ID: 925125751

View in Genome Browser
Species Human (GRCh38)
Location 2:1454621-1454643
Sequence GGCTCACGCTCTGCTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925125747_925125751 2 Left 925125747 2:1454596-1454618 CCCAGCAGCAGGGACAAGGCAAT 0: 1
1: 0
2: 4
3: 27
4: 235
Right 925125751 2:1454621-1454643 GGCTCACGCTCTGCTCCCACTGG 0: 1
1: 0
2: 0
3: 10
4: 155
925125748_925125751 1 Left 925125748 2:1454597-1454619 CCAGCAGCAGGGACAAGGCAATT 0: 1
1: 0
2: 0
3: 17
4: 172
Right 925125751 2:1454621-1454643 GGCTCACGCTCTGCTCCCACTGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925125751 Original CRISPR GGCTCACGCTCTGCTCCCAC TGG Intronic
900401232 1:2473774-2473796 GGCTCACCTGCTGCTCCCCCAGG - Intronic
902068689 1:13712957-13712979 GGCTCCCTCTCTGCTTCCCCAGG + Intronic
902555838 1:17246099-17246121 GGCTCAATTTCTGCTGCCACAGG + Intergenic
902699871 1:18164519-18164541 GCCTCACCCTGTTCTCCCACAGG + Intronic
903667856 1:25018745-25018767 GGCTCACCCTCTGCTCCTGGCGG - Intergenic
903904294 1:26672854-26672876 GGCTCAAGCAATCCTCCCACTGG + Intergenic
904299386 1:29544250-29544272 AACTCACACTCTGTTCCCACAGG + Intergenic
905288946 1:36908227-36908249 GCCTCAGGCTCTGCTTCCAGGGG + Intronic
905397088 1:37673873-37673895 GTCACACGCTCAGGTCCCACCGG + Intergenic
906104529 1:43284020-43284042 GGCCCACACTCTGCCCCCACAGG + Intronic
906124859 1:43421560-43421582 GGCTCACGGTCTGCTGGGACTGG - Intronic
910282975 1:85521756-85521778 GGCTCACGTCCTTCTCCTACAGG + Intronic
914207039 1:145541237-145541259 GGCTCACGTCCTTCTCCTACAGG - Intergenic
914800986 1:150962398-150962420 GGCTCAAGCGATGCTCCCAAAGG + Intronic
916041001 1:160961479-160961501 GGCTCACCTTCTGCTCCCTAAGG + Intergenic
916793171 1:168142039-168142061 GGGCCACCCTCTGCTCCCAGAGG + Intergenic
918191406 1:182178449-182178471 GGCTCAAGCGATCCTCCCACTGG + Intergenic
921010130 1:211133466-211133488 GGCTCCCGGGCTGCTCCCAGAGG - Intronic
1062971400 10:1651869-1651891 TGGGCAGGCTCTGCTCCCACTGG - Intronic
1067848436 10:49740429-49740451 GGCTCTCTGTCTGCGCCCACTGG + Intronic
1069573254 10:69507139-69507161 GGCCCAGGCTCTGCTCCCTGGGG - Exonic
1070677267 10:78420733-78420755 GTCTCAGGCTCTGGTCGCACAGG - Intergenic
1071289467 10:84177764-84177786 GGCTGTGGCTCTGCTCCCCCAGG + Intronic
1071299454 10:84245364-84245386 GGCTTCCTCTCTGCTCCCAGCGG - Intronic
1073433796 10:103503765-103503787 AGCTCATGCTGTGCTCCCCCTGG + Intronic
1077407105 11:2387581-2387603 GGCCCTCCCTGTGCTCCCACGGG + Intronic
1078184273 11:9038516-9038538 GGCTCAAGCTATTCTCCCACTGG - Intronic
1080719867 11:34838294-34838316 CCCTCACTCTCTGCTCCCAGTGG - Intergenic
1080781183 11:35431373-35431395 GCCTCACCCTCACCTCCCACCGG - Intergenic
1081143010 11:39527115-39527137 GGGTCACTCTATGCTCCAACAGG + Intergenic
1083864146 11:65444607-65444629 GGCTCAGGCTCTGCCTCCCCTGG - Intergenic
1084146165 11:67266477-67266499 GGCTCGCGCTCCGCTCCCGCCGG - Exonic
1084696877 11:70761039-70761061 GTCCCACGCTCTCCTCCCAGTGG - Intronic
1085277459 11:75309248-75309270 GGCCCAAGCCCTGCTCCCTCAGG + Intronic
1090252507 11:125261737-125261759 AGCTGATGCTCTGCTCCCTCTGG - Intronic
1091730778 12:2878470-2878492 GGCTAAGGCTCTGCTTCCTCCGG - Intronic
1092601151 12:10066321-10066343 GGCTCATGGTCTGGTCCCTCAGG + Intergenic
1095636691 12:44442560-44442582 GGCTCTCCCACTGCTCCCCCAGG - Intergenic
1097702253 12:62832050-62832072 GGCACACACTTTGGTCCCACTGG - Intronic
1100035473 12:90245823-90245845 GACTCACTCACTGATCCCACTGG - Intergenic
1102507300 12:113391823-113391845 GGCTCAAGCGATCCTCCCACAGG + Intergenic
1102569070 12:113816314-113816336 GGCTCACACTCAGCTCGCTCTGG - Intergenic
1104955893 12:132465677-132465699 GGCTCAGGCTCTGTGCACACAGG - Intergenic
1110584680 13:77175050-77175072 GGCTCAAGCAATCCTCCCACCGG + Intronic
1113943364 13:114029916-114029938 GGCTGTGGCGCTGCTCCCACAGG + Intronic
1114715290 14:24817959-24817981 GGCTCACGCTCAGGTCCAGCTGG - Intronic
1120953962 14:90065402-90065424 GGCTCAAGCTCTGCTTCTAAGGG - Intronic
1121679307 14:95779355-95779377 GGGTCTCCCTCAGCTCCCACAGG - Intergenic
1121815241 14:96923916-96923938 GGCTCAGGCTCTGTCCACACTGG + Intronic
1122696529 14:103555962-103555984 GCCTCATGCTCTGCTCCCTCAGG - Intergenic
1122823175 14:104357181-104357203 GACTCACCCTCTGCTCCCTCTGG - Intergenic
1125137333 15:36358802-36358824 GGCTCAAGCTCTCTGCCCACTGG + Intergenic
1126143537 15:45456324-45456346 GGGCCAGGCTCTGCTCTCACTGG - Intergenic
1128890463 15:71327290-71327312 GGCTCACACTGTCCTGCCACCGG + Intronic
1129460336 15:75697231-75697253 GGCTCTGCCTCTGCTCCCCCTGG + Intronic
1130081485 15:80737802-80737824 GGCTCAGGCTCTTCCCTCACTGG - Intronic
1131714297 15:95091558-95091580 GCCTCAGGTTCTGCTCCCAGTGG + Intergenic
1132313947 15:100877624-100877646 GGCTCTACCTCTGCTCCCATCGG - Intergenic
1132863264 16:2081820-2081842 GGCACGGGCTCTGCTCCCACTGG + Intronic
1133040750 16:3058805-3058827 GACTCAAGCTCTGCTCCTCCAGG + Exonic
1133269853 16:4605525-4605547 GGCTCCCAGACTGCTCCCACTGG + Intergenic
1133392230 16:5419851-5419873 GGGTCCCTCTCTGCTCCTACGGG - Intergenic
1136412284 16:30084536-30084558 GCCCCATGCTCTGGTCCCACGGG + Intronic
1137792294 16:51185336-51185358 GGCTCAGCCTCAGCTTCCACGGG + Intergenic
1137978869 16:53053424-53053446 GGCCCCCACTCTGCTCCCCCAGG - Intergenic
1138334480 16:56241853-56241875 TGCTCATGCCCAGCTCCCACAGG - Intronic
1138536639 16:57663779-57663801 GGCTCTCACTCAGCTCCCACGGG + Exonic
1139471607 16:67180766-67180788 GGCCCAGGCTCTGCTACCAGGGG + Intronic
1144760475 17:17704283-17704305 GGCTCCAGCACTGCTCCCTCTGG + Intronic
1145886503 17:28385537-28385559 GGCTTCCTCTGTGCTCCCACTGG - Intronic
1146289832 17:31599103-31599125 GGCTCTCCCTCTCCTCACACCGG - Intergenic
1147660549 17:42114737-42114759 GGCTCTTGCTCTGCTCCCTTGGG - Intronic
1147740882 17:42670355-42670377 GGCTCACGCTCTGCTGCTGCGGG - Exonic
1148464955 17:47859431-47859453 GCCTCATGCTCTGCTTCCATGGG + Intergenic
1150904639 17:69325070-69325092 GGCTCAAGCCTTCCTCCCACTGG - Intronic
1152407201 17:80104597-80104619 GGCACCCGCCCTGCTCCCACCGG + Intergenic
1154027762 18:10724451-10724473 GGCCCAGGCTCTGCTACCAGGGG - Intronic
1160810158 19:1009854-1009876 GGCGCAAGCTCTGCTCTCCCGGG + Exonic
1161687500 19:5710490-5710512 GGCTCAAGCGATCCTCCCACAGG + Intronic
1162373601 19:10292691-10292713 GGCCCAAGCTCTGGTCACACTGG + Exonic
1162399257 19:10434985-10435007 GGCTCAAGCGATGCTCCAACAGG + Intronic
1164425605 19:28138829-28138851 GTCTCACGCTCTGCTTTCATAGG - Intergenic
1166981623 19:46635023-46635045 GGCTCTCGCTCTGCCCCCGGGGG - Intergenic
1167521536 19:49958772-49958794 GGCCCACGGTCTGTCCCCACCGG + Exonic
1167523841 19:49971950-49971972 GGCCCACGGTCTGTCCCCACCGG - Intergenic
925125751 2:1454621-1454643 GGCTCACGCTCTGCTCCCACTGG + Intronic
925378523 2:3406658-3406680 GGCCCATGCTCTGTTCCCAAGGG + Intronic
932701844 2:73997525-73997547 GGCACCAGCTCTTCTCCCACTGG - Intronic
935046821 2:99490115-99490137 CGCACGCGCTCTGCTCCCCCCGG + Intergenic
935512311 2:103991244-103991266 GCCACACTCTCTGCTCCCAATGG - Intergenic
937205923 2:120237135-120237157 GGCTCATGCTCTGGCCTCACTGG - Intergenic
938973131 2:136450165-136450187 GGCTCATGCTCTCTGCCCACAGG + Intergenic
940392369 2:153147216-153147238 GGTTCACGCTCTGATCCTGCTGG + Intergenic
942329295 2:174805245-174805267 GGCTCACTCACTGCTTCCAGAGG - Intronic
945929766 2:215843047-215843069 TCCTCTCACTCTGCTCCCACGGG + Intergenic
946765772 2:223038848-223038870 GGCCCACTCTCCTCTCCCACGGG - Intergenic
1169249272 20:4047716-4047738 GTCTCAGGATCTGCTCCCAGTGG - Intergenic
1170333130 20:15237550-15237572 GGCTCAGGGTCTGTTCCCAAGGG - Intronic
1172853983 20:37987128-37987150 GCCTCAGGCTCAGCTCCCAGGGG - Intronic
1174544406 20:51314509-51314531 GGGCCACACTCTGCTCCCAGGGG + Intergenic
1175148206 20:56912406-56912428 AGCTCAGGCTCTGCTTCCAGAGG + Intergenic
1176056231 20:63150678-63150700 GGATCCTGCTCTGATCCCACTGG - Intergenic
1176411088 21:6449991-6450013 GGCACACGCTCAGCTGCCCCAGG + Intergenic
1179686581 21:43058313-43058335 GGCACACGCTCAGCTGCCCCAGG + Intronic
1180140672 21:45891916-45891938 GACTCAGGGGCTGCTCCCACTGG - Intronic
1181662578 22:24363434-24363456 GCCTCAAGCTATGCTCTCACTGG + Intronic
1183699971 22:39445789-39445811 GGCACAAGGCCTGCTCCCACCGG - Intergenic
1184737438 22:46407723-46407745 TGCTCAGGCACGGCTCCCACAGG + Intronic
1184932340 22:47690610-47690632 GCCTCACGCTCAGCTCACAGAGG - Intergenic
1185327746 22:50235368-50235390 GGCTCAGGCTCCTCTCCCCCTGG - Intronic
953860132 3:46537222-46537244 GGCTCAAGCGATCCTCCCACAGG + Intronic
956134258 3:66083270-66083292 GGCCCACTCTCAGCTCCTACAGG - Intergenic
961213179 3:125141337-125141359 GGCCCACCATCTGCTCCCAAGGG + Intronic
967552400 3:190811910-190811932 GGCTAACCCTGTGCTTCCACTGG + Intergenic
968513481 4:1005306-1005328 GGCTCACCCCCCGCCCCCACCGG - Intergenic
973605001 4:52577866-52577888 GGGTCAGACTGTGCTCCCACCGG - Intergenic
974664265 4:64937506-64937528 TGCTCACACTCTCCTCCCAAGGG - Intergenic
984218509 4:176944370-176944392 GGACCACTCTCAGCTCCCACAGG + Intergenic
992413758 5:76533107-76533129 GGCTTAAGCTCCTCTCCCACAGG - Intronic
997199928 5:132003726-132003748 GGCTCTCACTTTGCACCCACTGG + Intronic
997431347 5:133843317-133843339 GGCTCACTCTCTGCTCCTAGAGG + Intergenic
1001089752 5:168728685-168728707 GGCTCAAGCAGTCCTCCCACTGG - Intronic
1003148961 6:3532516-3532538 GGCTCCCGTTCTGCTCTCAACGG - Intergenic
1005215178 6:23518395-23518417 GGCTCAAGCAATCCTCCCACTGG + Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1010413081 6:75582828-75582850 GGGTCTCGCTCTGCCCCCCCAGG + Intergenic
1011624405 6:89271562-89271584 AGCTCCCGCTCTGCCCACACAGG + Intronic
1013286784 6:108689008-108689030 GCCTCAAGCTATCCTCCCACTGG - Intergenic
1013997205 6:116322472-116322494 GGCAGAGGCTCTGCTCCCTCTGG - Intronic
1019164679 6:170090148-170090170 GGCACTCCCTCTGCTCCCAGGGG + Intergenic
1019186586 6:170224046-170224068 GGCTCACCCTGAGCTCCCTCTGG - Intergenic
1022507042 7:30913864-30913886 GCCACAAGCTCTGCACCCACTGG - Intronic
1023195637 7:37635767-37635789 GGCTCATGCTCAGCTCTCGCTGG + Intergenic
1023907194 7:44531300-44531322 GGCTCACCCTAGCCTCCCACTGG + Intronic
1024683238 7:51716684-51716706 GGCTCAAGCAATCCTCCCACTGG - Intergenic
1026849468 7:73716013-73716035 GGGCCAGGCTCTGCCCCCACAGG + Intronic
1026925567 7:74190470-74190492 GGCTCAAGTCCTGCCCCCACAGG - Intronic
1028466588 7:91159585-91159607 GGCACATCCTCTGCTCCCATCGG - Intronic
1029300588 7:99579936-99579958 GGCCCGCGCTCTTCACCCACAGG - Intronic
1029449426 7:100632644-100632666 GGCTCAAGCGATCCTCCCACCGG + Intronic
1035271555 7:157722826-157722848 GGGTGGGGCTCTGCTCCCACGGG + Intronic
1035570634 8:670449-670471 GGCTCACCCTTTGCTCCGCCAGG + Intronic
1037320162 8:17633930-17633952 GGCTCACACTGTCCTCGCACTGG + Intronic
1040001472 8:42580294-42580316 AGCTCAAGCTCTGCCCACACTGG - Intergenic
1040596451 8:48842012-48842034 GACTCATGCTTTGCTCCCAGGGG - Intergenic
1042055316 8:64758082-64758104 GGCTCAGGCTCTGCTTTCAGGGG + Intronic
1043323776 8:79024598-79024620 TGCTAAAGCTCTGCTCCCATGGG - Intergenic
1049454203 8:142678713-142678735 GGCCCAAGCTCTGCTGCCAGTGG - Intronic
1049714187 8:144082205-144082227 GGCTCACGCTGTGACTCCACTGG + Intergenic
1053310370 9:37014554-37014576 GGCTCAAGCTCTGCCCAAACTGG + Intronic
1056405152 9:86266820-86266842 GGCTCAAGCGATCCTCCCACAGG + Intronic
1059416866 9:114167857-114167879 TGCTGAGCCTCTGCTCCCACCGG + Exonic
1059468294 9:114483641-114483663 GGCTCAAGCTCTGCTGCCTGAGG - Intronic
1060938571 9:127530189-127530211 CTCTGACGCTCTGCTGCCACAGG + Intronic
1061816794 9:133202170-133202192 AGCTCACACTTTGCTGCCACCGG - Intergenic
1061853344 9:133428783-133428805 GGCTCGCGCGCCCCTCCCACGGG - Intronic
1062238385 9:135523429-135523451 AGCCCACTCTCTTCTCCCACTGG + Intronic
1186287780 X:8064659-8064681 GGGTCACTCTCAGCTCCCAGTGG - Intergenic
1186805771 X:13139182-13139204 GGCCCCCGCCCTGCTCTCACAGG + Intergenic
1187365160 X:18660803-18660825 GCCTCACTCTCTGCTCACAAGGG + Intronic
1195941842 X:110173685-110173707 GGCTCTCTCTCTGCTCCTAGTGG + Exonic
1196348523 X:114698063-114698085 GGGCCATGCTCTGCTCCTACAGG + Intronic
1196867909 X:120086208-120086230 GGGTTAAGCTCTGCTACCACTGG + Intergenic
1196875193 X:120150073-120150095 GGGTTAAGCTCTGCTACCACTGG - Intergenic
1197701627 X:129604404-129604426 GGCTCACCATCTGCTGCCAGAGG + Intergenic
1199858111 X:151776912-151776934 CACCCACCCTCTGCTCCCACAGG + Intergenic