ID: 925124193

View in Genome Browser
Species Human (GRCh38)
Location 2:1442209-1442231
Sequence AGACTAATACAGATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 1, 3: 28, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925124190_925124193 24 Left 925124190 2:1442162-1442184 CCTTTTCTTCTCAGACTCAGGTA 0: 1
1: 0
2: 39
3: 82
4: 419
Right 925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG 0: 2
1: 0
2: 1
3: 28
4: 203
925124188_925124193 27 Left 925124188 2:1442159-1442181 CCTCCTTTTCTTCTCAGACTCAG 0: 1
1: 1
2: 46
3: 587
4: 1178
Right 925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG 0: 2
1: 0
2: 1
3: 28
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925124193 Original CRISPR AGACTAATACAGATGGAGTA GGG Intronic
903291924 1:22319412-22319434 AGACTAACACAGAAGCAGCAAGG - Intergenic
906490756 1:46266709-46266731 AGTCTAATACAGAAGGCGTCTGG + Intronic
907315594 1:53568906-53568928 AGACTAATACAGTAGGTGAATGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
908347784 1:63253019-63253041 AGACTAATACACATGAAAGAGGG + Intergenic
908428925 1:64036923-64036945 AGACAAAAACAGCTGGAGTCTGG + Intronic
908478337 1:64511119-64511141 ACATTAAAGCAGATGGAGTACGG + Intronic
908855555 1:68423080-68423102 AGAGTAGTAAAGAAGGAGTATGG - Intergenic
909901661 1:81144654-81144676 AGACAAAGACATATGGAGGATGG - Intergenic
910519497 1:88103202-88103224 AAACAAATACAGTTGGAGCATGG - Intergenic
917829731 1:178867965-178867987 AGGCAAATATAGATGGAGTATGG + Intronic
919159430 1:193808955-193808977 GGACTAATACAGAGGGAGTTAGG - Intergenic
920036404 1:203068442-203068464 AGACTAACACATCTGGAGTGTGG - Exonic
921310651 1:213839812-213839834 AGAATAATACCGATCTAGTAGGG + Intergenic
922098397 1:222461822-222461844 AGACTAATACAGTTGGTCAATGG + Intergenic
922844328 1:228671335-228671357 AGACTAATACAGATGTCTTATGG + Intergenic
923397395 1:233580576-233580598 AGACAAGAACAGATGGAGGAAGG - Intergenic
1063146237 10:3297483-3297505 GGACTAATACAGAGAGAGAAAGG + Intergenic
1064951662 10:20857946-20857968 AATCTAACACAGATGAAGTAAGG + Intronic
1065986480 10:30958507-30958529 AAAGTAGTACAAATGGAGTAAGG - Intronic
1067982124 10:51098440-51098462 AGACTAATGCAGGTGGAGCAAGG + Intronic
1068676655 10:59776583-59776605 AAACTAATACAGCTGGAAAAGGG - Intergenic
1070438084 10:76413271-76413293 AGACTAATACAGATGTGATGTGG - Intronic
1071503204 10:86217952-86217974 AGACAAATGCAGGTGGGGTAGGG - Intronic
1071549904 10:86558875-86558897 TGACTAATACAGATGGCTTGGGG - Intergenic
1071930995 10:90470205-90470227 AAACTAATACAAATGGTGAATGG - Intergenic
1072246525 10:93548552-93548574 AGACTAATACTGAGAGAGAAGGG - Intergenic
1072583574 10:96761655-96761677 AGATTTATACATATGGAGCAGGG - Intergenic
1074531202 10:114300148-114300170 TGACTAATACAGATGGAATCGGG + Intronic
1074889604 10:117724447-117724469 AGACTAATACACTGGGATTATGG - Intergenic
1075285042 10:121176485-121176507 AAACTAAAACAGATGGGGTAAGG + Intergenic
1076019366 10:127058552-127058574 AAAATAATACAGATGGGGAAGGG - Intronic
1078353648 11:10616742-10616764 CCACTAATACAGAAGGAGGAAGG - Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1079430213 11:20382497-20382519 AGACTAATACAGTAGACGTAAGG - Intronic
1079874909 11:25844451-25844473 AGACTAATACACATGGTAAATGG + Intergenic
1080793814 11:35544644-35544666 AGATTAATACACATGGATAAGGG + Intergenic
1085778303 11:79385804-79385826 AGACTAAGAGAGATGGTGTTAGG - Intronic
1087305430 11:96484229-96484251 AAACAAATACAGATTTAGTATGG - Intronic
1087502941 11:98982279-98982301 AGAATATTATAAATGGAGTAAGG + Intergenic
1087789442 11:102391403-102391425 AGACTAAAACAGAAAGGGTACGG - Intergenic
1087973598 11:104516370-104516392 ATACAAATAGATATGGAGTATGG - Intergenic
1090907518 11:131089864-131089886 AGAATAAGACTGATGAAGTATGG + Intergenic
1093218360 12:16389077-16389099 AGACAAATACAGGTGGCATAGGG + Intronic
1093568768 12:20641235-20641257 AGAGTAAGGCAGTTGGAGTACGG + Intronic
1095922101 12:47542030-47542052 AGAGGAACACAGAAGGAGTATGG + Intergenic
1096225736 12:49865836-49865858 ACACAAATTCAGCTGGAGTAGGG - Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1100058654 12:90544256-90544278 ATCCTAATACAAATGGGGTAAGG - Intergenic
1100522838 12:95392351-95392373 AGTCTAGTCCACATGGAGTAAGG + Intergenic
1100762720 12:97827078-97827100 AGACTAACACAGCTGGGGAAAGG + Intergenic
1100780723 12:98023394-98023416 AGACTAATACAGGAGAAGTTGGG - Intergenic
1101289418 12:103352472-103352494 AAAATAATACAGAAGGAGAAAGG - Intronic
1103031033 12:117613069-117613091 AGACTAATACAGACAGATTAAGG + Intronic
1106915952 13:34514755-34514777 AGACTAATACAGTTGGGGCAGGG - Intergenic
1110588492 13:77223909-77223931 AAACTAAAACAAATGAAGTAGGG + Intronic
1111825541 13:93262959-93262981 AGAGTCATACAAATGGAGTCTGG + Intronic
1112023595 13:95392838-95392860 AGACTAATGCAACTGGAGTAGGG - Intergenic
1112101709 13:96197123-96197145 GGACTAATACAGATGTACTTTGG - Intronic
1112814228 13:103252791-103252813 AGAGTAATAAAGAGGGACTAGGG + Intergenic
1113097736 13:106683832-106683854 AAACTAATACAGACGGTGCAAGG + Intergenic
1114164934 14:20211482-20211504 AGAGTAATAGAGATGAAGTCAGG + Intergenic
1114242889 14:20885241-20885263 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114249819 14:20949179-20949201 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1117224979 14:53647282-53647304 AGAAAAATACAGAGGGAGGAAGG - Intergenic
1118296149 14:64571679-64571701 AGACTAATACAGAAGGATAAAGG - Intronic
1118402610 14:65393749-65393771 AGACTAATACAGATGCCACACGG - Intergenic
1119482560 14:74967558-74967580 AGACTAATAGAGATGGTATTTGG - Intergenic
1121985946 14:98505985-98506007 AGACCAATTTAGATGGAGCAAGG - Intergenic
1122611979 14:102990909-102990931 AGACCAATACACAGGGAGAAAGG + Intronic
1126917054 15:53477536-53477558 AGGCTAATGCAGCTGGAGTGTGG + Intergenic
1131559636 15:93428276-93428298 TGACTAATACAGATGCATCACGG + Intergenic
1131565662 15:93483327-93483349 AGACTAACACACCTGGGGTAGGG + Intergenic
1135022907 16:18977692-18977714 GGACTAATACAGTTGGTGTGAGG + Intergenic
1136121412 16:28137865-28137887 AGACTGATAGAGAGGGAGTGGGG - Intronic
1137560040 16:49496651-49496673 AGACTAATACAGATGCCCTGAGG + Intronic
1138645494 16:58421493-58421515 AGACTAATACAGATGGCCTTGGG + Intergenic
1139797788 16:69497297-69497319 AGACTAATACAGATCCTGTAAGG + Intergenic
1142839499 17:2616275-2616297 AGAATACTACTGCTGGAGTATGG + Intronic
1143857143 17:9860363-9860385 AGACTAATACAGTTGGGGACAGG - Intronic
1143987933 17:10931194-10931216 ATTCTAATAAAGATGGACTAGGG - Intergenic
1146663893 17:34683766-34683788 AGACTAATACACATGCTCTAAGG - Intergenic
1147278931 17:39341629-39341651 AGCCTAATAGTGATGGAGTGAGG - Intronic
1149342124 17:55698068-55698090 AGACTAATACAGAGAGATTTAGG - Intergenic
1150744071 17:67802206-67802228 TGACTAATACAGATTGAGGCTGG - Intergenic
1151039271 17:70839873-70839895 AGACTAATACAGATGGGAAGTGG - Intergenic
1153739149 18:8104871-8104893 AGACTAATAAAAATGGTGAAAGG - Intronic
1156042212 18:32835445-32835467 AGACTAACACAGATGGTCAATGG - Intergenic
1156759798 18:40574698-40574720 AGACTAATACAGATTTTCTATGG - Intergenic
1157004494 18:43565781-43565803 AGACTAATAAACATGTAGTTTGG + Intergenic
1157058495 18:44258192-44258214 TGACTAATGCATATGGAGTAAGG - Intergenic
1159184582 18:64952256-64952278 ACATTAAACCAGATGGAGTAGGG + Intergenic
925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG + Intronic
925437117 2:3848046-3848068 AGACTAATACAGCTGGGAAAAGG + Intergenic
925728298 2:6895897-6895919 AGGAAAATACATATGGAGTAAGG + Exonic
927318184 2:21710464-21710486 AGACTAATACAGAAAGTGTTAGG - Intergenic
928061323 2:28116165-28116187 AGGCTAATGTAGATGGAGGAGGG + Intronic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
930625558 2:53693419-53693441 AGACTGATACACATTCAGTAAGG + Intronic
931339232 2:61382492-61382514 AGTGTGATACAGAGGGAGTATGG - Intronic
931524115 2:63133786-63133808 GGACTAATACAGGTGGAATTAGG + Intronic
931547649 2:63407281-63407303 AGACTAATATAGCTAGAGAAGGG + Intronic
933706360 2:85293608-85293630 AGTCTAATACTGATGGGGCAAGG + Intronic
935080947 2:99793411-99793433 AGACTAACACACATGGAATTTGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937129432 2:119496575-119496597 AGAAGAAGACAGATGGACTAGGG + Intronic
938982031 2:136536220-136536242 AGACTAATACAGGTGGGATCCGG - Intergenic
939687545 2:145217240-145217262 GGATTAATACAGATGGATTTTGG + Intergenic
941091393 2:161181075-161181097 AGACTAATACAGCTGGCATTTGG - Intronic
941266972 2:163374533-163374555 AAGCCAACACAGATGGAGTAGGG + Intergenic
942205550 2:173616979-173617001 AGACTAAGAAACATGGACTAGGG + Intergenic
943107188 2:183560299-183560321 AGACTAATACAATTTGAGAAAGG - Intergenic
943521537 2:188957411-188957433 AGAGTGATACAGATAGAGTGGGG - Intergenic
943912878 2:193591391-193591413 AGAGTAATACAGCTGCTGTACGG + Intergenic
944667729 2:201971146-201971168 AGACTAAGACAGAGGGAGAAAGG + Intergenic
947250477 2:228097659-228097681 AGACTGCTAGAGATGGAGTGTGG - Intronic
1170273747 20:14558730-14558752 AGACTATTATACGTGGAGTAAGG - Intronic
1171171962 20:23023447-23023469 AGGCTGAGAAAGATGGAGTAGGG - Intergenic
1172361536 20:34316194-34316216 AGTCTAATACAGATGGAAAGGGG + Intergenic
1173056071 20:39614096-39614118 AGACCAATGCAGATGGGGTATGG - Intergenic
1178560190 21:33631986-33632008 AGACTGATACAGAAGAATTAGGG - Intronic
1178793524 21:35722233-35722255 AGGCTAACACAGATGGGATAAGG - Intronic
1182941625 22:34282537-34282559 AGACTAATACAGAAGGACGGGGG - Intergenic
1184061349 22:42084016-42084038 AATCTAATACAGATGGAGTGGGG - Exonic
949324147 3:2844594-2844616 AGACCAATACAGATAGATAAGGG - Intronic
952117793 3:30203419-30203441 AGACTAAGACAGTTGGAGAAAGG + Intergenic
952648696 3:35695687-35695709 AGACTTAAACAAATGTAGTAAGG + Intronic
952703178 3:36348157-36348179 AGTCTAATACAGATAAAGTCAGG + Intergenic
953918594 3:46936625-46936647 GGACATAGACAGATGGAGTAAGG - Intronic
955055088 3:55447548-55447570 AGACAAGTACAGATGGACCAGGG + Intergenic
955289627 3:57679170-57679192 AGACTAATACAGATGGTTTGTGG + Intronic
956143295 3:66167163-66167185 GGACTAATACAGATGGTAAAGGG + Intronic
956519039 3:70083470-70083492 TGACTTATACAGATGGGATAAGG - Intergenic
957446019 3:80313858-80313880 AGATTAAAAAAGATGGAGAAGGG + Intergenic
959514367 3:107248958-107248980 TGACTAATACAGAAGGAGAGAGG + Intergenic
960280101 3:115771741-115771763 TGACTGATACAGGTGGAGTTAGG + Intergenic
962033655 3:131628206-131628228 GGACTAATACAGAGGGTGTTGGG - Intronic
963936577 3:151060187-151060209 CGACCAAGACAGATGGAGTGTGG - Intergenic
964078895 3:152726937-152726959 AGACTAACACAGATGGTATTAGG - Intergenic
967595622 3:191324351-191324373 AGAGTAAGACAGATGGGATAGGG + Intronic
967736617 3:192959766-192959788 AGACTAATACAGATGGAGTAGGG - Intergenic
970395747 4:15664241-15664263 ACACTAATACAGACCTAGTATGG + Intronic
970482794 4:16494542-16494564 AGACTAAGAGAGATGGTGGATGG - Intergenic
971740208 4:30509633-30509655 TGACTAATACATATGGAAAAGGG + Intergenic
971933577 4:33117939-33117961 AGACTAATACACCTGGTGTGAGG + Intergenic
972129249 4:35809131-35809153 AGACTAATACAGATGGCGAGTGG + Intergenic
972858524 4:43137828-43137850 AGACTAATACAAATGGATAAAGG - Intergenic
972978948 4:44671999-44672021 AAACTAATACAGATGGCAAAAGG + Intronic
973242946 4:47977479-47977501 AGACTAATACAGCTGGAATTAGG + Intronic
974100048 4:57406550-57406572 AGACTAATACAGAGGGATATAGG - Intergenic
975949222 4:79747832-79747854 GGCCTAATACAGTAGGAGTAAGG - Intergenic
976306128 4:83561035-83561057 AGACTAATACAACTGGCGTCAGG + Intronic
976836477 4:89380393-89380415 AGACTAATACAGCTGGCTAAAGG - Intergenic
978774102 4:112488533-112488555 AAACTATTCCAGATGGGGTAGGG + Intergenic
980041857 4:127948959-127948981 AGACTAATACAGGTGGTTTCAGG + Intronic
980516435 4:133868230-133868252 AGACTAATACAGATGTTGTAAGG + Intergenic
980864281 4:138536233-138536255 AGACTAATACAGATATTATAAGG + Intergenic
986199172 5:5565813-5565835 AAACAAAAGCAGATGGAGTACGG - Intergenic
986805876 5:11308760-11308782 GGACTAATACAGATAGACTGTGG - Intronic
987332597 5:16870282-16870304 ACACTAATACTGGTGGAATACGG + Intronic
988389202 5:30605544-30605566 AAAATAATACAGATGGTGTTTGG + Intergenic
988915522 5:35890363-35890385 TGACTAATGCAGAAGAAGTATGG - Intergenic
989163814 5:38415670-38415692 GGACTAATACAAATGGGGTCTGG - Intronic
991989847 5:72326681-72326703 AGACTCACACAAATGTAGTAAGG - Exonic
992082574 5:73248914-73248936 AGATTAATACAGTTAGACTAGGG + Intergenic
993372470 5:87109729-87109751 AGACTTATACAGTTGGATTGGGG - Intergenic
994081974 5:95717038-95717060 AGACTAATACAGCTGGGTCATGG + Intronic
995199157 5:109408035-109408057 AGAGTAATAAAGAGGGAGAAAGG + Intronic
995952818 5:117737380-117737402 AGACTAAGAAGGATAGAGTATGG + Intergenic
996004116 5:118400609-118400631 AGACTACTAAAGAAGGAGGAAGG - Intergenic
1005261506 6:24065995-24066017 AGACTCATACAGATGATCTAGGG - Intergenic
1008051851 6:46908347-46908369 AGGCTAATACAGAATGAGTCAGG + Intronic
1008104045 6:47423891-47423913 AAACTAATACAGAGTGAGAATGG + Intergenic
1010465582 6:76164338-76164360 TGACTAATGGAGATGGAGGAAGG - Intergenic
1011348325 6:86395823-86395845 AGACTAATAAAGAAGAAGAAAGG + Intergenic
1011796307 6:90956930-90956952 AAAATAATACTGATGGACTAAGG + Intergenic
1012581549 6:100876061-100876083 AGACTGTGACTGATGGAGTAGGG + Intronic
1014349977 6:120328859-120328881 AGCCTAATTCAGAGGGATTAAGG - Intergenic
1015853099 6:137594515-137594537 AGACTAATACCAGTAGAGTAGGG - Intergenic
1016540234 6:145156550-145156572 TGACTAATACACCTGGTGTAAGG + Intergenic
1019952607 7:4385672-4385694 GGACTAATACACATGGCGTCAGG - Intergenic
1024404421 7:48962364-48962386 AGGCAAAGACAGATGGAGTCGGG - Intergenic
1028190612 7:87846485-87846507 AGACTATTACAAATCAAGTAGGG - Intronic
1028292182 7:89078908-89078930 AGATTAAAGGAGATGGAGTATGG + Intronic
1032693272 7:134310948-134310970 ATACTAATACCAATGGAGAATGG - Intronic
1034542149 7:151765089-151765111 GGACTAATACAGATGGACTGCGG - Intronic
1036399061 8:8392280-8392302 AGACTAATACATATAGAAAAGGG - Intergenic
1037038702 8:14203194-14203216 AGACTAATACAGATATATTTAGG + Intronic
1038703523 8:29873257-29873279 GGACTAATACAGAGGGAATATGG + Intergenic
1038790007 8:30659806-30659828 AGACTTATACATATGGACAATGG + Intergenic
1038938990 8:32283128-32283150 ATGCTAATAAAGATGTAGTATGG - Intronic
1039263936 8:35804177-35804199 AGACCAGTTTAGATGGAGTATGG + Intergenic
1039264975 8:35814776-35814798 TGACTAATACAAATGGGGGAAGG + Intergenic
1039828071 8:41191685-41191707 AGACTAATACAGCTGGTGAGGGG - Intergenic
1040844437 8:51822186-51822208 AGACTAGTGCAGATGAAGTTGGG + Intronic
1040973251 8:53160714-53160736 AGACTAATACAGGTAGACTATGG + Intergenic
1042015045 8:64299601-64299623 ACAGTAATACAGAAGGAGTTTGG + Intergenic
1043999540 8:86862719-86862741 TAATCAATACAGATGGAGTAAGG - Intergenic
1046851003 8:118972753-118972775 GAACTAATACACCTGGAGTAGGG - Intergenic
1047012940 8:120692130-120692152 TAACTAATACAGGAGGAGTAGGG + Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1051977204 9:22965416-22965438 ATCCTAAAACAGATGGAGTTTGG - Intergenic
1051994414 9:23197654-23197676 AGAGAAATAGAGATGGAGAAGGG - Intergenic
1053259405 9:36648915-36648937 AGATCAAAACAAATGGAGTAAGG + Intronic
1053360324 9:37482011-37482033 AGACAAACACAGAGGGAGAAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054758611 9:68984122-68984144 ATAATAATACAGAACGAGTAGGG - Intronic
1056128803 9:83564006-83564028 ACACTGATACAGATGAAGGAAGG - Intergenic
1056286073 9:85089084-85089106 AGACAAATACAGAATGAGTGGGG - Intergenic
1058652388 9:107188906-107188928 ATACTAAAAGAGATGGAGAAGGG + Intergenic
1058761460 9:108137629-108137651 AGACTAAATCAGAAGGAGTGAGG + Intergenic
1059266031 9:113031464-113031486 AGAGTAATGGAGATGGAGAATGG + Intergenic
1059719499 9:116945809-116945831 AGACTAATACAGGTGGGATGGGG - Intronic
1060379794 9:123157179-123157201 AGACTAATACAAATGGAAGATGG + Intronic
1186529295 X:10279112-10279134 TGACTAATACAGATGGCAAATGG - Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1189055018 X:37689657-37689679 AGACTGATACAAATGAAATATGG - Intronic
1189061971 X:37763951-37763973 ATAGTCATACAGGTGGAGTAAGG - Intronic
1189202846 X:39212516-39212538 GGACTAATACAGAGGGATAAGGG + Intergenic
1190169501 X:48100743-48100765 AGACTAATACAGGAGGGATATGG - Intergenic
1191722191 X:64241131-64241153 AGAGTAATGCAAATGGACTAAGG + Intergenic
1193453910 X:81705558-81705580 AGAATGATAAAGATGGAGTAAGG + Intergenic
1194455798 X:94101405-94101427 AGACTGAGACAAGTGGAGTAAGG + Intergenic
1194585310 X:95725907-95725929 AGACTAAAACAGATGAAATTTGG + Intergenic
1194591008 X:95799790-95799812 AGACAAATAAAGATTAAGTAAGG - Intergenic
1196294868 X:113985984-113986006 TGACTAATACAGAGGGGGTAAGG - Intergenic
1196840587 X:119855457-119855479 AGGCTAATACAGTTGGTGTGGGG - Intergenic
1198769860 X:140118868-140118890 AGAATAATTCAGAGGGAGTGGGG + Intergenic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic