ID: 925148612

View in Genome Browser
Species Human (GRCh38)
Location 2:1599801-1599823
Sequence AGGGAGCAGCAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925148612_925148616 -7 Left 925148612 2:1599801-1599823 CCCTCCTCTTCCTGCTGCTCCCT No data
Right 925148616 2:1599817-1599839 GCTCCCTGCTCACCCAGCTCAGG No data
925148612_925148618 -5 Left 925148612 2:1599801-1599823 CCCTCCTCTTCCTGCTGCTCCCT No data
Right 925148618 2:1599819-1599841 TCCCTGCTCACCCAGCTCAGGGG No data
925148612_925148617 -6 Left 925148612 2:1599801-1599823 CCCTCCTCTTCCTGCTGCTCCCT No data
Right 925148617 2:1599818-1599840 CTCCCTGCTCACCCAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925148612 Original CRISPR AGGGAGCAGCAGGAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr