ID: 925130756

View in Genome Browser
Species Human (GRCh38)
Location 2:1492606-1492628
Sequence CAGAACTGGGAGAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925130756_925130760 5 Left 925130756 2:1492606-1492628 CCTGGCTATTTCTCCCAGTTCTG 0: 1
1: 0
2: 2
3: 22
4: 239
Right 925130760 2:1492634-1492656 TCTAAACATGAGACACCAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925130756 Original CRISPR CAGAACTGGGAGAAATAGCC AGG (reversed) Intronic
901957497 1:12797261-12797283 CAGATCTTGGAAAAACAGCCTGG - Intergenic
905174554 1:36127426-36127448 CAGAATTGGGGGCAATTGCCAGG + Intergenic
907877780 1:58510602-58510624 CAGCACTGGGAGTCCTAGCCAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908002419 1:59693709-59693731 CAGAACTGGGAAAGCTGGCCAGG + Intronic
908907546 1:69034034-69034056 CAGAACTTGATGAAATAACCTGG - Intergenic
913083888 1:115416170-115416192 CAGCACTGGGAGAGATAGACAGG + Intergenic
914709461 1:150199764-150199786 CAGATGTGGTAGAAATAGCAAGG - Intergenic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915766269 1:158365693-158365715 CAGGACTGGGACAGACAGCCTGG - Intergenic
915962523 1:160279079-160279101 GAGAATGGGGAGAAACAGCCTGG - Exonic
916066663 1:161141480-161141502 CAGAACTGATAGAAAAAGTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916517182 1:165530277-165530299 CTATACTGGGAGAAGTAGCCAGG + Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
919110971 1:193217889-193217911 CAGTACTGGAAGTACTAGCCAGG + Intronic
920253667 1:204639336-204639358 CTAAAATGGGAGTAATAGCCGGG + Intronic
920356228 1:205375250-205375272 CAGCAGTGGGAGAATTGGCCTGG + Intergenic
921378884 1:214503970-214503992 GAGAAGTGTGAGAAATAGTCAGG + Intronic
922224790 1:223636930-223636952 CAGAAGTGGGAGAAAAAGGGGGG - Intronic
923435364 1:233963232-233963254 CACAATGGGGAGAAATAGACTGG - Intronic
924833889 1:247628730-247628752 AATAACTAGGAGAAATACCCAGG - Intergenic
1065210515 10:23398101-23398123 CAGAACTCAGAGAAATACCTAGG + Intergenic
1065323066 10:24526626-24526648 CAGAGCTGGCAGAAAAACCCAGG - Intronic
1068281496 10:54876640-54876662 CAGATGTGGTAGAAATAGCAAGG + Intronic
1068936377 10:62639324-62639346 CAGAACTGGGACAAATGGGTAGG + Intronic
1069832029 10:71287433-71287455 CAGAACTGGCAGATAGAGCTGGG - Intronic
1072634214 10:97166938-97166960 CTGACCTGGTAGAAAAAGCCTGG - Intronic
1074806582 10:117059566-117059588 CAAAACTTGGAGGAATATCCAGG + Intronic
1075613547 10:123874157-123874179 TAGAAATGTGAGAAATAGGCTGG - Intronic
1076131811 10:128018695-128018717 CTGATCTGGGAGAACTGGCCGGG - Intronic
1076349621 10:129807162-129807184 CAGAACTGGGAGAAACAGCAAGG - Intergenic
1078181345 11:9014207-9014229 CAGAACTGGGATACAAATCCAGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1079187277 11:18248793-18248815 CACAACTGGGATAAATGACCCGG - Intergenic
1079189524 11:18266080-18266102 CACAACTGGGATAAATGACCCGG + Intergenic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082221507 11:49643889-49643911 CAGCACTGGGAGAAACAATCTGG - Intergenic
1082779712 11:57277572-57277594 CAGAACTGGGATTAAAACCCAGG - Intergenic
1082828649 11:57599029-57599051 CAGAAATGGGAGAAACAGCTAGG - Intronic
1084701684 11:70790365-70790387 CATAACTGGGTGCTATAGCCTGG - Intronic
1085462003 11:76699805-76699827 CACAGATGGGAGAAACAGCCAGG + Intergenic
1086571715 11:88292629-88292651 CAGCACTGGAAGGCATAGCCAGG - Intergenic
1086627537 11:88975264-88975286 CAGCACTGGGAGAAACAATCTGG + Intronic
1087567828 11:99884985-99885007 CAAAACAGGGAGAAAAATCCAGG + Intronic
1088028485 11:105216587-105216609 CAGAACTGGGATTAAAACCCAGG - Intergenic
1088549109 11:110992343-110992365 CAGAGCTGGGAGAAGAACCCAGG - Intergenic
1089219995 11:116862863-116862885 CAGAAGTTCGAGACATAGCCTGG + Intronic
1090154796 11:124425836-124425858 CAGATCTTGGAGAAATTCCCAGG - Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091456014 12:608546-608568 CAGAACTGGGAGTCAAACCCAGG + Intronic
1092172264 12:6381357-6381379 CAGAGAGGAGAGAAATAGCCTGG + Intronic
1092730450 12:11527923-11527945 CAGAAATGGGGGAAGTCGCCGGG - Intergenic
1094013136 12:25830109-25830131 CAGAATTGGGGAAAAGAGCCTGG - Intergenic
1098498045 12:71159793-71159815 AGGAACTGGGAGAAACTGCCAGG - Intronic
1101234492 12:102775033-102775055 CAGCACTGACAGAAAAAGCCAGG - Intergenic
1102406156 12:112676089-112676111 CAGACTGGGGAGAAATATCCTGG + Intronic
1102952135 12:117038088-117038110 CAGGACTGCCAGAAAGAGCCAGG + Intergenic
1103316148 12:120057385-120057407 AAGAAGTGGGAGAGTTAGCCAGG - Intronic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1105819007 13:24063118-24063140 GAGCACTGGGAGAAGGAGCCTGG - Intronic
1106237702 13:27878535-27878557 CAGACCTGGGAGATATAGACAGG - Intergenic
1107772785 13:43806510-43806532 CAAAAATGGGATAAATGGCCGGG - Intergenic
1108147175 13:47490587-47490609 CAGAACTCAGAGAAACAGCAGGG + Intergenic
1109310095 13:60683437-60683459 CAGAACTGGGATTAATAGCCAGG - Intergenic
1113077449 13:106480983-106481005 CAGCCCTTGGAGAAATAGCGGGG - Intergenic
1114289239 14:21273959-21273981 TAGAACTGGGAGAGATAGCTGGG + Intergenic
1118322466 14:64761380-64761402 CTGAACAGGGGGAAAGAGCCAGG + Intronic
1118338031 14:64871274-64871296 CAAATCTGGGAGAAATGGTCAGG + Intronic
1118375287 14:65171527-65171549 CATAATTTGGAGAAATAGCCTGG + Intergenic
1119328868 14:73779088-73779110 TAGAACAAGAAGAAATAGCCGGG + Intronic
1119829160 14:77685566-77685588 CAGAAGTTGGAGAACCAGCCTGG + Intronic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1122030235 14:98906716-98906738 CAGGACGGAGACAAATAGCCTGG + Intergenic
1125351314 15:38770388-38770410 CAGAACTGGGACAAGAATCCAGG - Intergenic
1125569275 15:40702980-40703002 CAAAACTGGTAGAAATGGTCAGG - Intronic
1126547889 15:49892556-49892578 TAGAACTGGGATAAATAGTGAGG + Intronic
1127760916 15:62138264-62138286 CAGAACTGGGATTCAAAGCCAGG - Intergenic
1127799135 15:62462665-62462687 CAGAGCTGGAGGAAATGGCCTGG + Intronic
1128393466 15:67199123-67199145 CAGATCTGGGAGGCATAACCAGG - Intergenic
1130174474 15:81554058-81554080 CAGAGCTGGTAGAAATCACCAGG - Intergenic
1130843771 15:87725525-87725547 CAGGACTGGGAGAGAGAGCTGGG - Intergenic
1132272296 15:100537094-100537116 CAGAACTGGGAGAACTACTTGGG + Intronic
1133945319 16:10343134-10343156 CAGAACAGGGTGCAATAGCAGGG - Intronic
1135102282 16:19616562-19616584 CAGCCCTGAGAGAAATAGCCTGG - Intronic
1135743968 16:24999886-24999908 CAGCACTGGGGAAAATAGCCAGG - Intronic
1137619068 16:49864512-49864534 CAGGCCTGGGAGAAATACCATGG + Intergenic
1137677341 16:50310228-50310250 GAGAACTGGGAGATGGAGCCGGG + Intronic
1139871000 16:70108588-70108610 CAGAACTGGGTGTAATAGGTAGG + Intergenic
1139909841 16:70391020-70391042 CAGAACTGGCATAAAAAGCAAGG - Intronic
1140375873 16:74445285-74445307 CAGAACTGGGTGTAATAGGTAGG - Intergenic
1140761568 16:78113562-78113584 CAGAAAAGTGAGAACTAGCCAGG - Intronic
1141077926 16:81025182-81025204 CAAAACTGGGAGTAAAATCCAGG + Intronic
1141835182 16:86533894-86533916 CAGCACTGGGAGACAGAGCCAGG - Intronic
1142592171 17:1011042-1011064 GGGAACAGGGAGAGATAGCCTGG + Intronic
1144016372 17:11200222-11200244 CAGATCTGAGACAAATACCCAGG - Intergenic
1144227032 17:13159291-13159313 CAGAACAGGGAGAGTTAGCGAGG - Intergenic
1144684577 17:17217406-17217428 CAAAACTGGGAGAAAGATCTTGG - Intronic
1144785637 17:17830064-17830086 CAGAACTTGGAACCATAGCCTGG + Intronic
1145842370 17:28006610-28006632 CAGAGCTGGGATAAAAAACCAGG + Intergenic
1146565979 17:33913096-33913118 GAGAACTGGCAGAAATTGGCGGG - Intronic
1147695427 17:42348820-42348842 CTAAACTGGGAGAAACAGGCTGG - Intronic
1153575986 18:6522464-6522486 CAGAACTGAAAAAAATATCCAGG - Intronic
1154295574 18:13144109-13144131 CAGAACTGTGAGAAAAAGGCAGG - Intergenic
1155412444 18:25561611-25561633 CAGAACTGGGAGGGATTCCCAGG + Intergenic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157417166 18:47513398-47513420 CAAAAATGGGGGCAATAGCCAGG + Intergenic
1157446852 18:47752825-47752847 CAGAGCTGGGAGGAAGAACCAGG + Intergenic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1161931097 19:7340955-7340977 CAAAAGTGGGAGAAAAGGCCAGG + Intergenic
1163725112 19:18918813-18918835 AAGCTCTGGGAGAAATAACCAGG + Intronic
1165762237 19:38328182-38328204 CTGAACTATGAGAAATAGGCAGG + Exonic
1166566194 19:43767051-43767073 CAGTACTGGGGAAAGTAGCCTGG + Exonic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
925380274 2:3420014-3420036 CATAACTGGGTGAAATATCCAGG - Intronic
927105831 2:19824327-19824349 CAGATGTGGTAGAAATAGCAAGG - Intergenic
927240943 2:20919136-20919158 CAGAAATGGGTGAGATGGCCTGG - Intergenic
927951826 2:27175611-27175633 TAGAACGGGGAGAAGGAGCCAGG - Intergenic
928281925 2:29954350-29954372 CAGAAGTGGGAGGAAAAGCTGGG + Intergenic
928369407 2:30730367-30730389 CAGAAATGGTAGAAATGGTCAGG - Intronic
929129669 2:38554701-38554723 CAGAGCTGGGATAAGCAGCCAGG + Intergenic
930947697 2:57095371-57095393 CATAACTGGCAGAAAGAGCAAGG - Intergenic
931014595 2:57961866-57961888 CAGAAGTTGGAGACACAGCCTGG + Intronic
932408403 2:71529368-71529390 CAGTACTTGGACAAATGGCCTGG - Intronic
932710125 2:74056921-74056943 CACAACTTGGAGAAATGGGCTGG + Intronic
935104087 2:100023525-100023547 CAGAAGAGGGAGAAACAGCAAGG + Intronic
938657585 2:133450218-133450240 CAGAACAGGGAAGATTAGCCTGG - Intronic
939883684 2:147658213-147658235 CAGAACAGAAAGAAAAAGCCTGG - Intergenic
940092069 2:149931769-149931791 TAGATTAGGGAGAAATAGCCTGG - Intergenic
940756161 2:157685425-157685447 CAGAACTGGGAGTAAAATCGTGG - Intergenic
943705826 2:191033159-191033181 CAGAAATTGGAGAAATATACAGG + Intronic
943786952 2:191887768-191887790 CGGAAATGGGAGCAATAGCTAGG + Intergenic
944570416 2:201039044-201039066 CAGAGCTGGGAGAGAATGCCAGG - Intronic
944910551 2:204306483-204306505 TAAAAATGGGAGAATTAGCCGGG - Intergenic
945054135 2:205853293-205853315 CAAAAGTGGGCAAAATAGCCCGG + Intergenic
945381130 2:209142138-209142160 CAGAACTGGGAGAGACAGCTAGG + Intergenic
946614835 2:221498190-221498212 AATACCTGGGAGAAAGAGCCAGG + Intronic
947521683 2:230850359-230850381 CAGACTTTGGAGGAATAGCCTGG + Intergenic
948011857 2:234655261-234655283 CTGCACTGGGAGAGAGAGCCCGG + Intergenic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1177689280 21:24482898-24482920 TAGAAAAGGGAGAAATAGACCGG - Intergenic
1178024916 21:28455469-28455491 CAGCACTGGGAGAGCCAGCCTGG + Intergenic
1179002954 21:37481271-37481293 ATGAAGTGGGAGAAAAAGCCAGG - Intronic
1179040183 21:37795944-37795966 CAAAACTGGGAGAAATCCCAGGG - Intronic
1182961050 22:34475606-34475628 CAGAGCTGCAAGAAATAGCATGG - Intergenic
1183067785 22:35375439-35375461 CAGATCTGGGAGGTATAGTCAGG + Intergenic
1183374330 22:37454222-37454244 CAGCACTTGGAAAAATAGACAGG + Intergenic
1183622910 22:38985193-38985215 CAGAACTGTGGGAAGTGGCCAGG - Intronic
1183802121 22:40175750-40175772 TAGCACTGAGTGAAATAGCCAGG - Intronic
949488690 3:4566546-4566568 GAGAGTGGGGAGAAATAGCCAGG + Intronic
949802557 3:7919751-7919773 CAGAACTGGGGAAGATATCCTGG - Intergenic
950897500 3:16466974-16466996 CAGATGTGGGAGAAAGAGACTGG + Intronic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953167830 3:40481402-40481424 TAGAAAGGGGAGAAATATCCAGG + Intronic
954401040 3:50319816-50319838 CAGAACTGGGAGAGCTACACAGG - Exonic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
954833175 3:53440694-53440716 AAGAACTCAGAGAAATGGCCAGG - Intergenic
954936249 3:54329542-54329564 CAGAACTGGGACAAACATCTTGG - Intronic
956529323 3:70200359-70200381 CAGAAGTCAGAGAAATAGGCAGG - Intergenic
957950481 3:87119855-87119877 AAGAACTTGGACAAATAGGCTGG - Intergenic
960126399 3:114003379-114003401 AATAACTGTAAGAAATAGCCTGG - Intronic
961926905 3:130490989-130491011 CAGTACAGAGAAAAATAGCCAGG + Intergenic
962012337 3:131404042-131404064 CAGATGTGGGAGAACTAGACAGG + Intergenic
962467748 3:135675945-135675967 AAGACCTGGGAGAAATAGAAAGG - Intergenic
963243156 3:143031023-143031045 CAGATATGGTAGAAATAGCAAGG + Intronic
963492668 3:146020559-146020581 AAGAAGTGGGAGAAATACACAGG + Intergenic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
965578550 3:170243797-170243819 CAGAACTAAGAGAAGTAGCTGGG - Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969156241 4:5212643-5212665 CAAATGTGGGAGAAATTGCCTGG - Intronic
969331483 4:6475726-6475748 AAGCACAGGGAGACATAGCCTGG - Intronic
970383971 4:15537689-15537711 CAGCCCTGGGAGAAATTTCCTGG + Intronic
971705203 4:30032777-30032799 CAGAGATGTGAGAAATAGCCAGG + Intergenic
972166693 4:36294264-36294286 AACAACTGGGAGAAATAGAGAGG - Intronic
972200672 4:36710965-36710987 CAGAACTGTGATAGATAGCTGGG - Intergenic
972639770 4:40914908-40914930 CAGAACTAGGACAAAAACCCAGG - Intronic
975088530 4:70372864-70372886 AAGAACTGGAAGAAATCGGCTGG + Intronic
976686187 4:87818332-87818354 CATAACTGGGAGAATAATCCAGG - Intergenic
976687715 4:87833948-87833970 CAGAACTGGGATTAGTATCCAGG - Intronic
977799538 4:101210199-101210221 GGGAACTTGGAGAAATAGTCTGG - Intronic
980474323 4:133291991-133292013 TAGAACAGGGAGATAGAGCCTGG + Intergenic
981595894 4:146421454-146421476 CTATACTGGGAGAAATGGCCTGG - Intronic
981782317 4:148443431-148443453 CATAAGTGGGAGAAACAGACAGG + Intronic
983106889 4:163697576-163697598 AAGAACTGCAAGAAATAGGCAGG + Intronic
985957720 5:3277175-3277197 CAGAACTCTGAGAAAGAGACGGG + Intergenic
986132384 5:4943169-4943191 AAGAAATGCGAGAAAGAGCCTGG + Intergenic
986181665 5:5398744-5398766 CAAAGATGGAAGAAATAGCCTGG - Intergenic
988738285 5:34044574-34044596 CAGAACTGTCAAAACTAGCCTGG + Intronic
989200873 5:38762125-38762147 CAGAACTGGGATCAAAACCCAGG + Intergenic
989510038 5:42275753-42275775 AAGAACTGGGAAAAATATTCTGG - Intergenic
989592918 5:43128713-43128735 CAAAACTGGGATAAATATCTGGG - Intronic
990413163 5:55561236-55561258 GAGAAAAGGGAGAAATACCCTGG + Intergenic
990767987 5:59208963-59208985 CAGCAATGGAAGAAAAAGCCTGG + Intronic
991699019 5:69299852-69299874 CAGAACTGGAAGAACCAACCTGG + Intronic
992777383 5:80100377-80100399 TAGAACTGGGAAAATTGGCCGGG - Intergenic
994789438 5:104205523-104205545 CAGGACTGGGACAGACAGCCTGG - Intergenic
997132174 5:131287946-131287968 CAAAAATGGGAGAAGTGGCCGGG + Intronic
998711675 5:144832919-144832941 CAGAATTTGAAGAGATAGCCAGG - Intergenic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1004338393 6:14784893-14784915 CAGAACTGTGAGAACTAGCAAGG + Intergenic
1005012508 6:21349258-21349280 AAGAACTGGGAGAGAGAGCATGG - Intergenic
1005809145 6:29502989-29503011 CAGAGCTGGGAGAGAAAGCCTGG - Intergenic
1007315275 6:40983209-40983231 TAGAACAGGGAGAAATAACAGGG - Intergenic
1010064890 6:71670789-71670811 CAGATGTGGGAGAAATAGCAAGG + Intergenic
1010131479 6:72499494-72499516 CAGAATGGGGAGAACAAGCCAGG + Intergenic
1011841046 6:91499452-91499474 CAGAACTGGGAGAAAAAAAATGG - Intergenic
1011906335 6:92373446-92373468 CACAACTGAGAGAAAAAGGCAGG - Intergenic
1013414827 6:109915585-109915607 CAGATATGGTAGAAATAGCAAGG + Intergenic
1013463141 6:110394699-110394721 CAGAGCTGGGATATAAAGCCAGG - Intronic
1016377678 6:143440322-143440344 TAGAACTGGGAGTAAGAGACTGG - Intronic
1019172065 6:170138202-170138224 CAGGACTGGGAGGAACAGGCGGG + Intergenic
1019178200 6:170171485-170171507 CAGAACAGGGAGGAACAACCCGG - Intergenic
1020083497 7:5298494-5298516 CAGAAGTGTGAGAGAGAGCCAGG + Intronic
1021419525 7:20429912-20429934 AAGAAGTGGGAGAAATTGCTAGG + Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1022330915 7:29378013-29378035 CAGACTTGGTAGAAATACCCAGG - Intronic
1023905092 7:44516305-44516327 CAGAACTGGGAGTATTTGGCCGG + Intronic
1024094132 7:45970998-45971020 CAGAAATAGGAGAAACAGACTGG - Intergenic
1025210783 7:57018702-57018724 CAGAACTGTGAGAGACAGCCAGG - Intergenic
1025661173 7:63558145-63558167 CAGAAGTGTGAGAGACAGCCAGG + Intergenic
1027184591 7:75963338-75963360 CAGAAGTGGCAGAAACACCCTGG - Intronic
1027517649 7:79162686-79162708 CATAATTGGGATAAATACCCAGG - Intronic
1029306834 7:99625756-99625778 CAGAACAGTCAGAAATGGCCAGG - Intronic
1030189260 7:106794404-106794426 CAGCACTGGGCCAAAGAGCCAGG + Intergenic
1032475597 7:132209513-132209535 CAGAAATCTGAGAAATAGCCTGG + Intronic
1033087047 7:138352405-138352427 TAAAGCTGGGAGAAATAGGCTGG - Intergenic
1036158820 8:6367611-6367633 CATATCTGGGATAAATAGCCAGG + Intergenic
1038941968 8:32314940-32314962 CAGAACAGTCAGAATTAGCCTGG - Intronic
1039014892 8:33136151-33136173 CAGAAAGGGGAGAAATAGAATGG - Intergenic
1041161228 8:55046112-55046134 CAGACCTGGAAGAAATTCCCAGG + Intergenic
1042723203 8:71845789-71845811 CAGAGCTGGCAGAGATAGCTGGG + Intronic
1042880012 8:73477070-73477092 AAGAACTGGAAGAATTAACCGGG + Intronic
1043420989 8:80098513-80098535 CAGATGTGGCAGAAATAGCAAGG + Intronic
1044071024 8:87759891-87759913 CTGAGCTGGGAGAAAGAGCTGGG - Intergenic
1046452250 8:114408550-114408572 CATATCAGGGAGAAACAGCCTGG - Intergenic
1047409312 8:124611255-124611277 CAAGATTGGGAGAAAGAGCCAGG + Intronic
1047906373 8:129477237-129477259 CAGAACTGTGAGAAATAAATGGG + Intergenic
1049180579 8:141220029-141220051 CCGAACGGGGAGAAAAACCCTGG - Intronic
1050022308 9:1296972-1296994 CAGAACTGGAAGAAATAATATGG + Intergenic
1052649269 9:31279476-31279498 AAAAACTGGGAGAAAAAGCAGGG - Intergenic
1055347280 9:75352228-75352250 CAGTACTGAGAGCAATAGCGGGG + Intergenic
1055799546 9:80019796-80019818 TAGGACTGGGAGAGATATCCAGG + Intergenic
1056274403 9:84979384-84979406 CAGAAGTGGTGGAAATAGCAAGG + Intronic
1056545227 9:87607244-87607266 CAGAACTGGGATCAAAATCCAGG + Intronic
1057729604 9:97597250-97597272 CAAAACTGGGAGTAAAAGCTGGG - Intronic
1057957424 9:99422498-99422520 CAGAACTGGGATAAAAAACTGGG + Intergenic
1058014987 9:100021160-100021182 CACAACTCTGAGAAATGGCCTGG - Intronic
1185691432 X:2158325-2158347 CAGAATTGGAAGACATACCCAGG + Intergenic
1185923134 X:4115961-4115983 CAGGAGTTGGAGAAACAGCCTGG - Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187313205 X:18166574-18166596 CAGGACTGGGAGATTTAGGCAGG + Intronic
1187483706 X:19681993-19682015 CAGAGCTGAGAGAAAGAGCCAGG + Intronic
1188159853 X:26785563-26785585 AATTACTGGGAGAAATAGACTGG + Intergenic
1188874898 X:35417634-35417656 CAGAAATGGAAGAAAAAGCGAGG - Intergenic
1194035136 X:88861569-88861591 CAGGACTCTGAGAAAAAGCCAGG + Intergenic
1194084990 X:89515649-89515671 CAGATCGGGAAGCAATAGCCTGG - Intergenic
1194483021 X:94450544-94450566 CAGAAAGGGAAGAAATAGCCAGG + Intergenic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195953465 X:110303314-110303336 CACAACTGGGGGAAAAAGTCAGG - Intronic
1196228637 X:113195069-113195091 CAGAACTGGGGTAACTGGCCTGG - Intergenic
1197641389 X:128972005-128972027 CAGAACTGGGAGACCAAGTCAGG + Intergenic
1198698593 X:139371060-139371082 AAGAACTTGGAGAAATCCCCAGG - Intergenic
1199746243 X:150773473-150773495 CAAAACTGGGTGAGATGGCCAGG - Intronic
1200437639 Y:3171534-3171556 CAGATCGGGAAGCAATAGCCTGG - Intergenic