ID: 925149636

View in Genome Browser
Species Human (GRCh38)
Location 2:1606348-1606370
Sequence TGGGATATTAAAGTACATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925149624_925149636 6 Left 925149624 2:1606319-1606341 CCCCTCTGCGGACCCCAAATTTC No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149625_925149636 5 Left 925149625 2:1606320-1606342 CCCTCTGCGGACCCCAAATTTCC No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149629_925149636 -6 Left 925149629 2:1606331-1606353 CCCCAAATTTCCCCCTCTGGGAT No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149626_925149636 4 Left 925149626 2:1606321-1606343 CCTCTGCGGACCCCAAATTTCCC No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149630_925149636 -7 Left 925149630 2:1606332-1606354 CCCAAATTTCCCCCTCTGGGATA No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149622_925149636 25 Left 925149622 2:1606300-1606322 CCATTAAAACAGGGAACAACCCC No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data
925149631_925149636 -8 Left 925149631 2:1606333-1606355 CCAAATTTCCCCCTCTGGGATAT No data
Right 925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925149636 Original CRISPR TGGGATATTAAAGTACATGA CGG Intergenic
No off target data available for this crispr