ID: 925141230

View in Genome Browser
Species Human (GRCh38)
Location 2:1550953-1550975
Sequence CTGCAGGTTTCTGTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925141222_925141230 -7 Left 925141222 2:1550937-1550959 CCTTTCCCCGAGGTCCCTGCAGG No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141221_925141230 -6 Left 925141221 2:1550936-1550958 CCCTTTCCCCGAGGTCCCTGCAG No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141216_925141230 22 Left 925141216 2:1550908-1550930 CCCCAAAGCGGAGCCTTAGGACG No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141218_925141230 20 Left 925141218 2:1550910-1550932 CCAAAGCGGAGCCTTAGGACGAA No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141214_925141230 27 Left 925141214 2:1550903-1550925 CCTCTCCCCAAAGCGGAGCCTTA No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141217_925141230 21 Left 925141217 2:1550909-1550931 CCCAAAGCGGAGCCTTAGGACGA No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data
925141219_925141230 9 Left 925141219 2:1550921-1550943 CCTTAGGACGAAGCTCCCTTTCC No data
Right 925141230 2:1550953-1550975 CTGCAGGTTTCTGTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925141230 Original CRISPR CTGCAGGTTTCTGTGGAGCC TGG Intergenic
No off target data available for this crispr