ID: 925139066

View in Genome Browser
Species Human (GRCh38)
Location 2:1537561-1537583
Sequence GGGGGTGTTGAACACAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925139066 Original CRISPR GGGGGTGTTGAACACAGTTG GGG (reversed) Intronic
900739373 1:4321433-4321455 AGAAGTGTTGAGCACAGTTGGGG + Intergenic
902771578 1:18648219-18648241 GGGGGTGGGGAAAACAGCTGTGG - Intronic
903650588 1:24919304-24919326 GGGGTTGGTGAACACAGTGATGG + Exonic
906669899 1:47646727-47646749 GCCCCTGTTGAACACAGTTGGGG + Intergenic
908093043 1:60706821-60706843 TGGGGTCTTGAACAAAGTAGTGG - Intergenic
908258054 1:62318773-62318795 GGGGGTGGAGAACACTGGTGAGG - Intronic
910046985 1:82929413-82929435 GAGGGTGTTGAGCAGAGTTAGGG + Intergenic
910790197 1:91042808-91042830 GGGAGTGTTGAACAAGGATGTGG - Intergenic
911374297 1:97032029-97032051 GGGGATGTTGATCACAGGGGAGG + Intergenic
913128651 1:115816829-115816851 GTGGGTGGTGAATAGAGTTGGGG - Intergenic
915532184 1:156509046-156509068 GGGGGTGGAGAACACTGTTCTGG + Intergenic
919928226 1:202203908-202203930 GGGGGTGTTTAGCACAGAGGGGG + Intronic
920538396 1:206757838-206757860 GGCAGTGTTGAGCTCAGTTGAGG - Intergenic
921800652 1:219399122-219399144 GTGGGTGTTCACCACAGTGGTGG + Intergenic
921848550 1:219909294-219909316 GGGGCTGAAGAACACAGTGGTGG + Intronic
923813875 1:237352191-237352213 GGCAGTGTTGAATAAAGTTGGGG + Intronic
1068837368 10:61569509-61569531 GGGAGAGTTGAACGCAGATGTGG + Intergenic
1071882121 10:89910978-89911000 GTGGGTGTTCACCACAGTGGTGG + Intergenic
1072631131 10:97147314-97147336 GGGGATGTTGAAAACATTTTGGG + Intronic
1072960347 10:99923676-99923698 GGTGGTGAGGAACACAGTGGAGG - Intronic
1076046297 10:127296780-127296802 GGGGGTGCTCTTCACAGTTGTGG + Intronic
1076295144 10:129378293-129378315 GGGGGTGGGGAAAACAGTGGTGG - Intergenic
1076562986 10:131379560-131379582 GGGCCTGGTGAACACAGTTCTGG - Intergenic
1083543829 11:63534528-63534550 GGGGCAGGTGAACACAGATGTGG - Intergenic
1092096869 12:5850061-5850083 GAGGGTGTTATACACAGATGAGG - Intronic
1092578374 12:9814136-9814158 CGGGGTGTAGAACACCTTTGGGG - Intergenic
1093385378 12:18547324-18547346 GGGGATGTCGTACACACTTGGGG + Intronic
1098392113 12:69980592-69980614 GGGGTTGTTGGAAACATTTGCGG + Intergenic
1098444732 12:70554738-70554760 GGGAGGGGTGAAGACAGTTGAGG + Intronic
1102970101 12:117159741-117159763 GTGTGTGTGGAACACAGTGGAGG - Intronic
1106638391 13:31556562-31556584 TGGGGTGTAGAACACAGCAGAGG + Intergenic
1106862984 13:33931331-33931353 GGGGCTGTTAAACACAGGAGCGG + Intronic
1113175228 13:107556187-107556209 TGGGGTATTGGACACAGATGTGG + Intronic
1113782841 13:112986528-112986550 AGGGGTGTTTAAGACAGTGGCGG + Intronic
1114905803 14:27124624-27124646 GGGGGTGAGGAAGACAGTTAAGG - Intergenic
1115027264 14:28759780-28759802 AGGGGTATTGAACCCAGTGGGGG - Intergenic
1120554636 14:85914603-85914625 GGGGATGTTGATAACGGTTGAGG - Intergenic
1121343030 14:93116163-93116185 GGGGGTGCTGAACCCTGCTGGGG - Intronic
1121976142 14:98405720-98405742 GGTGGTGAGGAAAACAGTTGAGG - Intergenic
1122723628 14:103736164-103736186 GGGTGTGATGAACAAAGGTGTGG - Exonic
1124077832 15:26462409-26462431 GTGGGTGTTCACCACAGTGGTGG - Intergenic
1125046856 15:35251565-35251587 GGGGATGTGGTACACAGGTGTGG - Intronic
1128471864 15:67961350-67961372 GGGGGACTTGACCACAGCTGGGG - Intergenic
1130336380 15:82960388-82960410 GTGTGTGTTGAACAGAGGTGGGG + Intronic
1132008854 15:98256361-98256383 GGAGGTGTTGAAAACCTTTGAGG - Intergenic
1133292213 16:4729890-4729912 TGGGGCTTTGCACACAGTTGTGG - Intronic
1135600895 16:23782380-23782402 GGGGGTGTTGATGACAGATGGGG - Intergenic
1135706981 16:24683557-24683579 GTTGGTGATGAACACAGCTGTGG - Intergenic
1136613681 16:31382449-31382471 GGAGCTGTTGAAGACAGGTGGGG - Exonic
1141166288 16:81663143-81663165 AGGTGTGTTGAACTCATTTGGGG - Intronic
1148000912 17:44386427-44386449 GGAGGTGTTGTACAGAGTTTAGG - Intronic
1148407519 17:47430326-47430348 GGGGGTGTTGCACATAGTGGTGG + Intronic
1150832864 17:68539854-68539876 GGGATTGTTGAACACACGTGGGG + Intronic
1153910962 18:9706674-9706696 CGGGATGTAGAACACAGTGGAGG + Intergenic
1156331305 18:36126423-36126445 GACAGTGTTGTACACAGTTGAGG + Exonic
1160090959 18:75826158-75826180 GGGGGTGTTGAACAAAGACTTGG - Intergenic
924971844 2:135604-135626 GGGAGTGTTACACACAGGTGGGG + Intergenic
925135381 2:1522788-1522810 TGGGGGGTTGCACACAGTGGTGG - Intronic
925135439 2:1523015-1523037 GGGGAGGTTGCACAGAGTTGGGG - Intronic
925135446 2:1523044-1523066 GGTGAGGTTGCACACAGTTGGGG - Intronic
925135529 2:1523355-1523377 GGGGAGGTTGAACACAGTGGGGG - Intronic
925135603 2:1523645-1523667 GAGGAGGTTGAACACAGTGGGGG - Intronic
925135625 2:1523729-1523751 GGGGGGGTTGCACACAGTGGGGG - Intronic
925135666 2:1523899-1523921 GGGGAGGTTGATTACAGTTGGGG - Intronic
925135778 2:1524355-1524377 GGGGAGGTTGAACAGAGTGGAGG - Intronic
925135803 2:1524441-1524463 TGGGGGGTTGCACACAGTGGGGG - Intronic
925135831 2:1524550-1524572 GGGGGGGTTGCACACAGTGGGGG - Intronic
925135892 2:1524802-1524824 GGGGAAGTGGCACACAGTTGGGG - Intronic
925135944 2:1525026-1525048 GGGGAGGTTGCACAGAGTTGGGG - Intronic
925135968 2:1525111-1525133 GGGGAGGTTGCACACAGTTTGGG - Intronic
925136035 2:1525415-1525437 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136044 2:1525443-1525465 GGGGGTGTTGCAAACAGTGGGGG - Intronic
925136077 2:1525554-1525576 GGGGGGTTTGCACACAGTGGGGG - Intronic
925136184 2:1525999-1526021 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136245 2:1526219-1526241 GGGGGTGTTGCACACATCGGGGG - Intronic
925136283 2:1526356-1526378 TGGGGGGTTGCACACAGTGGGGG - Intronic
925136305 2:1526437-1526459 GGGGAGGTTGCACACAGTTGGGG - Intronic
925136317 2:1526490-1526512 GCGGGGGTTGCACACAGTGGCGG - Intronic
925136337 2:1526605-1526627 GGGGAGGTTGCACAGAGTTGGGG - Intronic
925136351 2:1526662-1526684 GGGGAGGATGAACACAGTTTGGG - Intronic
925136498 2:1527233-1527255 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136647 2:1527854-1527876 GAGGAGGTTGAACACAGTGGGGG - Intronic
925136835 2:1528658-1528680 GGGGAGGTTGCACACAGTGGTGG - Intronic
925136886 2:1528856-1528878 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136898 2:1528912-1528934 GTGGGGGTTGCACACAGTGGGGG - Intronic
925136938 2:1529079-1529101 GGAGAGGTTAAACACAGTTGGGG - Intronic
925136944 2:1529107-1529129 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136990 2:1529277-1529299 GGGGAGGTTGCACACAGTGGGGG - Intronic
925136999 2:1529305-1529327 GGGGACGTTGCACACAGTGGGGG - Intronic
925137006 2:1529333-1529355 GGGGAGGTTGCACACAGTGGGGG - Intronic
925137023 2:1529389-1529411 GGGGATGTTGCAGACAGTGGGGG - Intronic
925137215 2:1530172-1530194 GGGGAGGTTGGACACAGTGGGGG - Intronic
925137260 2:1530343-1530365 GGGGACGTTGCACACACTTGGGG - Intronic
925137294 2:1530516-1530538 GGGGGGGTTGCACAGAGTGGGGG - Intronic
925137390 2:1530883-1530905 GGGGAGGTTGCACACAGTGGGGG - Intronic
925137443 2:1531081-1531103 GGGGAGGTTGCACACAGTGGGGG - Intronic
925137452 2:1531109-1531131 GGGGAGGTTGCACACAGTGGGGG - Intronic
925137461 2:1531137-1531159 GGGGAGGTTGCACACAGTGGGGG - Intronic
925137508 2:1531309-1531331 GGGGAGGTTGAACACAGTTGGGG - Intronic
925137529 2:1531396-1531418 GGGGAGGTTGAACACAGTGGGGG - Intronic
925137692 2:1532085-1532107 GTGGGGGTTGCACACAGTGGGGG - Intronic
925137740 2:1532283-1532305 GTGGGGGTTGCACACAGTGGGGG - Intronic
925137807 2:1532564-1532586 GGGGAGGTCGCACACAGTTGGGG - Intronic
925137835 2:1532652-1532674 GAGGAAGTTGTACACAGTTGGGG - Intronic
925137951 2:1533124-1533146 GGGGACGTTGCACACAGTGGGGG - Intronic
925138038 2:1533446-1533468 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138064 2:1533532-1533554 GGGGAGGTTGCACAAAGTTGGGG - Intronic
925138189 2:1534046-1534068 GGGGAGGTTGAACACAGTGGTGG - Intronic
925138371 2:1534834-1534856 GGGGGGGTTACACACAGTGGGGG - Intronic
925138408 2:1535007-1535029 GGGGAGGTTGTACACACTTGCGG - Intronic
925138415 2:1535036-1535058 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138511 2:1535412-1535434 GGGGAGGTTGCACACAGTAGGGG - Intronic
925138619 2:1535832-1535854 GGGGAGGTTGCACACAGTTTGGG - Intronic
925138631 2:1535885-1535907 GGGGGGGTTGCACACATTCGGGG - Intronic
925138709 2:1536159-1536181 GGGGGGCTTGAACACATTGGGGG - Intronic
925138726 2:1536216-1536238 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138752 2:1536302-1536324 GGGGAGGTTGCACAAAGTTGGGG - Intronic
925138840 2:1536647-1536669 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138879 2:1536818-1536840 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138888 2:1536846-1536868 GGGGAGGTTGAACACAGTGGCGG - Intronic
925138933 2:1537033-1537055 GGGGAGGTTGCACACAGTGGGGG - Intronic
925138990 2:1537258-1537280 GGGGAGGTTGCACACAGTGGGGG - Intronic
925139066 2:1537561-1537583 GGGGGTGTTGAACACAGTTGGGG - Intronic
925139167 2:1537979-1538001 GGGGGGGTTGCACAGAGTGGGGG - Intronic
925975449 2:9138952-9138974 GGGGGTTCTGAACACAGTGTGGG - Intergenic
928069769 2:28202943-28202965 GGGGGTGGAGGACACAGGTGAGG - Intronic
930743675 2:54859604-54859626 GTGGGTGTTGAGCACAGGAGGGG + Exonic
931889989 2:66661435-66661457 GCGGGTGTTCACCACAGTAGTGG + Intergenic
933387378 2:81628680-81628702 AAGGGTGTTGAGCCCAGTTGCGG + Intergenic
933750533 2:85600021-85600043 GGGGGAGGAGAGCACAGTTGAGG + Intronic
934616499 2:95774621-95774643 TGGGGTTTTGAACACAGTCCTGG - Intergenic
934644394 2:96049939-96049961 TGGGGTTTTGAACACAGTCCTGG + Intergenic
934810969 2:97276210-97276232 TGGGGTGTTTCACCCAGTTGAGG - Intergenic
934826723 2:97431729-97431751 TGGGGTGTTTCACCCAGTTGAGG + Intergenic
934837810 2:97606029-97606051 TGGGGTTTTGAACACAGTCCTGG + Intergenic
940047814 2:149428392-149428414 GCAAGGGTTGAACACAGTTGGGG + Intronic
941929285 2:170924491-170924513 TCTGGTGTGGAACACAGTTGTGG - Intergenic
948551487 2:238775714-238775736 GAGGGTCTTGAACACAGGAGTGG + Intergenic
1169087032 20:2833281-2833303 GGGGATATTGAGCACATTTGAGG + Intergenic
1172056178 20:32155686-32155708 GAGGATTTTGAACTCAGTTGTGG + Intronic
1172434658 20:34920538-34920560 GGGTGTGGTTCACACAGTTGGGG + Exonic
1173202021 20:40961330-40961352 TGGGGTGTTGAGCCCAGTTGAGG - Intergenic
1185322560 22:50208764-50208786 GGGTGTCTTCAACACAGGTGGGG - Intronic
951809474 3:26683534-26683556 GGGGATGTTGAACTCAAATGAGG + Intronic
952633293 3:35495987-35496009 GGGGATGTTGATCACAGAAGAGG - Intergenic
955854292 3:63256270-63256292 GGGGGTCATGGACACACTTGAGG - Intronic
956703105 3:71976289-71976311 GGGGCTGTTGCATACAGTGGAGG + Intergenic
957768761 3:84660391-84660413 GGGGGTGGGCAACAAAGTTGGGG - Intergenic
958654583 3:96984493-96984515 GGGGGTGTGGGACCCACTTGAGG + Intronic
959171331 3:102847831-102847853 TGGGGTCTTGAAGACAGTGGAGG + Intergenic
961047508 3:123719812-123719834 GGGGGAGATGATCACAGTGGAGG - Intronic
961651469 3:128418638-128418660 GGGGGTGCTGGGCAGAGTTGGGG - Intergenic
962744297 3:138386220-138386242 GGGGGTTTTGAGCAGGGTTGGGG - Intronic
962747857 3:138410860-138410882 GGGGGTGTTAACCACAGCAGGGG - Intergenic
969305961 4:6326474-6326496 GGGGGCGTTGAAGCCTGTTGTGG + Intronic
969838178 4:9860400-9860422 GAGGGTGTTGAACGAAGATGGGG + Intronic
970159881 4:13177742-13177764 GGGTGTGTTGAGCACATTTGTGG - Intergenic
972201418 4:36718090-36718112 GGGAGTGTTGAACAAGGATGTGG + Intergenic
973645800 4:52950321-52950343 GGTGGTGTTGAATGCAGTTGGGG + Intronic
973683028 4:53340661-53340683 GGGGGTGAGGGACACACTTGAGG - Intronic
975638850 4:76478646-76478668 GGGGGTCATGAACCCACTTGAGG - Intronic
976614008 4:87057876-87057898 GGGGATGTTGAAGACAGCGGTGG - Intronic
978537318 4:109775696-109775718 GGGGGTCATGAACCCACTTGAGG - Intronic
982489803 4:156015300-156015322 GGGGGTGGTGCTGACAGTTGGGG - Intergenic
982527089 4:156491473-156491495 GGGAGAGTTGAACACAGGTGTGG - Intergenic
987012267 5:13779686-13779708 AGGGGAGTTGACCACAGATGTGG - Intronic
990372926 5:55138814-55138836 GAGGTTGGTGAACAGAGTTGAGG + Intronic
991566558 5:68010877-68010899 GGGGGTGCTGCACAGAGCTGAGG - Intergenic
996685093 5:126270963-126270985 GGGGATGTTGAAAAAAGTTTTGG + Intergenic
996825446 5:127676896-127676918 GGGAGAGTTGAACAGAGATGTGG - Intergenic
998770538 5:145539308-145539330 TGGCGTGTTGCACACATTTGGGG - Intronic
1001414420 5:171534635-171534657 GGGGGCGATGGACACAGCTGGGG - Intergenic
1001576608 5:172768840-172768862 GGGGAAGTTGAACACGGTGGTGG + Exonic
1002454631 5:179339074-179339096 CAGGGTGGTGAACACGGTTGTGG - Intronic
1003423241 6:5977065-5977087 GAGGGTGGTGATCACAGATGAGG - Intergenic
1003723559 6:8733509-8733531 GGGGAGGGTGAAAACAGTTGTGG + Intergenic
1004277763 6:14253503-14253525 GGGGGTGGTGAAAACAGGTAGGG + Intergenic
1005952454 6:30641981-30642003 GGGAATGTGGAACACTGTTGAGG - Intronic
1011216896 6:85014744-85014766 GAAGGTGGTGAACACAGCTGAGG + Intergenic
1012986270 6:105879419-105879441 GGGCGTGGTGAATACAGTAGTGG + Intergenic
1012989643 6:105911914-105911936 AGGGGTTTTTAACACACTTGGGG + Intergenic
1016885794 6:148958404-148958426 GTTGCTGTTGCACACAGTTGTGG + Intronic
1018107454 6:160502734-160502756 GGGGGAGTTGAACAGGGATGTGG + Intergenic
1021516714 7:21497264-21497286 GAGGGGGTGGAACACAGCTGAGG - Intronic
1022649694 7:32263076-32263098 GGGTGTGTTGAACACATTCCGGG - Intronic
1023863079 7:44227027-44227049 GGGGGTGTGGAAGACAGAGGGGG + Intronic
1024958374 7:54950018-54950040 GGGAGGGTTGAACAGAGATGTGG + Intergenic
1026602676 7:71789488-71789510 GGGCTTGTTAAACACAGATGGGG - Intronic
1029313855 7:99693346-99693368 GGGGGTCAGGAACACATTTGAGG + Intronic
1030069910 7:105689517-105689539 GGGGGTGATTGACACAGCTGGGG + Intronic
1030634726 7:111935931-111935953 TGGGGAGTTGAACTCAGTTGGGG - Intronic
1033126419 7:138711108-138711130 GGGGGTGTGGGAAACAGCTGAGG - Intronic
1033375223 7:140754558-140754580 GGGAGCATTGAACACAGTGGTGG - Intronic
1041288816 8:56288533-56288555 AGGGGTATTGAACACATTTATGG - Intergenic
1045672795 8:104575326-104575348 GTGGGTGTTCACCACAGTGGTGG - Intronic
1048448067 8:134507488-134507510 GGTGCTGTTGAACACAGTCGTGG - Intronic
1048677574 8:136800635-136800657 GGGGGTGGTGATGACAGTGGGGG + Intergenic
1051158815 9:14182658-14182680 GGGGGTGTTGAGCAAAGTGATGG - Intronic
1051781886 9:20697814-20697836 GAGGATGTTGAACACAGTGGAGG + Intronic
1054474664 9:65564242-65564264 GTGGGTGTTGGACACAGTGTTGG + Intergenic
1055016020 9:71618939-71618961 GAGGGTGATAAACAGAGTTGAGG + Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1062423639 9:136496245-136496267 GGGGGTGTTGTCCACAGGCGAGG + Exonic
1191153313 X:57243415-57243437 GGGGGTTATGGACCCAGTTGAGG - Intergenic
1191601716 X:63016384-63016406 GGGGGTGTAGGACCCACTTGAGG + Intergenic
1196751413 X:119121008-119121030 GGGGGTGTTGGATACAGTTAGGG - Intronic
1198716907 X:139567426-139567448 GGGAGTTTTGCACAGAGTTGTGG - Intergenic