ID: 925148109

View in Genome Browser
Species Human (GRCh38)
Location 2:1594544-1594566
Sequence GCTTCCAGCCCAGGAGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925148109_925148116 28 Left 925148109 2:1594544-1594566 CCCAGTGCTCCTGGGCTGGAAGC No data
Right 925148116 2:1594595-1594617 TTTATTCTCATCCTCAAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925148109 Original CRISPR GCTTCCAGCCCAGGAGCACT GGG (reversed) Intergenic
No off target data available for this crispr