ID: 925139948

View in Genome Browser
Species Human (GRCh38)
Location 2:1543221-1543243
Sequence CTTCACATGTGAAATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925139948_925139950 -1 Left 925139948 2:1543221-1543243 CCGTCCTCATTTCACATGTGAAG 0: 1
1: 1
2: 5
3: 56
4: 354
Right 925139950 2:1543243-1543265 GCAGCTGAATTCCAGAGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 246
925139948_925139951 0 Left 925139948 2:1543221-1543243 CCGTCCTCATTTCACATGTGAAG 0: 1
1: 1
2: 5
3: 56
4: 354
Right 925139951 2:1543244-1543266 CAGCTGAATTCCAGAGTGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 255
925139948_925139953 12 Left 925139948 2:1543221-1543243 CCGTCCTCATTTCACATGTGAAG 0: 1
1: 1
2: 5
3: 56
4: 354
Right 925139953 2:1543256-1543278 AGAGTGCTGGGTCCCAGCCCAGG 0: 1
1: 2
2: 13
3: 82
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925139948 Original CRISPR CTTCACATGTGAAATGAGGA CGG (reversed) Intronic
901148505 1:7084639-7084661 CTTCACATGTGGGACGCGGAGGG + Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
902810152 1:18883476-18883498 CGTCAGATGTGAGAAGAGGATGG - Intronic
903299311 1:22366975-22366997 CTTCACATTTTAGATCAGGAAGG + Intergenic
903657515 1:24958434-24958456 CGTCATGTATGAAATGAGGAGGG + Intronic
904825006 1:33268636-33268658 ATTCACTAGTGAAATGGGGAGGG + Intronic
905434669 1:37948306-37948328 CTTCACTTGGGGAAAGAGGAAGG - Intergenic
905927600 1:41762942-41762964 CTGCACATGTGAAATTAAGCTGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906672672 1:47667940-47667962 CTTCTCATGTAAAATGAAGCTGG + Intergenic
907699260 1:56767255-56767277 CTTCTCATGTAAAAAGATGAGGG - Intronic
907975242 1:59425434-59425456 CTTCACAAGTGTAATGGGAAGGG - Intronic
908258259 1:62319663-62319685 CTGCACCTATCAAATGAGGATGG - Intergenic
908644652 1:66264554-66264576 TTTCACATGTGACAAGAGAAGGG - Intronic
910436415 1:87210455-87210477 CTGTGCATGTGAAATGAAGAGGG - Intergenic
910498545 1:87861776-87861798 CTTCAGGTGTAAATTGAGGAGGG + Intergenic
910515803 1:88058787-88058809 CTTGATATATGAAATGATGATGG - Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910705153 1:90121852-90121874 GTAAACAAGTGAAATGAGGATGG + Intergenic
912501052 1:110122005-110122027 CTTCCCAGCTCAAATGAGGAAGG - Intergenic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
913132292 1:115851707-115851729 CTTCACATGAGAAAAGAGTCTGG + Intergenic
913552416 1:119928458-119928480 CATCACATGTCAAAGGAGGCAGG + Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
914985989 1:152457593-152457615 CTTCAGATGTGAAATGTAAAAGG - Intergenic
916313445 1:163422240-163422262 CTTAACAGGTGAGATGAGGGTGG - Intergenic
917159332 1:172040061-172040083 CTTGTCATGTGGAAGGAGGAGGG + Intronic
917392313 1:174551545-174551567 GCTCACTTTTGAAATGAGGAAGG + Intronic
917534558 1:175864774-175864796 CTGCAGAGGTGAAATCAGGAGGG + Intergenic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
919641885 1:200053413-200053435 CTTCATATGTAAAAAGAGGTAGG - Intronic
920422465 1:205844407-205844429 CTTCATTTGTGAAATAAGGGAGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
921380139 1:214516216-214516238 CTTCAACTGTGAAAAAAGGAAGG - Intronic
921701263 1:218271517-218271539 TTCCACATGTGAATTTAGGAGGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922113720 1:222589226-222589248 TTTCATATGGGTAATGAGGAAGG - Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
924784510 1:247183106-247183128 GTTCACTTGTGAAATGAGGCTGG - Intergenic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1064284998 10:13984287-13984309 CATCACACATGAAATGAGGAAGG - Intronic
1065111048 10:22440132-22440154 ATTTAAATGTGAAATGTGGAAGG - Intronic
1065632582 10:27695612-27695634 CTTCCAATGTGAAAGGAGCAAGG + Intronic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1068526900 10:58140753-58140775 CTCCACATGTGAGATGAGAGGGG + Intergenic
1069283344 10:66682939-66682961 CACAACCTGTGAAATGAGGAGGG - Intronic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073517293 10:104087856-104087878 CTTCACATATGAATTTTGGAGGG + Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074125370 10:110524921-110524943 CTTCTTGTGTGAAATGAAGAAGG + Intergenic
1074209910 10:111320993-111321015 CTTGAAATGTAAAATGAGGCAGG + Intergenic
1075585731 10:123656753-123656775 CTCCACCTGCGAAATGAGGTGGG - Intergenic
1075909041 10:126107704-126107726 ATTCTCATGTGCAATGTGGATGG - Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076483463 10:130800292-130800314 ATCCTCATGTGAAATGAGGCAGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078467881 11:11563591-11563613 CCTCACTTGTGACATGAGGATGG - Intronic
1080052699 11:27873129-27873151 GTTCAGATGTGAAAACAGGAGGG + Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083476534 11:62919064-62919086 CCTCACATATGCAATGAGGAGGG + Intronic
1083539638 11:63503638-63503660 CTTCCTGGGTGAAATGAGGAAGG - Intergenic
1084468919 11:69343799-69343821 CTTCCCATGTGAAAGGACCAAGG + Intronic
1085681192 11:78576665-78576687 CATCACATGGCAAAAGAGGAAGG - Intergenic
1086159875 11:83710115-83710137 TAACACATGTGAAATGTGGATGG + Intronic
1087117465 11:94541118-94541140 ATTCAGATGTGAAATAAAGAGGG - Intergenic
1088867075 11:113858508-113858530 CTTAACATGGGAGATGAGAAAGG - Intronic
1089051111 11:115546864-115546886 GTTGACATGTGAGATGAGAAGGG - Intergenic
1089182702 11:116594068-116594090 GTACACATGTGAAAAGATGAAGG - Intergenic
1091012725 11:132020723-132020745 CCTCACATCTGAAATAATGAAGG - Intronic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1093828651 12:23727519-23727541 CTTGCCTTGTCAAATGAGGATGG - Intronic
1094163902 12:27422474-27422496 CTTCAAGTGTGAAATGTGCAGGG + Intronic
1095372340 12:41483893-41483915 GTTCACATGTCAGATGAAGAGGG - Intronic
1096179063 12:49540668-49540690 CAGCACATGTGAACTGAGGTCGG - Intronic
1096438974 12:51622601-51622623 CTTCCAATATGATATGAGGAAGG - Intronic
1096923265 12:55112846-55112868 CCTCTCATGAGAAAAGAGGATGG - Intergenic
1097992524 12:65851141-65851163 CTTCTTTTGTGAAATGAGGCTGG + Intronic
1098047883 12:66420740-66420762 CTTGATATCTGAAATGACGAGGG + Exonic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1100403745 12:94254524-94254546 TTTCACTTGTAAAATGAGTAAGG + Intronic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100856374 12:98761053-98761075 TCTCACACGTAAAATGAGGATGG - Intronic
1100962708 12:99981704-99981726 CTTCATCTGTGAAATGACAATGG + Intronic
1101972608 12:109326368-109326390 CTCCACATGGGGGATGAGGAAGG + Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1104265573 12:127229339-127229361 CTTCAAAGGTGAGATGTGGAGGG + Intergenic
1106215852 13:27698495-27698517 AATCTCATGTGAAATGAGGAGGG - Intergenic
1108446295 13:50512144-50512166 CTTCAGCTGAGAAAAGAGGATGG + Intronic
1108584240 13:51854675-51854697 CTTCATATGTGAAATGGAAATGG + Intergenic
1109148394 13:58812458-58812480 CTTCACATGTGAAGGGCAGAAGG - Intergenic
1110210697 13:72968769-72968791 CCTCATATGTGAAATGAGAGTGG + Intronic
1110274383 13:73627283-73627305 CTGCATATTTGAAATGAAGAGGG + Intergenic
1111645137 13:91022947-91022969 CTTCACTTTTGGAAAGAGGAAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114226307 14:20741776-20741798 CTCCACATGGGAAATATGGAGGG - Intronic
1115443381 14:33461871-33461893 CATCACTTGTGAAATGGGAATGG + Intronic
1116550277 14:46228797-46228819 CTTGAGATAGGAAATGAGGAAGG - Intergenic
1116978397 14:51141667-51141689 CTTCAGTTGGGAAATGACGATGG + Intergenic
1117243947 14:53864719-53864741 ATTCAGATGAGAAATGATGATGG + Intergenic
1117477195 14:56107895-56107917 CTTCACATGTGCAATGATAATGG + Intergenic
1117687394 14:58268502-58268524 CTTCACAACTGAAACTAGGAGGG - Intronic
1117800056 14:59433984-59434006 CTTCACGTGTTAAAAGAGGACGG - Intronic
1118160731 14:63287332-63287354 CCTGAGCTGTGAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1119540674 14:75436137-75436159 CTTCAAAAGTGAAATGTAGATGG + Intronic
1119854920 14:77892415-77892437 CTTCACATGTGAGATAATAAGGG - Intronic
1119893539 14:78200974-78200996 CTTCATCCGTGAAATGAGGCTGG + Intergenic
1120491073 14:85179566-85179588 CTTCACATGAGAGATAATGAAGG + Intergenic
1120928596 14:89823453-89823475 CTTCATAAGTGAAATGAAAATGG + Intronic
1121075359 14:91063609-91063631 CTTCATATGTGTAATATGGAGGG + Intronic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122913621 14:104845651-104845673 CATCACATGTGAACTTGGGAGGG - Intergenic
1126414890 15:48407150-48407172 CTTCATTTATGAAATGGGGATGG + Intergenic
1127394114 15:58529821-58529843 CTTCAACTGTGACATAAGGAAGG + Intronic
1128347355 15:66862901-66862923 CTCCACATGTAAAATGAGGCAGG + Intergenic
1128394572 15:67211069-67211091 CTTCCCAAGTGAAAGGAAGAAGG - Intronic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1129180401 15:73870773-73870795 CTCCACATGTGCCATGAGGATGG - Intergenic
1129678400 15:77644509-77644531 CGTCACCTGGGAAATAAGGATGG + Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1130309639 15:82741949-82741971 CTTCCAATGTGAAATAAAGATGG + Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1136175201 16:28511929-28511951 CTTCAGATGTGACATGAGGATGG + Intronic
1137043770 16:35638172-35638194 CTTAGCATGTGAAATAGGGAAGG - Intergenic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137695682 16:50460662-50460684 CTTCACCTGTGAAATGAAGGGGG - Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1139166587 16:64573176-64573198 CCTCAGATTTGAAATGGGGATGG - Intergenic
1141479630 16:84297808-84297830 CCTCACCTGGGAAATGAAGATGG + Intronic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1144761649 17:17710675-17710697 CTCCACCTCTGAAATGAGGAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144952073 17:18999845-18999867 CCTCAACTGTGAAATAAGGAAGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146212425 17:30952893-30952915 CTTCAGATGTGTAATGAGGCTGG + Intronic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147808104 17:43146903-43146925 GTTCCCATCTAAAATGAGGAGGG - Intergenic
1148279580 17:46337590-46337612 GTTCCCATCTAAAATGAGGAGGG + Intronic
1148301797 17:46555446-46555468 GTTCCCATCTAAAATGAGGAGGG + Exonic
1148365719 17:47054433-47054455 GTTCCCATCTAAAATGAGGAGGG + Intergenic
1149189158 17:54037766-54037788 CATCACATGTGATTTGAGAATGG - Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150400819 17:64854707-64854729 GTTCCCATCTAAAATGAGGAGGG - Intronic
1150781000 17:68122109-68122131 GTTCCCATCTAAAATGAGGAGGG - Intergenic
1152790831 17:82278554-82278576 CTTCCCATCAGAAGTGAGGAAGG + Intergenic
1153133241 18:1882074-1882096 CATCACAGGTAAAACGAGGAAGG - Intergenic
1153256767 18:3179508-3179530 CCTCAGATGTGAAATGGAGAGGG + Intronic
1154091415 18:11367351-11367373 CATCACCTGTGACATGAAGAGGG - Intergenic
1156470246 18:37373322-37373344 CTCCACATCTGAAATCAGAAGGG - Intronic
1157348870 18:46866991-46867013 CTTAACATTTGAAAAGAGAATGG + Intronic
1158304587 18:56090773-56090795 CTTCAGATAAGAAATGAGGAAGG + Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1160565737 18:79785758-79785780 CCTCACCTGTGCAATGAGAAGGG + Intergenic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1162082372 19:8225890-8225912 GTTCATCTGTGAAATGAGAATGG + Intronic
1162781198 19:13007767-13007789 CTTCAAATGTTATTTGAGGACGG + Intronic
1165614396 19:37186499-37186521 CTTCTCATGTGTAATGAGGTTGG + Exonic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167667407 19:50830804-50830826 CTTCCCTTGTCAAATGAGGTCGG + Intronic
1167717336 19:51152247-51152269 CCTTACAAGTGAAAGGAGGAGGG - Intronic
1167835343 19:52063897-52063919 CTTTACAAATGAAATGAGGGTGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925175771 2:1782612-1782634 ATTCAGATGGGACATGAGGAGGG + Intergenic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926119065 2:10231660-10231682 CTTCAGATTTGAAATGAAGTGGG + Intergenic
926494721 2:13571921-13571943 ATTCAGATGAGAAATGATGATGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926946930 2:18198577-18198599 CTTCATCTGTGAATTGAGGCAGG - Intronic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
929052572 2:37850418-37850440 CTTCACATGTGCAGTGAGGGTGG + Intergenic
929168135 2:38904333-38904355 CTACACATCAGAAATGAGGCTGG + Intronic
929285363 2:40129534-40129556 TTTCACATTTGAAATGAAGGTGG - Intronic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
929646088 2:43629798-43629820 TTTCACATATGAAAAGAGGTTGG + Intergenic
929666842 2:43839969-43839991 CTTCTCAGGTAAAATGAGGAAGG - Intronic
929693159 2:44091364-44091386 CTTCCCTTGTAAAACGAGGATGG - Intergenic
930057449 2:47263014-47263036 TTTCACAGGTAAAATGAGAATGG + Intergenic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932970497 2:76535151-76535173 CTTCATATGGTAAAAGAGGAAGG + Intergenic
933234373 2:79849015-79849037 CTTCATGTGTGAGATGAGAAAGG + Intronic
935641704 2:105297075-105297097 GCTCACAGGTAAAATGAGGATGG - Intronic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
938161174 2:128985893-128985915 TTTCATCTGTGAAATGAGAATGG - Intergenic
939507390 2:143063713-143063735 CTTCACATATAAAATGAAGATGG - Intergenic
939999313 2:148951017-148951039 ATTCACATCTGAAATGAGTTTGG - Intronic
940329474 2:152458522-152458544 CTCCAAATGTGGAGTGAGGATGG - Intronic
940662703 2:156567397-156567419 CTCCACATGTGAAAGAATGAAGG - Intronic
940696275 2:156983474-156983496 AATTACATGTGAAATGAGGCTGG + Intergenic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941875025 2:170423287-170423309 CTGCACATATGAAATGTGGCTGG - Intronic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
943736358 2:191359889-191359911 TTTCAAATGGGAAAGGAGGAAGG - Intronic
944477347 2:200120423-200120445 CCTCACCTTTGAAATGAGGGAGG - Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945445196 2:209928943-209928965 CTTTACATGTGAAATAAGCCAGG - Intronic
946127722 2:217578746-217578768 CTTAAGATGTGAAATGACAAAGG + Intronic
946182954 2:217959959-217959981 CCTCACGTGTGAAGGGAGGAGGG + Intronic
1168870653 20:1125391-1125413 CTTCATCTGTGAAGTGAGGTGGG + Intronic
1168930671 20:1620761-1620783 CTTCAGATGGGAACTGAGGAGGG + Intergenic
1168973931 20:1949972-1949994 GATCACATGTGAGATGGGGAAGG - Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1171225470 20:23438774-23438796 CTTCACCTGTAATATGAGAATGG - Intergenic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1174065682 20:47863405-47863427 CCTCACATGTGTAGTGAGGAAGG - Intergenic
1175389127 20:58615375-58615397 CTTCATTGGTGAAATGACGATGG - Intergenic
1177401660 21:20613554-20613576 CCTCACATGTCAAGAGAGGAAGG + Intergenic
1178974096 21:37207374-37207396 TTTCAAATGTGAAATGAGAAAGG - Intergenic
1181340999 22:22179935-22179957 CTTCAATTGTGAAATCAGGGAGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182834080 22:33327328-33327350 CCTCACCTCTGAAATGAAGAAGG - Intronic
1183233408 22:36597333-36597355 CTTCACATGTGATTTGGGGGAGG + Intronic
1183575975 22:38689425-38689447 CTACCAATGTGAAAAGAGGAGGG + Intronic
1183742235 22:39675179-39675201 CCTTGCCTGTGAAATGAGGATGG + Intronic
1184121395 22:42452771-42452793 CTTCACCTGTGAGGTGGGGATGG + Intergenic
949151244 3:770219-770241 ATTGAAATGTGAAAGGAGGAAGG + Intergenic
949243890 3:1902784-1902806 ATTCAGATCTGAAGTGAGGATGG - Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
950226278 3:11237341-11237363 CTTCACAATGGAAAAGAGGATGG + Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
951585955 3:24214766-24214788 CTTTACAAATGAGATGAGGAGGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952135086 3:30409921-30409943 CTTCCCACGTGAAATGAAAATGG - Intergenic
953266239 3:41391700-41391722 GTTCTCATGTGGAATGAGAAGGG + Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953793316 3:45964905-45964927 CTACAAAGGTGAACTGAGGACGG + Intronic
955841518 3:63117784-63117806 ATCCACATGAGAACTGAGGAAGG + Intergenic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956507070 3:69953107-69953129 CTTGACATGAGAACTGGGGAGGG - Intronic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
959226159 3:103587911-103587933 CTTCACCACTGAAAGGAGGATGG + Intergenic
960180443 3:114569440-114569462 CTTAACCTGAGAAATGAGGCAGG + Intronic
960371134 3:116841418-116841440 TCTCACATGTGAAATGAACAGGG - Intronic
960553269 3:119000644-119000666 ATTCAGATGAGAAATGATGATGG - Intronic
960705895 3:120480603-120480625 CCTCACATGTGAATTTACGAAGG + Intergenic
960719160 3:120608630-120608652 AATGACATGTGCAATGAGGAAGG + Intergenic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
960948327 3:122982189-122982211 CTCCACATGGGAAATGAGGAAGG - Intronic
961651721 3:128420340-128420362 TCTCACATGTGCAGTGAGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963261800 3:143200074-143200096 TTTCACCTGTAATATGAGGAAGG + Intergenic
963447142 3:145427297-145427319 ATTTACATGTGAAATGACAATGG - Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964696503 3:159513834-159513856 CTTGAAATGTGAAAAGAGGGAGG - Intronic
964884563 3:161466385-161466407 CATCACATGACAAAAGAGGAAGG - Intergenic
965447661 3:168795552-168795574 CTTCAGATGTGAAGAGAGAATGG - Intergenic
965479491 3:169200095-169200117 TTTGACCTTTGAAATGAGGAAGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966527881 3:180940433-180940455 TGTTACATGTGAAATGAGGGAGG - Intronic
967342485 3:188415167-188415189 CTTCAGATGTAAAATACGGAGGG - Intronic
968938493 4:3625776-3625798 GAGCACATGTGAAATAAGGAAGG + Intergenic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
972312698 4:37895755-37895777 CTTTACATGTCAAATTAGAAAGG + Intronic
972336409 4:38110661-38110683 CTTCACATATAAAATGAGAATGG - Intronic
972707497 4:41559595-41559617 CTTAAGATGTGAGATGATGAGGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
974587134 4:63894125-63894147 CTACATGTGTGAAATTAGGATGG - Intergenic
975399892 4:73923347-73923369 TATTACATTTGAAATGAGGAAGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
978326732 4:107566155-107566177 AGTCACATGTCAAATGAGGATGG - Intergenic
978480161 4:109179853-109179875 CTTCACATATGAAATCAATAGGG + Intronic
978591953 4:110333363-110333385 TTTCTCATGTCAAATGAAGATGG + Intergenic
981190502 4:141856858-141856880 GATCACCTGTGAAATGTGGATGG - Intergenic
981700327 4:147600786-147600808 TGTCACCTGTGAAATGAGAAAGG - Intergenic
982146905 4:152404793-152404815 CTTAAGAGGTGAAATGAGGCTGG + Intronic
982403162 4:154991058-154991080 CTGCACATTTGAAATCAGGTAGG - Intergenic
984515857 4:180738337-180738359 CTGCACATCTGGAAGGAGGATGG - Intergenic
985230460 4:187810637-187810659 CAGGACATGTGAAATCAGGAAGG - Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
985945123 5:3176206-3176228 CTCCAGATCTGAAATGTGGAAGG + Intergenic
986167933 5:5291905-5291927 CTGTATATGTGAATTGAGGAGGG + Intronic
986240957 5:5959662-5959684 TTTCACTTGTTAAATGATGATGG - Intergenic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
988912155 5:35854199-35854221 CTCCAAATGTGAAATCAGGAGGG - Intronic
991391670 5:66150643-66150665 ATCCACATGAGAAATGATGAGGG + Intronic
991485486 5:67131393-67131415 CTTCACCTGTAATACGAGGATGG - Intronic
992044715 5:72874851-72874873 CTTTATGTGTGACATGAGGAAGG + Intronic
992979761 5:82156629-82156651 CTTTACATGTGACATAAGAAAGG - Intronic
993015372 5:82529828-82529850 AATCACAAGGGAAATGAGGAAGG - Intergenic
994379899 5:99058362-99058384 CTTCACATGAGACATGTGGTGGG - Intergenic
995037562 5:107552415-107552437 CCTCACCTATTAAATGAGGATGG - Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
997743482 5:136278383-136278405 CCTCACAGGGGCAATGAGGAAGG - Intronic
997876760 5:137556546-137556568 ATACATATGTGTAATGAGGAAGG + Intronic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
1003390937 6:5712220-5712242 CATCACTTGTGATATTAGGAAGG - Intronic
1004180281 6:13375488-13375510 TTTCAGGTGTGAAATTAGGATGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1007946693 6:45833442-45833464 CTTCACATATAAAATGAGAATGG + Intergenic
1008311207 6:49976639-49976661 CTTCACATGTGGCATCAGCAAGG - Intergenic
1008863983 6:56187655-56187677 TTTCTTATGTGAAATGAGGTAGG - Intronic
1009381513 6:63036288-63036310 CCTCACATGTGCACTGAGGAAGG - Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015365748 6:132395627-132395649 CTTTACAGGTGAGATGAGTATGG - Intronic
1015525649 6:134173708-134173730 CATCACATTTCAAATGAGTATGG + Intronic
1015835696 6:137417880-137417902 ATTCAAATGTGAAATGTTGAAGG - Intergenic
1016375947 6:143420866-143420888 CTTCCCAGCTGAAGTGAGGAGGG - Intergenic
1016383287 6:143507345-143507367 CTTCATATTTGAAACTAGGAGGG + Exonic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1021132671 7:16930039-16930061 TGTTACATGTGAAAGGAGGAGGG - Intergenic
1021217919 7:17940239-17940261 GTTTACCTGTGAAATGGGGAAGG - Intronic
1022695753 7:32703690-32703712 CTTCTCATGTGAAATTAAGGAGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1026243015 7:68593710-68593732 TTTAACATGTGAAAGGAGAAAGG - Intergenic
1028733644 7:94181646-94181668 CATAAAATGTTAAATGAGGAGGG - Intergenic
1030707271 7:112706675-112706697 CCTCACATGTTAAATAAGAATGG - Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1032104020 7:129009886-129009908 TTTCACATGAGAAGTGTGGAGGG - Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032403965 7:131642579-131642601 CTTCCCCTGGGAAATGAGCATGG + Intergenic
1033099462 7:138458244-138458266 TTACTCATGTGAAATTAGGAAGG + Intergenic
1033936657 7:146593718-146593740 CTTCAAAGGAGAAATAAGGAGGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034914514 7:155025866-155025888 CTAGTCATGTGAAAAGAGGAGGG - Intergenic
1035074169 7:156167499-156167521 CCTCACCTGAGAAACGAGGATGG - Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035900948 8:3457884-3457906 GAACACATGAGAAATGAGGAAGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1037153384 8:15668530-15668552 CCTTACATGTGTAGTGAGGAAGG + Intronic
1037157343 8:15719755-15719777 CCTGGCATGTGAAATGGGGATGG - Intronic
1037893836 8:22638688-22638710 TTTTACAGTTGAAATGAGGAAGG - Intronic
1038291334 8:26252372-26252394 TTTCACATGTGAATTTGGGAGGG + Intergenic
1038792887 8:30684274-30684296 GTTCCCATGTGAAATGAGGAAGG - Intronic
1039309538 8:36301366-36301388 ATTCACCTCTGAAATGAGAAAGG + Intergenic
1040984675 8:53280727-53280749 CTTCACATGTGAACTGAGGTTGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1042021255 8:64372757-64372779 CTTGACATGTGAAAGGGGGGAGG + Intergenic
1042223137 8:66493204-66493226 CTTCATTTCTGAAATGAGAAAGG + Exonic
1042677464 8:71337785-71337807 CTCCACAGGAGAAAGGAGGAAGG - Intronic
1042690986 8:71498630-71498652 CTTCACATGTGAAGAGAAAAGGG + Intronic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1044321808 8:90810668-90810690 CTTCACTTGCGAACTAAGGAAGG + Intronic
1044563495 8:93637814-93637836 CTGCACATGTGAAAAAAGAAAGG + Intergenic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1045375735 8:101572003-101572025 CCTTAGCTGTGAAATGAGGAAGG + Intronic
1045586360 8:103541558-103541580 CTTTCCAAGTGAAATGAGAAGGG + Intronic
1046225944 8:111280485-111280507 CTCCACATGTGAAATACGAAAGG - Intergenic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048705234 8:137146432-137146454 CATCACATGATTAATGAGGAAGG + Intergenic
1049564988 8:143333536-143333558 CTTCATCTGTGAAATGAGACTGG - Intronic
1050345684 9:4683731-4683753 ATTCACATGTGAAATTATAAGGG + Intronic
1050700457 9:8332806-8332828 CTTCAAATGAGAAATGAGATCGG - Intronic
1051553261 9:18354548-18354570 CTTCAAAAGTGAACAGAGGAAGG - Intergenic
1051572653 9:18577858-18577880 TTTCAATTGTGAAATGATGATGG - Intronic
1051989399 9:23133276-23133298 CTTCACTTGTGAAATCAAGCAGG - Intergenic
1052077548 9:24161638-24161660 CTCCACGTGTGAAGGGAGGAAGG - Intergenic
1052126071 9:24775823-24775845 ATTCACATATGAAATTATGATGG - Intergenic
1052399269 9:27979998-27980020 CTTCACATGTCAATACAGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1054452724 9:65412031-65412053 GAGCACATGTGAAATAAGGAAGG - Intergenic
1055969798 9:81900494-81900516 CTTAACATCTGATATAAGGAAGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056720867 9:89070620-89070642 CTTCACATCTTTAATGAAGAAGG - Intronic
1057017661 9:91666739-91666761 CTTAAAATGTGAAATGAGACCGG - Intronic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058940770 9:109810802-109810824 CTTGAGTTGGGAAATGAGGAAGG + Intronic
1059063249 9:111055376-111055398 CTTCACATGTGAAAGGGGTCAGG - Intergenic
1059938430 9:119334652-119334674 CTGCACCTGTGCAACGAGGAAGG + Intronic
1059972243 9:119679641-119679663 ATCCATCTGTGAAATGAGGATGG + Intergenic
1061017940 9:127993483-127993505 CTTCAACTGTGAAGTGAGGATGG - Intergenic
1061946513 9:133911350-133911372 CTGCACACGTGAAATGCGGCTGG + Intronic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1185885619 X:3779991-3780013 TTTCTGATGTGAAATGAGCAGGG + Intergenic
1186425238 X:9459255-9459277 CTTCCCATATGAGATGAGGAAGG - Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1188260768 X:28020572-28020594 TTTCAAATGTGATATGAGGCTGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189376390 X:40469639-40469661 CTTCACGTGTGTAAAGAGGTTGG + Intergenic
1189753283 X:44245033-44245055 CTTCCCCTATGAAATGAAGATGG - Intronic
1190227127 X:48554872-48554894 CTTAACAGGTAAAATGAAGAAGG - Intronic
1190394940 X:49972563-49972585 CTTCATATGTGATATGAGTAGGG - Intronic
1190605995 X:52143438-52143460 CATCACATGGCAAAAGAGGAAGG + Intergenic
1191211860 X:57892732-57892754 CCTCAAATGTGAACTGAGGATGG - Intergenic
1193506878 X:82355574-82355596 CATAAAATGTGAAATGAGCAGGG - Intergenic
1196122026 X:112061472-112061494 CTTCAGATCTGAGATGAGGGTGG + Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198026443 X:132712316-132712338 CTTCAGAGATCAAATGAGGAAGG - Intronic
1198122089 X:133604113-133604135 CTTAACGTGAGAAATGGGGATGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199163432 X:144642450-144642472 CTTCATATTTGAACTGAGAAGGG + Intergenic