ID: 925141547

View in Genome Browser
Species Human (GRCh38)
Location 2:1553292-1553314
Sequence GCCTTACCTCGTCCTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925141541_925141547 16 Left 925141541 2:1553253-1553275 CCTTTTTCAGTTAGGAGGTACAC No data
Right 925141547 2:1553292-1553314 GCCTTACCTCGTCCTCCTAGAGG No data
925141544_925141547 -10 Left 925141544 2:1553279-1553301 CCTTCCCTTCTGGGCCTTACCTC No data
Right 925141547 2:1553292-1553314 GCCTTACCTCGTCCTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925141547 Original CRISPR GCCTTACCTCGTCCTCCTAG AGG Intergenic
No off target data available for this crispr