ID: 925139614

View in Genome Browser
Species Human (GRCh38)
Location 2:1540809-1540831
Sequence CGGAGTAAACAGAAATATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925139614_925139617 9 Left 925139614 2:1540809-1540831 CCTGCATATTTCTGTTTACTCCG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 925139617 2:1540841-1540863 GTCCGTTCTGCACCTTCCTCCGG 0: 1
1: 0
2: 2
3: 6
4: 140
925139614_925139618 10 Left 925139614 2:1540809-1540831 CCTGCATATTTCTGTTTACTCCG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 925139618 2:1540842-1540864 TCCGTTCTGCACCTTCCTCCGGG 0: 1
1: 0
2: 0
3: 15
4: 226
925139614_925139620 13 Left 925139614 2:1540809-1540831 CCTGCATATTTCTGTTTACTCCG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 925139620 2:1540845-1540867 GTTCTGCACCTTCCTCCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925139614 Original CRISPR CGGAGTAAACAGAAATATGC AGG (reversed) Intronic
901141896 1:7040219-7040241 CAGATTAAATTGAAATATGCTGG - Intronic
902306712 1:15545983-15546005 CGGCGTAAATAAAAATAAGCTGG - Intronic
903730147 1:25487645-25487667 TGGAGTAAACAGAAAAATAAGGG - Intronic
903917039 1:26772202-26772224 CGGAGTGAAGAGAAATAGCCAGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906856460 1:49311343-49311365 CGAAGAATACAGAGATATGCAGG + Intronic
908954270 1:69602198-69602220 TGGAGAAAACAGAAAGATTCTGG - Intronic
909264164 1:73535642-73535664 AGCAGAAAACAGAAAAATGCAGG - Intergenic
911858679 1:102915869-102915891 GTGAGTAGACAGAAATATGCAGG + Intronic
913537727 1:119790275-119790297 TGGAGCAAAAAGAAATCTGCAGG - Intergenic
915304174 1:154968559-154968581 AGGAGTAACCTGAAATTTGCTGG - Exonic
915774459 1:158467553-158467575 CCCAGTAAACAGAAAAATGAGGG + Intergenic
917794004 1:178519950-178519972 TGAAGCAAACATAAATATGCAGG + Intronic
918265263 1:182836491-182836513 GGGAGTGATCAGAAATATGAGGG + Intergenic
923824723 1:237487791-237487813 TGGAATAAACTGAAATATGCAGG - Intronic
1063233857 10:4091935-4091957 TGGAGTAAACTGAAACATGGAGG - Intergenic
1063380735 10:5583950-5583972 CGGAGGAAACAGGAATGTCCTGG + Intergenic
1063856551 10:10260688-10260710 GGGAGGGAACAGAAATAGGCTGG - Intergenic
1066067112 10:31770449-31770471 CAGAACAAACAGAAATGTGCAGG + Intergenic
1070602151 10:77873481-77873503 CGGGGTAAACAGAATTATCAGGG - Intronic
1080767531 11:35310420-35310442 AGAAATAAACAGAAATAAGCTGG - Intronic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1084134459 11:67166076-67166098 GGCAGTAAACAGAAGTATTCAGG + Intronic
1085152406 11:74262713-74262735 CTGAGTACACAGCAATCTGCAGG + Intronic
1088024586 11:105162517-105162539 AGGAGTAGACAGAAAAATGGTGG - Intergenic
1090990193 11:131810286-131810308 GGGAGTAAGAAGAAATATGAGGG - Intronic
1091529087 12:1337374-1337396 CGAAGCAAACAGAAAAAAGCAGG - Intronic
1095378503 12:41560111-41560133 CGGAAAAAACAGAAATAGGGAGG - Intronic
1096025592 12:48358402-48358424 TGGAGAAAACAGAACTAGGCTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098795633 12:74885398-74885420 TGGCATAAACAGACATATGCAGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099473255 12:83076380-83076402 GTGAGTAAAAAGAAATATGTTGG - Intronic
1100328946 12:93568180-93568202 GGGAGGAAAGAGAAATGTGCAGG + Intergenic
1101719257 12:107336960-107336982 CTGAGAATTCAGAAATATGCAGG - Intronic
1106488380 13:30192899-30192921 CTCAGTAAACAGAAATCAGCCGG + Intergenic
1107772552 13:43804841-43804863 TGGTGTTAACAGAAATATTCAGG + Intergenic
1112754664 13:102618011-102618033 TGGTTTAAACAGAAATAAGCTGG - Intronic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117911304 14:60640922-60640944 GTGATTAAACAGAAAAATGCAGG - Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124700536 15:31908320-31908342 CGGAGTGAGCAAAAATTTGCTGG - Intergenic
1125344175 15:38702319-38702341 GAGAACAAACAGAAATATGCAGG - Intergenic
1125706572 15:41742525-41742547 CGCTGCAAACAGAAATTTGCAGG - Exonic
1126664536 15:51064415-51064437 TGGACTAAACAAAACTATGCAGG - Intronic
1127548404 15:60012093-60012115 CTGAGTAAATAAAAATATACAGG - Intronic
1127554743 15:60076773-60076795 CAGTGTCAACAGAAAAATGCCGG + Intergenic
1133062002 16:3180850-3180872 GGGAGAACACAGATATATGCCGG - Intergenic
1137230680 16:46563355-46563377 GAGAGCAACCAGAAATATGCAGG - Intergenic
1138046731 16:53732756-53732778 ATGGGTAAACAGAAATCTGCTGG - Intronic
1142331468 16:89456830-89456852 CGGGGGGAACAGAAATATCCTGG + Intronic
1144736166 17:17556677-17556699 CAGAGGCAACAGAAATTTGCAGG - Intronic
1147471172 17:40663138-40663160 AGAAGAAAACAGAAAAATGCTGG + Intronic
1147899160 17:43772590-43772612 GTGAGTCAACAGAAACATGCTGG - Intronic
1147973030 17:44230037-44230059 AGGAGTAACCTGAAATTTGCTGG - Intergenic
1148433287 17:47660831-47660853 GGGAGGAAACAGAAAAATGTAGG - Intronic
1148842822 17:50509690-50509712 CTCAGTAAACAAAAATAGGCTGG - Intronic
1150805293 17:68313977-68313999 CGGAGTAAAAAGAGATATGTAGG - Intronic
1152559641 17:81071575-81071597 CGGAAGCAACAGAAATATCCAGG + Intronic
1154145599 18:11863750-11863772 TGGAGGAAACAGAAATGTGCAGG + Intronic
1154417154 18:14184568-14184590 GAGAGCAATCAGAAATATGCAGG + Intergenic
1158631407 18:59118192-59118214 CGCAGTAAACATACATATGCAGG - Intergenic
1162090114 19:8274045-8274067 CTGAGAAAACAGAAATCAGCAGG + Intronic
1162092348 19:8288908-8288930 CTGAGAAAACAGAAATCAGCAGG + Intronic
1165886295 19:39081411-39081433 TGGCGTAAATAGAAATATACAGG - Intergenic
925139614 2:1540809-1540831 CGGAGTAAACAGAAATATGCAGG - Intronic
925333912 2:3079075-3079097 CGGACTAAGCAGAAATGTCCAGG - Intergenic
925560559 2:5188881-5188903 CGGAATAAACTCAAAGATGCAGG + Intergenic
927317007 2:21695582-21695604 AGGAGAAAAAAGAAATATCCTGG - Intergenic
929989387 2:46772678-46772700 CGGTGTAAACAGAAACATCCAGG - Intergenic
932711204 2:74064920-74064942 AGAAGTCAACAGATATATGCAGG + Intronic
934500094 2:94852704-94852726 GAGAGCAATCAGAAATATGCAGG - Intergenic
941275628 2:163487099-163487121 AGCAGTAAACAGAAAGATGTGGG - Intergenic
942681200 2:178479998-178480020 CGAAGCAAACAGAAATAGGAAGG + Intergenic
1174462369 20:50691748-50691770 TGGAGTAAACAGAAACTTCCAGG - Intergenic
1176856175 21:13974696-13974718 GGGAGCAATCAGAAATATGCAGG - Intergenic
1176868422 21:14069554-14069576 GAGAGCAATCAGAAATATGCAGG + Intergenic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1179311088 21:40196708-40196730 AGGAGAAAACAGAAAAAAGCAGG - Intronic
1179952822 21:44720696-44720718 GTGAGTAAAGAAAAATATGCTGG + Intergenic
1182345356 22:29659927-29659949 AGGAGTAAAAAGATTTATGCTGG + Intronic
956814962 3:72899884-72899906 AGAAGGAAACAGAAATATGTGGG - Intronic
957119920 3:76076975-76076997 CGAATTAAACAGAAAAATACTGG - Intronic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
970725408 4:19038187-19038209 TTTAGTAAACAAAAATATGCAGG - Intergenic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971867002 4:32185313-32185335 CAGGGCAAACAGAACTATGCAGG - Intergenic
972729414 4:41778847-41778869 CAAAATATACAGAAATATGCTGG + Intergenic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
976034994 4:80807102-80807124 CTGAATGAACAGAAATCTGCAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976970468 4:91096155-91096177 CTGAGAAAGCAGCAATATGCTGG - Intronic
977046301 4:92072297-92072319 AGGAGAAAACAGAAAGATGTGGG - Intergenic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
978400339 4:108324301-108324323 CGAATTAAACAGAGATATGATGG - Intergenic
978958710 4:114648171-114648193 CTGAGTAAGCTGAAATATGTTGG - Intronic
979813676 4:125071739-125071761 GGGGGTAAATAGAAATAAGCTGG + Intergenic
982263678 4:153518869-153518891 TGGAGTAAACAGAAAAGGGCAGG - Intronic
982448722 4:155526364-155526386 CGAAGGAAACAGAAAAAGGCTGG - Intergenic
983989368 4:174098834-174098856 AGAAGTAAAAAAAAATATGCTGG + Intergenic
986683297 5:10252716-10252738 TGGATAAAACAGAATTATGCTGG - Intronic
987931589 5:24406491-24406513 GGGAGTTAACAGAAATATTTTGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
995779337 5:115759116-115759138 TGCAGTGAACAGATATATGCAGG - Intergenic
997707748 5:135974442-135974464 CAGGGTAAACAGAAATTTTCAGG + Intergenic
1002795525 6:468198-468220 CTGAATAAACAGAAATGTGATGG + Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004825672 6:19418062-19418084 GGGAGTAAACAGTAATTTGTTGG - Intergenic
1006220749 6:32488502-32488524 AGAATTAAACAGAAATATCCAGG + Intergenic
1007474128 6:42107633-42107655 CTGGGTAAACAGAAATTGGCAGG - Intronic
1013759615 6:113501504-113501526 CGGAATAAATAGAAATATTCTGG + Intergenic
1013834335 6:114315297-114315319 CGGAATAAAAAGAAATGTGATGG - Intronic
1014497788 6:122148248-122148270 CTGAGTATAAAGAAATATCCAGG + Intergenic
1020509168 7:9031094-9031116 AGGAGTAAACAGAACTGTCCTGG + Intergenic
1025641488 7:63376321-63376343 TGGAGAAAACAGAAACATGCAGG + Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1035676173 8:1457434-1457456 CCGAGTATAGATAAATATGCTGG - Intergenic
1037133685 8:15437326-15437348 TGTAGTAAACAGAGATATGTAGG - Intronic
1040405160 8:47094409-47094431 TGCAGTAAACACACATATGCAGG - Intergenic
1043204858 8:77425481-77425503 AGGAGAAGACAGAAAGATGCAGG + Intergenic
1053907441 9:42857129-42857151 GAGAGCAATCAGAAATATGCAGG + Intergenic
1054369197 9:64374115-64374137 GAGAGCAATCAGAAATATGCAGG + Intronic
1054527519 9:66148391-66148413 GAGAGCAATCAGAAATATGCAGG - Intronic
1054676827 9:67863862-67863884 GAGAGCAATCAGAAATATGCAGG + Intronic
1056059085 9:82863973-82863995 ATGAGTAAAAAGAAATCTGCAGG - Intergenic
1057997904 9:99836544-99836566 TGGGGGAAACAGAAATATGTAGG + Intronic
1058148055 9:101433249-101433271 GGCAGTAAACAGAAAAATGGAGG - Intronic
1203560930 Un_KI270744v1:57187-57209 GAGAGCAATCAGAAATATGCAGG - Intergenic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186678357 X:11844855-11844877 CGGAGTGCACAGAAATTTGTGGG - Intergenic
1186891983 X:13968043-13968065 CAGAGTAAACACTGATATGCTGG - Intergenic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1193674532 X:84433627-84433649 CTGAGTAAAAAGAACAATGCAGG - Intronic
1195343825 X:103928769-103928791 CGGAGGATACAGAACTAGGCAGG - Intronic
1196701097 X:118669663-118669685 CTGAGTACACAGAAACATTCAGG + Intronic
1199085638 X:143627532-143627554 TGGTGTGAACAGAAATATTCTGG - Exonic
1201859575 Y:18581898-18581920 GGTAGAAAACAGAAATATGCTGG + Intronic
1201873746 Y:18738483-18738505 GGTAGAAAACAGAAATATGCTGG - Intronic
1202167479 Y:22005746-22005768 GGTAGAAAACAGAAATGTGCTGG - Intergenic
1202169340 Y:22024674-22024696 GGGAGAAAACTGAAATGTGCCGG - Intergenic
1202222022 Y:22561691-22561713 GGGAGAAAACTGAAATGTGCCGG + Intergenic
1202223881 Y:22580623-22580645 GGTAGAAAACAGAAATGTGCTGG + Intergenic
1202319234 Y:23615038-23615060 GGTAGAAAACAGAAATGTGCTGG - Intergenic
1202321093 Y:23633976-23633998 GGGAGAAAACTGAAATGTGCCGG - Intergenic
1202549674 Y:26036080-26036102 GGGAGAAAACTGAAATGTGCCGG + Intergenic
1202551535 Y:26055019-26055041 GGTAGAAAACAGAAATGTGCTGG + Intergenic