ID: 925139823

View in Genome Browser
Species Human (GRCh38)
Location 2:1542455-1542477
Sequence GGCTGCCGAGAGCCCTCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925139821_925139823 -9 Left 925139821 2:1542441-1542463 CCGGGATACTCACAGGCTGCCGA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925139823 2:1542455-1542477 GGCTGCCGAGAGCCCTCTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925139823 Original CRISPR GGCTGCCGAGAGCCCTCTGA GGG Exonic
900595839 1:3479773-3479795 GCCTCCCGACAGCCCTGTGATGG + Intronic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
900665292 1:3811056-3811078 GGCTGCCCACTGCCCTCTGCTGG + Intergenic
900809425 1:4790120-4790142 GGCTGCCGAGAGCCATGTATGGG + Exonic
900870096 1:5296219-5296241 GAATGCCAAGAGCCCTCTGTAGG + Intergenic
903383981 1:22914978-22915000 GGCTCCTGAGTGCCCTCAGATGG + Intronic
903649507 1:24914280-24914302 GGCTGCCGAGTGGCTTCAGATGG - Intronic
903694813 1:25198939-25198961 GGGTCCCCAGAGCCCTTTGATGG - Intergenic
904249528 1:29213164-29213186 GCCAGCCAAGAGCACTCTGAGGG + Intronic
904316649 1:29670303-29670325 TGCAGCCAAGAGCCCTGTGATGG - Intergenic
904823235 1:33258239-33258261 GGCTGCCGAGGGGGATCTGAAGG + Intronic
906197596 1:43938598-43938620 AGCTGGCAAGAGCTCTCTGAAGG + Intergenic
910277424 1:85464530-85464552 GGCTGCCGGCAGCCTTCTGGAGG - Intronic
910876905 1:91886264-91886286 GGCGGCCGAGAGCCCCCGGTGGG - Exonic
920008720 1:202852442-202852464 TGCTGCGGAGAGGCCTGTGAAGG + Intergenic
922579367 1:226685601-226685623 GGCTGCAGGGAGGCCTGTGAGGG - Intronic
1063504078 10:6580365-6580387 GGCTGGCGAGCGCCCCCTGGCGG - Intergenic
1063544810 10:6970629-6970651 GACTGCAGAGAGCACTCGGAAGG - Intergenic
1066733251 10:38451643-38451665 GGCTGCCGAGAGCCATGAGCTGG - Intergenic
1070912735 10:80132595-80132617 GGGTGCCGAGGGGCCTCTGGAGG + Intronic
1072021844 10:91410336-91410358 GGCAGCCCAGAGCCCTCTCGCGG + Exonic
1072344576 10:94490937-94490959 AGCTGCAGAGAGTCCTCTCAAGG - Intronic
1072533387 10:96340471-96340493 GGCAGCAGAGCGCCCTCTGATGG + Intergenic
1075114351 10:119613393-119613415 GGCAGGCCAGAGCCCTCTGTAGG - Intergenic
1075700253 10:124464666-124464688 CACTGCCCAGAGCCCTCTGCTGG - Intronic
1075737368 10:124672296-124672318 GGCTGTTGAGAGCCCAGTGAGGG - Intronic
1075960215 10:126562091-126562113 GGCTGCCCAGAGGCCACTGCAGG + Intronic
1076191633 10:128487438-128487460 GGGTCCGGAGAGGCCTCTGAGGG - Intergenic
1076360287 10:129883604-129883626 GGCTGCAGAGAGCCCTATTCCGG + Intronic
1076510516 10:131011132-131011154 GGCTGCGGATGGCCCTCTGAGGG + Intergenic
1076512418 10:131022138-131022160 GGCTGCCAAGACCCCTCAGCAGG + Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076674886 10:132142602-132142624 GGCTGGCGGGTGCCCTCTGCGGG + Intronic
1077011053 11:379552-379574 GGCTGCCGGGAGCCCGCGTAGGG + Exonic
1078920641 11:15827057-15827079 GGCAGCAGAGAGCTATCTGAGGG + Intergenic
1080467454 11:32511071-32511093 AGCTGCAGAGAGACCTCTAAGGG - Intergenic
1084516827 11:69642074-69642096 GGCTGCCGGGAGCCCGCGGGAGG + Intronic
1102197685 12:111036151-111036173 GGCTGGCGAAAGCCCTTTGCAGG + Intronic
1103745599 12:123121095-123121117 GTCAGCAGAGAGGCCTCTGAGGG - Intronic
1104395561 12:128429482-128429504 GGCTGCTAAGAGCTCTCTGCTGG + Intronic
1105626979 13:22122174-22122196 GGCTGCAGTGAGCTCTATGATGG - Intergenic
1112338978 13:98537208-98537230 GCCTGATGGGAGCCCTCTGAGGG - Intronic
1119159528 14:72441552-72441574 GGCTGGCGAGGGCCCTGGGATGG - Intronic
1119855398 14:77896617-77896639 TGCTGCCAAGGGCCATCTGAGGG + Intronic
1121261497 14:92569495-92569517 GGCTGCTCAGGGCCGTCTGAGGG + Intronic
1121436717 14:93925476-93925498 GGCTGAAGAGAGCGCCCTGAGGG - Intronic
1122483992 14:102065986-102066008 GGCAGCCCTGTGCCCTCTGATGG - Intergenic
1122548016 14:102535494-102535516 TGCTGCCCTGACCCCTCTGAGGG + Intergenic
1122847026 14:104505793-104505815 GGCTGCCGAGAGCCCCCGCCTGG + Intronic
1122894946 14:104752203-104752225 GGCTGCCGAGCGCCCCCGGGCGG - Intergenic
1127732099 15:61810915-61810937 GGCTGCGCAGACCTCTCTGAGGG + Intergenic
1127997724 15:64163215-64163237 GGCGGCCGGGAGCCCAATGAGGG - Intergenic
1128163302 15:65438948-65438970 GGGTCCCGAGAGCCTACTGAGGG + Intergenic
1128226646 15:66006363-66006385 GCTGGCCTAGAGCCCTCTGAGGG + Intronic
1128563252 15:68682405-68682427 GGATTCCCAGAGGCCTCTGATGG - Intronic
1128711023 15:69872100-69872122 GGCTGCCTGAAGCCCTCTGCAGG + Intergenic
1130990894 15:88875079-88875101 GGCAGCGGAGGTCCCTCTGATGG - Exonic
1136713996 16:32262443-32262465 GGCTGGCAGGGGCCCTCTGAAGG - Intergenic
1137009783 16:35311005-35311027 GGCTGGCAGGAGCCTTCTGAAGG + Intergenic
1137579302 16:49623589-49623611 GGCTGCTGAGAGTCCTTTCACGG - Intronic
1137618657 16:49861401-49861423 GTCTGCTGAGAGCCCTATGGAGG + Intergenic
1138412244 16:56849786-56849808 GGCTGCCGGGAGCTCTCTAGTGG + Intronic
1138415630 16:56869934-56869956 GCCTGCCTAGAGCCCTCTCCCGG - Intronic
1139371778 16:66473470-66473492 GGCTGCCGGGAGCCTTGGGAGGG + Intronic
1139544994 16:67645883-67645905 GGCTGCCCAGAGCCCAGTGCTGG - Intronic
1142204137 16:88774724-88774746 GGCTGGGGAGAGCACTCTTAGGG + Intronic
1142372812 16:89692309-89692331 CGGGGCCGAGAGCCTTCTGAGGG + Intronic
1203056058 16_KI270728v1_random:927309-927331 GGCTGGCAGGGGCCCTCTGAAGG + Intergenic
1146128554 17:30249680-30249702 GGCTGCTGTGAGCATTCTGATGG + Intronic
1147340552 17:39751110-39751132 GGCTGCCGAGAGCCCTTAGAGGG + Intergenic
1147438537 17:40432491-40432513 AGCACCCAAGAGCCCTCTGAGGG - Intergenic
1150239961 17:63622968-63622990 GGCTGCCGAGCGGGCTCTGCCGG - Intronic
1150295611 17:64005750-64005772 GGCTACAGAGGGCCCTCTGTGGG - Intronic
1151298875 17:73206823-73206845 GGCTGCCAAGAGGCTTCTGCGGG + Intronic
1151423034 17:74011137-74011159 GGCTGCAGAGTGACCTCGGATGG - Intergenic
1153618066 18:6952261-6952283 GGCTGCTGAGAGCCCAGTGCAGG + Intronic
1156497411 18:37535085-37535107 GGCTGCCGTGTGGCCTCGGATGG + Intronic
1157202531 18:45671506-45671528 GACCACTGAGAGCCCTCTGAAGG + Intronic
1157486593 18:48091834-48091856 GGCCACCGAGTGGCCTCTGAAGG - Intronic
1160881914 19:1324886-1324908 GACTGACGAGAGGCCTCTGGCGG - Intergenic
1160948535 19:1654689-1654711 GGCTCCGGAGAGGCCTCTGCGGG - Intergenic
1162448957 19:10742824-10742846 GGTTGGCCAGAGCCCTGTGAAGG + Intronic
1163449264 19:17366037-17366059 GGCTGCCGAGAGCACTGGGCAGG + Intronic
1164828163 19:31299425-31299447 GGGTGCCCAGAACCCTCTGCTGG + Intronic
1165743010 19:38214727-38214749 GGCTGCAGAGTGCACTGTGATGG - Intronic
1167649473 19:50721525-50721547 GGCTGCCGGGAGCCCCAGGAGGG - Intergenic
925132160 2:1501790-1501812 GACTCCCGAGAGCCTGCTGAAGG + Intronic
925139823 2:1542455-1542477 GGCTGCCGAGAGCCCTCTGAGGG + Exonic
925160093 2:1677598-1677620 GGCTTCCGAGGGCCATCCGAGGG + Intronic
926395817 2:12441054-12441076 GGCTGCACAGAGTCCTTTGATGG + Intergenic
927911911 2:26905665-26905687 GGCTGTAAAGAGCCCTGTGAAGG + Intronic
928427866 2:31193458-31193480 GGCTGGCTAGATCCCTGTGAGGG + Intronic
929701762 2:44168784-44168806 GGATGCCGCGCGCCCTCTCACGG - Intronic
933846135 2:86328709-86328731 GGCTGCCTTGACCCCTCTGTGGG + Intronic
935105809 2:100042252-100042274 GGCTGCGGAGGGCCCTCTGTGGG - Intronic
935589734 2:104835440-104835462 AGCTCCTGAAAGCCCTCTGAAGG - Intergenic
936935597 2:117836090-117836112 CACAGCCGAGAGCCCTCTGCTGG - Intergenic
941271356 2:163432947-163432969 GGCTGTCTAGAGTCCTCTGCTGG - Intergenic
946307899 2:218866277-218866299 GGCTACCCAACGCCCTCTGAAGG - Intronic
947565910 2:231192918-231192940 TGCAGCCTAGAGCCCTCTGTGGG - Intergenic
947739764 2:232479769-232479791 AGCTGGAGAGAGCCCTCTGCAGG - Intergenic
948053854 2:234997057-234997079 GGCTTCCGGGAGCCCGGTGAGGG + Intronic
948305008 2:236940247-236940269 GGCTGCAGGGAGCCCACAGAAGG + Intergenic
948565134 2:238880001-238880023 GGCAGCCCAGAGCCCCGTGAAGG - Intronic
948888363 2:240895091-240895113 GCCTGCCCAGAGCCGTGTGAGGG + Intronic
948888678 2:240896552-240896574 GGCTGCCCAGACCCCGCTGTGGG + Intronic
1168796500 20:613240-613262 GGCAGCCTAGAGGCCTGTGAGGG + Intergenic
1170893665 20:20396050-20396072 CCCTGCCCAGAGCGCTCTGATGG - Intronic
1171091543 20:22290163-22290185 GGATGCTGAAAGCCCCCTGAAGG + Intergenic
1171251545 20:23652971-23652993 AGCTGCCACCAGCCCTCTGAAGG - Intergenic
1171489777 20:25508684-25508706 GAATGCCGAGAGCCCTCTTCAGG - Intronic
1172522800 20:35579175-35579197 GGCTCCAGAGGGCCCTCCGATGG - Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1178847848 21:36188322-36188344 GGCTGCCGAGAGCCATCTCAGGG - Intronic
1179437131 21:41369684-41369706 GGCTGCTGAGAGCGCCCTGCAGG - Intronic
1179439335 21:41382245-41382267 GGCTTCTGAGATCCCTCTGCAGG + Intronic
1179638586 21:42731807-42731829 GTCTGCTGAGAGACCACTGAGGG + Exonic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181577551 22:23805017-23805039 GGCTGCCTTGAGCTTTCTGAAGG + Intronic
1182120611 22:27784075-27784097 AGCTCCCGAGTACCCTCTGAGGG - Intronic
1182123117 22:27799537-27799559 GGGTGCCTGGAGCCCACTGAGGG + Exonic
1183193528 22:36337052-36337074 GGCTGCCTGGAGCCCTGTGCTGG - Intronic
1184100958 22:42341616-42341638 GGATTCCGAGAGCCCTGTAAGGG + Intronic
1184391576 22:44206330-44206352 GGATGCCAAGAGCACACTGAGGG + Exonic
1185245803 22:49772040-49772062 GGCTGCTCAGAGGCCTCTCACGG - Intergenic
950411709 3:12842323-12842345 GGCTGCCGTGAGCCGTGAGATGG - Intronic
953600666 3:44360666-44360688 GGCTGCAGTGAGCCCCTTGATGG - Intronic
953852072 3:46471998-46472020 GGCTGCCAAGGACCCTCTGGAGG - Intronic
953908266 3:46879206-46879228 GGCTGCAGAGAGGAATCTGATGG - Intronic
954386419 3:50246352-50246374 GGCTGCCGGGCGCCCCCTGGTGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961312831 3:126014702-126014724 GGCTGCCTAGGAGCCTCTGAAGG + Intronic
961475775 3:127145444-127145466 GGCTGCCCAGAGCCCAGTGAGGG - Intergenic
962030215 3:131591599-131591621 TGCTGCTGAGAGGCCCCTGATGG - Intronic
962155037 3:132937251-132937273 GGCTGATGAGAACTCTCTGAGGG - Intergenic
962739913 3:138356008-138356030 GGGTGCTGAGAGACCTCAGAAGG + Intronic
966726692 3:183115104-183115126 GGATGCCGGCACCCCTCTGACGG + Intronic
967920059 3:194607862-194607884 GGCTCCCTCTAGCCCTCTGATGG + Intronic
971242202 4:24899029-24899051 TACTGCTGAGAGCTCTCTGATGG - Intronic
972469957 4:39394857-39394879 TGCTGCTGAGAGCCCTCTTCTGG + Intergenic
981540441 4:145841160-145841182 GGCTGCCAAGAACCCTCTCTTGG - Intronic
981571307 4:146153581-146153603 GGCTGGAAAGAGCCTTCTGAAGG - Intergenic
984204667 4:176772027-176772049 GGCTGCAGAAAGCCCTATTACGG + Intronic
985758637 5:1733559-1733581 GGCTGCTGAGGGGCCCCTGAGGG - Intergenic
986421851 5:7593105-7593127 AGCTGCCCAGCGCCCTCTGGGGG + Intronic
997675933 5:135713419-135713441 GGCTGCTGGGAGGCCTCAGAAGG - Intergenic
998337386 5:141384925-141384947 GGCAGCCTTGAGCCCTCCGACGG + Exonic
1001101736 5:168819903-168819925 TTTTGACGAGAGCCCTCTGATGG - Intronic
1001133523 5:169083687-169083709 TGCTGCCCAGAGGCCTGTGATGG - Intronic
1001292236 5:170471926-170471948 GGCTGCCAGGAGGCCTCTGACGG - Intronic
1001961945 5:175884738-175884760 CCCTGCCCAGAGCCCTCTAAAGG + Intergenic
1005309450 6:24545270-24545292 TGTTGCAGATAGCCCTCTGAAGG - Exonic
1007473624 6:42105681-42105703 GGCAGCCTAGTGGCCTCTGAGGG + Exonic
1011551612 6:88535638-88535660 GGCAGCCCAGAGGACTCTGAGGG - Intergenic
1011755945 6:90498315-90498337 GGCTGCTGGGAGGCTTCTGATGG - Intergenic
1013131267 6:107235224-107235246 AGCTGCAGAGAGAGCTCTGAAGG + Intronic
1015819531 6:137245702-137245724 GGCTGCGGAGAGCTTTCTGGTGG - Intergenic
1019749155 7:2718015-2718037 GGCTGCCGCGGACCCTCTGAGGG - Intronic
1029532892 7:101137172-101137194 CCCTGCCCAGAGCCCTCTCAGGG - Intronic
1039478762 8:37856390-37856412 GGCTTCCTTGAGCCCTTTGAGGG - Intergenic
1043582048 8:81725444-81725466 TCCTGCCCAGAGCCCTCAGAAGG - Intronic
1047254896 8:123207384-123207406 GCCTGCCGAGCGGCCGCTGAAGG - Exonic
1049106285 8:140615477-140615499 GCCCGCTCAGAGCCCTCTGAAGG + Intronic
1049697470 8:143990981-143991003 GGCGGCCTAGAGCCCTGGGAAGG + Intronic
1057305133 9:93907844-93907866 GGCTGCACAGAACCCTCTGTTGG - Intergenic
1057602848 9:96473488-96473510 GGATGCAGGGAGCCCTGTGAGGG - Intronic
1061551728 9:131338786-131338808 GGCTGCAGAGAGGCCTGGGAGGG + Intergenic
1062536957 9:137025316-137025338 GTCTGCCGAGGGCTCTCTGGAGG - Intronic
1062673592 9:137725964-137725986 GGCTGCAGAGACAGCTCTGAGGG - Intronic
1190333667 X:49250269-49250291 GGCTGGGGAGAGACCTCTGCCGG - Exonic
1195144609 X:102000484-102000506 TGCTGGCTACAGCCCTCTGATGG - Intergenic
1200059574 X:153478277-153478299 GACTTCCGGCAGCCCTCTGAGGG + Intronic