ID: 925151373

View in Genome Browser
Species Human (GRCh38)
Location 2:1617778-1617800
Sequence TCCCCAGGCACCGTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925151371_925151373 4 Left 925151371 2:1617751-1617773 CCTGGGGCGGGGTCACTGCAGAG No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data
925151368_925151373 14 Left 925151368 2:1617741-1617763 CCTGTGCCGCCCTGGGGCGGGGT No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data
925151369_925151373 8 Left 925151369 2:1617747-1617769 CCGCCCTGGGGCGGGGTCACTGC No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data
925151364_925151373 16 Left 925151364 2:1617739-1617761 CCCCTGTGCCGCCCTGGGGCGGG No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data
925151366_925151373 15 Left 925151366 2:1617740-1617762 CCCTGTGCCGCCCTGGGGCGGGG No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data
925151370_925151373 5 Left 925151370 2:1617750-1617772 CCCTGGGGCGGGGTCACTGCAGA No data
Right 925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925151373 Original CRISPR TCCCCAGGCACCGTCTCCCC AGG Intergenic
No off target data available for this crispr