGATGGGTGGAGG - Intronic
1003706674 6:8539352-8539374 CTGAACGCAGAGCTGGGACTTGG + Intergenic
1005655734 6:27935191-27935213 CAGATCACAGGGCTGGGTCATGG - Intergenic
1006017644 6:31094948-31094970 GTGACCACAGAGAGGGGCCAAGG - Intergenic
1006296148 6:33170944-33170966 AAGGACACAGGGATGGGTCATGG + Intronic
1008547475 6:52595989-52596011 CTGAACAGAGAGTTGGGGGATGG - Intergenic
1009764124 6:68047296-68047318 CTGAACACAGGAATGGGCAAAGG - Intergenic
1012528183 6:100202592-100202614 CTTAAAGCAGAGAGGGGTCAGGG - Intergenic
1012531857 6:100247705-100247727 CTGAAGAAAGATATGGGACAAGG + Intergenic
1013759625 6:113501596-113501618 CGGAATACTGAGATGTGTCAAGG - Intergenic
1014689882 6:124550458-124550480 TTGAACCCAGGGCTGGGTCAGGG - Intronic
1015802679 6:137076664-137076686 CTGGGCACAGAGATGGCTGAGGG - Intergenic
1016048354 6:139504035-139504057 ATGAACAGAGAGATAGGCCATGG - Intergenic
1016222628 6:141693661-141693683 CAGAACACAGAGATTGTTTAGGG + Intergenic
1020077860 7:5270424-5270446 TGGAACACAGAGGTTGGTCAGGG - Intergenic
1021775735 7:24053564-24053586 CTGAAGAAAGAGATGGGTAAAGG - Intergenic
1023295317 7:38708833-38708855 CTGATCACAGATATGGGTGTAGG - Intergenic
1025011165 7:55400054-55400076 CTGAACACAGAGATAGGTCCAGG + Exonic
1025201027 7:56961746-56961768 TGGAACACAGAGGTTGGTCAGGG + Intergenic
1025670916 7:63615186-63615208 TGGAACACAGAGGTTGGTCAGGG - Intergenic
1026006062 7:66601246-66601268 CTGAACAGGGAGATGGTTGAGGG - Intergenic
1026455679 7:70570633-70570655 CAGGACACAGAGAAGGGTAAAGG - Intronic
1027419756 7:78007487-78007509 CAGAACACAGAGATAGTTGAAGG + Intergenic
1029483120 7:100824720-100824742 CTGAAAGCAGAGAGGGGTCTTGG - Intronic
1030879485 7:114859698-114859720 CTGAGGCCAGAGATGTGTCATGG - Intergenic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1031987134 7:128170489-128170511 CTGAGCACAGAGGAAGGTCATGG - Intergenic
1032264316 7:130360264-130360286 CTGAACACAAGGACTGGTCACGG - Intronic
1032538642 7:132685328-132685350 CTGAAATCAGAGGTGGGCCAAGG - Intronic
1033574235 7:142664757-142664779 ATGAAGTCAGAGATGGGGCAGGG - Intergenic
1034273422 7:149814067-149814089 CTGACCACAGAGTTGGCTCCAGG + Intergenic
1036585222 8:10117395-10117417 CTGACCAGAGAGCTGGATCAGGG - Intronic
1037465995 8:19161257-19161279 CTGAGCACAGAGGTGTTTCATGG + Intergenic
1038848922 8:31255308-31255330 TTGAACCCAAAGAAGGGTCATGG - Intergenic
1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG + Intergenic
1039508197 8:38067657-38067679 CTGGCCAGAGAGATGGGTCGAGG - Intergenic
1039645233 8:39275093-39275115 CTAGACACAGAGATGCATCAGGG - Intronic
1043732999 8:83708550-83708572 CTCACTACAGGGATGGGTCAGGG - Intergenic
1044352995 8:91188430-91188452 CTGAACACAGAGTTTGGGAAGGG - Intronic
1044560409 8:93606662-93606684 CTGAACACAGAGATGGGCAGTGG + Intergenic
1044560443 8:93606803-93606825 CTGAACACAGGGATGGGAGGTGG + Intergenic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1045657807 8:104405164-104405186 CGGAATACAGAGATGCTTCATGG - Intronic
1046049860 8:109010075-109010097 TTGAACACAGGCATGGGTGAGGG - Intergenic
1046638195 8:116696163-116696185 CTGAATCCAGAGATGGGACAGGG + Intronic
1048422655 8:134292611-134292633 CTGAACACCTATATGGGACAAGG + Intergenic
1048848747 8:138624134-138624156 GTGAGCACAGTGATGGGTGAGGG + Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049319438 8:141988160-141988182 AGGAACACAGAGAGGGGTCCAGG - Intergenic
1049601067 8:143507914-143507936 CAGGGCACAGACATGGGTCAGGG + Intronic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1053315992 9:37052321-37052343 CTGAATACAGAGACTGGTCAGGG + Intergenic
1053556679 9:39145237-39145259 CTCAAGGCAGAGGTGGGTCATGG - Intronic
1053782030 9:41619424-41619446 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1053820790 9:41965515-41965537 CTCAAGGCAGAGGTGGGTCATGG - Intronic
1054089658 9:60833654-60833676 CTCAAGGCAGAGGTGGGTCATGG - Intergenic
1054111069 9:61109212-61109234 CTCAAGGCAGAGGTGGGTCATGG - Intergenic
1054169982 9:61829578-61829600 CTGCACACAGAGAGGGGCCCTGG + Intergenic
1054609788 9:67221913-67221935 CTCAAGGCAGAGGTGGGTCATGG + Intergenic
1054667556 9:67751237-67751259 CTGCACACAGAGAGGGGCCCTGG - Intergenic
1056586140 9:87928420-87928442 CTGCACATAGAGGGGGGTCATGG + Intergenic
1056610742 9:88124523-88124545 CTGCACATAGAGGGGGGTCATGG - Intergenic
1056753557 9:89368410-89368432 GAGAGCACAGAGATGGGCCAGGG - Intronic
1057138086 9:92709043-92709065 CTAAACACACAGTTGGATCATGG + Intergenic
1057820494 9:98326616-98326638 CAGAACACAGAGTTGCCTCATGG + Intronic
1057868885 9:98702924-98702946 CTGAACACAGAGTTGGGGAGAGG - Intronic
1060060401 9:120454563-120454585 CTGAAGTCAGAGGTGGGCCAAGG - Intronic
1060537898 9:124406115-124406137 CTGATCACAGAGAGGTGTGATGG - Intronic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062194432 9:135265097-135265119 CTGTCCACAGCGAGGGGTCAGGG - Intergenic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1189074213 X:37898858-37898880 CAGAAACCAGAGATGGGACATGG + Intronic
1189203498 X:39217980-39218002 CTGAAATCAGAGATAGGCCAAGG - Intergenic
1189253164 X:39616969-39616991 CTAAAAACAGAGATGGCACATGG + Intergenic
1190442975 X:50494349-50494371 CTGAACACAGTCATGAGTGAAGG + Intergenic
1192528549 X:71868027-71868049 CCAAACACAGAGATGGGTGTTGG - Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1194768427 X:97870733-97870755 CTGAAATCAGAGGTGGATCAAGG + Intergenic
1195907910 X:109863660-109863682 CTGAAAACAAAGTTAGGTCAAGG + Intergenic
1197696701 X:129557573-129557595 GTGAACACAGGGATAGGTTAGGG + Intronic
1198013777 X:132588138-132588160 TTGAACACAGAGATGGGGTGAGG + Intergenic
1198152343 X:133923330-133923352 CTGATCAGAGAGATAGGACATGG + Intronic
1200909413 Y:8517005-8517027 CTGGACACAGACATGGGTAGTGG + Intergenic