ID: 925142411

View in Genome Browser
Species Human (GRCh38)
Location 2:1559252-1559274
Sequence CTGGTGAGGGGCCCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925142411_925142421 10 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142421 2:1559285-1559307 GAGCCCACCCTGGCACACAGTGG No data
925142411_925142419 0 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142419 2:1559275-1559297 CAGGTCCTCTGAGCCCACCCTGG No data
925142411_925142422 11 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142422 2:1559286-1559308 AGCCCACCCTGGCACACAGTGGG No data
925142411_925142429 26 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142429 2:1559301-1559323 ACAGTGGGCTCTTTTGGGAATGG No data
925142411_925142428 21 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142428 2:1559296-1559318 GGCACACAGTGGGCTCTTTTGGG No data
925142411_925142427 20 Left 925142411 2:1559252-1559274 CCCCACACAGGGCCCCTCACCAG No data
Right 925142427 2:1559295-1559317 TGGCACACAGTGGGCTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925142411 Original CRISPR CTGGTGAGGGGCCCTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr