ID: 925141462

View in Genome Browser
Species Human (GRCh38)
Location 2:1552633-1552655
Sequence GCTTAGTAGCTGAATGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925141461_925141462 -10 Left 925141461 2:1552620-1552642 CCTTTTGAAGAAAGCTTAGTAGC No data
Right 925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG No data
925141458_925141462 13 Left 925141458 2:1552597-1552619 CCCCTTTTCAACATCAACATGAT No data
Right 925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG No data
925141459_925141462 12 Left 925141459 2:1552598-1552620 CCCTTTTCAACATCAACATGATC No data
Right 925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG No data
925141460_925141462 11 Left 925141460 2:1552599-1552621 CCTTTTCAACATCAACATGATCC No data
Right 925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925141462 Original CRISPR GCTTAGTAGCTGAATGCAGA TGG Intergenic
No off target data available for this crispr