ID: 925152156

View in Genome Browser
Species Human (GRCh38)
Location 2:1622453-1622475
Sequence AGCAAGGCACGCCCTAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925152149_925152156 11 Left 925152149 2:1622419-1622441 CCAGGGAGGGAGGTGGCAGAAGC No data
Right 925152156 2:1622453-1622475 AGCAAGGCACGCCCTAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925152156 Original CRISPR AGCAAGGCACGCCCTAACCA GGG Intergenic
No off target data available for this crispr