ID: 925145950

View in Genome Browser
Species Human (GRCh38)
Location 2:1583449-1583471
Sequence CAGGCTTAGCACAGGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925145950_925145960 29 Left 925145950 2:1583449-1583471 CCCCAGTCCCTGTGCTAAGCCTG No data
Right 925145960 2:1583501-1583523 AATCGCAGAGAAGGCAGAGAAGG No data
925145950_925145958 -1 Left 925145950 2:1583449-1583471 CCCCAGTCCCTGTGCTAAGCCTG No data
Right 925145958 2:1583471-1583493 GGGACTGTAATGACAGACAATGG No data
925145950_925145959 20 Left 925145950 2:1583449-1583471 CCCCAGTCCCTGTGCTAAGCCTG No data
Right 925145959 2:1583492-1583514 GGTCTAAAGAATCGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925145950 Original CRISPR CAGGCTTAGCACAGGGACTG GGG (reversed) Intergenic
No off target data available for this crispr