ID: 925152365

View in Genome Browser
Species Human (GRCh38)
Location 2:1624005-1624027
Sequence GAGTAACCTCAGCTCGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925152365_925152370 16 Left 925152365 2:1624005-1624027 CCACCACCGAGCTGAGGTTACTC No data
Right 925152370 2:1624044-1624066 TGACAGCACGACGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925152365 Original CRISPR GAGTAACCTCAGCTCGGTGG TGG (reversed) Intergenic