ID: 925151396

View in Genome Browser
Species Human (GRCh38)
Location 2:1617853-1617875
Sequence AGAGTGCACCAGCCCTCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925151384_925151396 18 Left 925151384 2:1617812-1617834 CCTGCCCCTTCAGGCCCCACAGC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151390_925151396 2 Left 925151390 2:1617828-1617850 CCACAGCCACCTGTTGTTGACCC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151388_925151396 4 Left 925151388 2:1617826-1617848 CCCCACAGCCACCTGTTGTTGAC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151383_925151396 19 Left 925151383 2:1617811-1617833 CCCTGCCCCTTCAGGCCCCACAG No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151389_925151396 3 Left 925151389 2:1617827-1617849 CCCACAGCCACCTGTTGTTGACC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151382_925151396 20 Left 925151382 2:1617810-1617832 CCCCTGCCCCTTCAGGCCCCACA No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151391_925151396 -4 Left 925151391 2:1617834-1617856 CCACCTGTTGTTGACCCAGAGAG No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151386_925151396 13 Left 925151386 2:1617817-1617839 CCCTTCAGGCCCCACAGCCACCT No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151385_925151396 14 Left 925151385 2:1617816-1617838 CCCCTTCAGGCCCCACAGCCACC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151387_925151396 12 Left 925151387 2:1617818-1617840 CCTTCAGGCCCCACAGCCACCTG No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data
925151392_925151396 -7 Left 925151392 2:1617837-1617859 CCTGTTGTTGACCCAGAGAGTGC No data
Right 925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925151396 Original CRISPR AGAGTGCACCAGCCCTCGGC TGG Intergenic
No off target data available for this crispr