ID: 925153609

View in Genome Browser
Species Human (GRCh38)
Location 2:1634340-1634362
Sequence GAGCACAGCCTGTCAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925153604_925153609 -1 Left 925153604 2:1634318-1634340 CCCGTCCTGGAGAAGAGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 174
Right 925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 235
925153603_925153609 3 Left 925153603 2:1634314-1634336 CCTGCCCGTCCTGGAGAAGAGAG 0: 1
1: 0
2: 0
3: 15
4: 213
Right 925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 235
925153606_925153609 -2 Left 925153606 2:1634319-1634341 CCGTCCTGGAGAAGAGAGACGGA 0: 1
1: 0
2: 0
3: 19
4: 277
Right 925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 235
925153601_925153609 18 Left 925153601 2:1634299-1634321 CCACGAAGCAGGTGACCTGCCCG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 235
925153607_925153609 -6 Left 925153607 2:1634323-1634345 CCTGGAGAAGAGAGACGGAGCAC 0: 1
1: 0
2: 2
3: 16
4: 161
Right 925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925153609 Original CRISPR GAGCACAGCCTGTCAGCTCT GGG Intronic
900184512 1:1326735-1326757 GAGCAGAGCCAGGCAGCTCCTGG + Intronic
900241086 1:1617838-1617860 GGGCACAGCCTGTGAACTGTGGG + Intronic
900706678 1:4085117-4085139 TAACAGAGCCTGTCAGCACTCGG - Intergenic
901655089 1:10764760-10764782 GAGCACTGCCTGGTGGCTCTGGG - Intronic
901767729 1:11514619-11514641 GAGCCCAGCATGTCAGAGCTGGG + Intronic
901847426 1:11992417-11992439 GAGCTCAGCCTGTCGGCTGCAGG + Intronic
903358116 1:22760549-22760571 GAGCTCAGCTTTTCAGCTTTGGG - Intronic
903438789 1:23371546-23371568 CAGGACAGCCTGTCATCACTGGG + Exonic
903578942 1:24356889-24356911 GACCACAGACTGTCAGCGCTGGG - Intronic
905149579 1:35917193-35917215 GTCCACAACCTGTCTGCTCTTGG + Intronic
905501987 1:38446673-38446695 GAGCTCAGCCTGTACTCTCTTGG - Intergenic
905557628 1:38899748-38899770 GAACACAGCAGCTCAGCTCTCGG - Intronic
906488462 1:46248990-46249012 GGACACAACCTGTCAGATCTAGG - Intronic
907842084 1:58168288-58168310 GAGGAAAGCCATTCAGCTCTGGG + Intronic
908558753 1:65284191-65284213 GAGCAGAGCCTGTCAGAAGTGGG - Intronic
909111143 1:71479199-71479221 GAGCACAGCTAATCAGCCCTTGG - Intronic
913382386 1:118226366-118226388 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
916083355 1:161250900-161250922 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
918070429 1:181130193-181130215 GATCACAGGCTGGCAGCTCTAGG + Intergenic
918276694 1:182959671-182959693 AAGCCCAGATTGTCAGCTCTGGG - Intergenic
921513693 1:216064259-216064281 GAGCCCATCCTGGCAGCTCAGGG + Intronic
922045309 1:221939700-221939722 GACCACAGGCTGGCAGCTCTTGG - Intergenic
922742385 1:228021345-228021367 GAGCACAGCCTGGGAGCTGTTGG + Intronic
924632452 1:245753600-245753622 GGGCACAGCCCTTCAGCACTGGG + Intronic
924792563 1:247266352-247266374 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1063859332 10:10290875-10290897 GAGGAAAGCCGCTCAGCTCTGGG - Intergenic
1064101536 10:12468615-12468637 GAGCACTGCCTGTGTTCTCTGGG + Intronic
1064603809 10:17017994-17018016 GAGGAAAGCCATTCAGCTCTGGG - Intronic
1066617582 10:37311118-37311140 GACCACAGCATCTCATCTCTGGG + Intronic
1067061330 10:43079383-43079405 GGGCATAGCCTGTCAGCCCCAGG + Intronic
1069137582 10:64784037-64784059 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
1069682708 10:70296651-70296673 GAGCACGGCCTGGCTGCTCATGG + Intergenic
1070580074 10:77712364-77712386 CAGGACAGGCTGTGAGCTCTGGG - Intergenic
1070789319 10:79180210-79180232 GTGCACAGCCTGGCACCTCGGGG - Intronic
1071475324 10:86020455-86020477 CAGCACAGCCTGTGGGCTCAGGG + Intronic
1071507839 10:86243377-86243399 GGGCACAGCCTGACAGTGCTTGG - Intronic
1071834604 10:89407136-89407158 GAGGAAAGCCATTCAGCTCTGGG + Intronic
1072480026 10:95802031-95802053 GACCATGGCCTGTCAGCCCTCGG + Intronic
1072629560 10:97135884-97135906 GGGCACAGTGTGTCAGCTCCTGG - Intronic
1073970506 10:109042045-109042067 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1074612771 10:115037814-115037836 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1075932136 10:126307995-126308017 GAGCACAGCCTTTCATCTGTAGG + Intronic
1075934492 10:126327701-126327723 GAACACTGCATGTCACCTCTGGG + Intronic
1076523229 10:131094050-131094072 GAGAACAGCCTTGCTGCTCTAGG - Intronic
1077233399 11:1468680-1468702 GCCCAGAGGCTGTCAGCTCTCGG + Intergenic
1078857538 11:15218982-15219004 GACCACAGCTTGTTAACTCTTGG - Intronic
1080827559 11:35860840-35860862 AAGCCCAGACTGCCAGCTCTGGG - Intergenic
1080858702 11:36134640-36134662 GAGCCCAGCCTTTCAGCTGAAGG + Intronic
1081569030 11:44278313-44278335 GAGCACAGCCTCTCAGCTCCTGG + Intronic
1081964611 11:47161869-47161891 CAGCACAGTCTGTCAGCTTGGGG - Exonic
1083988741 11:66233700-66233722 GATCACAGAAAGTCAGCTCTGGG + Intronic
1084295248 11:68209278-68209300 GAACAGTGCCTGGCAGCTCTGGG - Intronic
1084332275 11:68437173-68437195 GAGGACAGACTGTGAGCTGTGGG + Intronic
1084851460 11:71944611-71944633 GAGCACGGACAGTGAGCTCTTGG - Intronic
1085394165 11:76198272-76198294 GACCACAGAGTGTCAGCCCTGGG - Intronic
1087175514 11:95091527-95091549 GGGAACACCCTGTGAGCTCTAGG - Intronic
1087319038 11:96637244-96637266 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1088492311 11:110400238-110400260 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1088744817 11:112796484-112796506 GTGCAGAGCCTGTCAGAACTGGG + Intergenic
1088934150 11:114381647-114381669 GCACACTCCCTGTCAGCTCTTGG + Intergenic
1089424980 11:118365473-118365495 GAAAACAGCCTGACAGCTTTGGG - Intronic
1089847679 11:121471216-121471238 GAGCATTGACTGTCAGCTCCAGG + Intronic
1090281533 11:125460371-125460393 GAGCAGAGCCTTGCAGATCTAGG - Intronic
1090957592 11:131527152-131527174 GAGAATAGCTAGTCAGCTCTGGG - Intronic
1095974175 12:47928010-47928032 GAGCACAGCTTGTTATCTTTGGG + Intronic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1100050996 12:90447529-90447551 GAGGAAAGCCTTTCAGCTATGGG - Intergenic
1103011786 12:117463669-117463691 GGGCATAGCCTGACAGCCCTGGG + Exonic
1104933206 12:132351341-132351363 CAGCCCAGCCTGTCTCCTCTGGG + Intergenic
1106162448 13:27213455-27213477 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1107717931 13:43219027-43219049 GAGCTCAGCCAGTGAGGTCTGGG - Intronic
1108492673 13:50996904-50996926 GAACACAGCCTGACAGCTGCTGG - Intergenic
1110850666 13:80241279-80241301 GAGCACAGCCAGGCAGCTCCAGG + Intergenic
1110953905 13:81529147-81529169 CAGCACTGCTTGTCAGCTGTGGG + Intergenic
1112383556 13:98916616-98916638 GTGCACAGACTGTCTGCTGTGGG + Intronic
1112974637 13:105302380-105302402 GAGCAGAGCAAGACAGCTCTCGG + Intergenic
1113554048 13:111216795-111216817 GCGCACAGCCTGACAACCCTAGG - Intronic
1113942800 13:114027164-114027186 GAGCCCAGCCAGCCAGCCCTGGG - Intronic
1118608165 14:67518237-67518259 GAGCAAAGCCTGTCTGTTCCTGG - Intronic
1118966862 14:70595215-70595237 AAGCCCAGACTGCCAGCTCTGGG + Intronic
1121865456 14:97358814-97358836 GAACACAGCTTATCTGCTCTGGG - Intergenic
1122451123 14:101808417-101808439 CAGCACTGTCTGTCAGCTCTGGG + Intronic
1123918419 15:25054075-25054097 GAGCACAGACTATCCACTCTAGG - Intergenic
1123920666 15:25067650-25067672 GAACACAGACAATCAGCTCTGGG - Intergenic
1125604053 15:40930119-40930141 GAGCACAGCCTGGGCGCACTGGG + Intronic
1126119959 15:45242618-45242640 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
1127583816 15:60362774-60362796 CAGCAAAGCCTGTGAGATCTTGG + Intronic
1128706022 15:69837910-69837932 GAGGCCCTCCTGTCAGCTCTGGG + Intergenic
1129137378 15:73566610-73566632 GAGCACAGGCTGACTGCTCCTGG + Intronic
1130062090 15:80577555-80577577 GAGAAGAGGCTGGCAGCTCTTGG + Intronic
1130414506 15:83679785-83679807 GAGCACCGCCTGCCACCACTGGG + Intronic
1131401079 15:92126120-92126142 AAGCTCAGCCTGTCTGCCCTGGG + Exonic
1132033185 15:98456020-98456042 GAGTATGGCCTGTCATCTCTAGG - Intronic
1133248691 16:4466000-4466022 GAGCACATCCTGTCAGCTTGCGG - Intronic
1133267098 16:4591839-4591861 GAACACACCCTGGAAGCTCTGGG + Intronic
1133603575 16:7364036-7364058 TAGAACAGCCAGTCAGCTTTGGG + Intronic
1135388860 16:22071209-22071231 GGGCTCTCCCTGTCAGCTCTAGG - Intronic
1135524199 16:23201478-23201500 GAGCAGGGTCAGTCAGCTCTAGG + Intronic
1137588788 16:49680808-49680830 GAGCACAGCCTGCCAGGTCAAGG + Intronic
1138090889 16:54173692-54173714 CAGGACAGCCTATCAGCTCCTGG - Intergenic
1139366921 16:66439206-66439228 GAGCTCGGCCTGGCTGCTCTGGG + Intronic
1139570025 16:67806123-67806145 GAGAACAGGCAGTCAGCCCTCGG + Intronic
1139601102 16:67987760-67987782 GAGCACCGACTGCCACCTCTAGG - Exonic
1141817077 16:86418535-86418557 CAGCAAAGCCTGCCAACTCTGGG - Intergenic
1141820430 16:86441950-86441972 GAGCAGAGCCTGGGAGCACTGGG + Intergenic
1148125822 17:45236277-45236299 GAGCCCAGCCTGTCCTCACTGGG + Intronic
1148876291 17:50689439-50689461 GAGCACAGCCTGCCAGGCCAGGG - Intronic
1149598499 17:57878012-57878034 CAGTACAGCCTGCCAGCTCCTGG + Intronic
1149936352 17:60810839-60810861 AAGCCCAGACTGCCAGCTCTGGG + Intronic
1151724289 17:75875595-75875617 GAGCACAGCGTGCCACATCTGGG - Intronic
1152375089 17:79914812-79914834 GAGGTCAGCCTGGCTGCTCTGGG - Intergenic
1152554763 17:81047267-81047289 GGGGCCAGCCTGTCAGCTCTTGG - Intronic
1152718546 17:81911373-81911395 GCGGACAGCCTGGCAGCTCCCGG + Exonic
1152893524 17:82896427-82896449 CAGCACAGCCACCCAGCTCTGGG - Intronic
1155786332 18:29905999-29906021 AAACACACCCTCTCAGCTCTGGG - Intergenic
1158818531 18:61131542-61131564 GTGCACATCCTGTCTGCCCTGGG + Intergenic
1160627952 18:80225870-80225892 GAGCACACCTAGTCATCTCTGGG + Intronic
1162812594 19:13173227-13173249 AAAGACAGCCTGTCAGCTTTGGG + Intergenic
1163713013 19:18858016-18858038 GGGCACAGTCTGGCTGCTCTGGG - Intronic
1165998735 19:39864557-39864579 GAGCACATCCTGTAAGTTATTGG + Intronic
1166369806 19:42294415-42294437 AAGCACAGCCTGTCAGTGGTGGG + Intronic
1166529711 19:43535052-43535074 AAGCCCAGCCAGTCAGCTCCAGG + Exonic
1168466226 19:56603999-56604021 GAACACAGCCTTCCAGGTCTGGG - Intronic
925153609 2:1634340-1634362 GAGCACAGCCTGTCAGCTCTGGG + Intronic
925153615 2:1634376-1634398 GAGCAAAGCCTGTCAGCTCCGGG + Intronic
926051954 2:9750938-9750960 CAGCCCAGCCTGTCAGCTGTAGG - Intergenic
926831041 2:16962120-16962142 AAGCAGAGCCTGTCTCCTCTGGG - Intergenic
927095573 2:19745552-19745574 CAGCTCAGCCTGTAAGCTCTGGG + Intergenic
927808878 2:26171122-26171144 GAGCAAAGCATTTCTGCTCTTGG + Intergenic
930007575 2:46910293-46910315 GAGGTCAGTCTGTCAGCCCTAGG - Intronic
930664161 2:54085365-54085387 GAGCCCATCCTGGCAGCTCAGGG - Intronic
932293766 2:70607467-70607489 GAACACAGCCTGCCTTCTCTGGG - Intergenic
937721284 2:125099859-125099881 GAGCAGTGCCTATCAGCACTTGG - Intergenic
938366224 2:130736670-130736692 GAGGCCAGCCTGCCAGCTCCTGG + Intergenic
938806436 2:134810647-134810669 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
938811637 2:134859058-134859080 GAGCACACCCCTTCAACTCTAGG + Intronic
940122108 2:150278334-150278356 GAGCCCACCATGTCAGGTCTGGG - Intergenic
946207607 2:218121184-218121206 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
948429257 2:237908854-237908876 CAGCACAGCCTGTCACCCCCAGG - Intronic
948459150 2:238120777-238120799 GAGGGCAGGCTGTCAGCTGTGGG + Intronic
948599501 2:239100299-239100321 GAGCAAAACGTGACAGCTCTGGG - Intronic
948834825 2:240620794-240620816 GGGCAAAGCCTGTCAGCTGTGGG - Intronic
1171346139 20:24468326-24468348 GACCACAGCCTTGCAGCTCTGGG + Intergenic
1172132595 20:32665376-32665398 GAGCACAGGCTCTCTGCTCTTGG - Intergenic
1172216668 20:33240413-33240435 CATCACACCCTGTCATCTCTGGG - Intronic
1172330840 20:34075110-34075132 GTGCACAGCCTGGGAGCCCTGGG + Intronic
1172793031 20:37519289-37519311 GAGCACAGCGGCTCAGCTCCTGG - Exonic
1174116533 20:48230255-48230277 AAGCACTGCCGCTCAGCTCTAGG - Intergenic
1174465329 20:50712876-50712898 AAGCACAGCATTTCACCTCTTGG + Intergenic
1177191606 21:17857751-17857773 GCCCACTGCCTCTCAGCTCTAGG - Intergenic
1178299296 21:31438507-31438529 CAGCACAGACTGTCAGCTCATGG - Intronic
1180595792 22:16972420-16972442 GAACACAGCCTGGCAGTTCAAGG + Intronic
1181486220 22:23233336-23233358 GAGAACAGCCTGTCACCACCGGG - Intronic
1181932803 22:26416397-26416419 GTACACAGCCTCTCAGTTCTAGG + Intergenic
1182902283 22:33908460-33908482 GTGCACAGCTTGACAGGTCTAGG + Intronic
1183536461 22:38404378-38404400 GAGAACAGGCTTTCGGCTCTGGG - Intergenic
1183788096 22:40043478-40043500 GAGAACAGCCCTTCAGCTCCTGG - Exonic
1184437798 22:44490146-44490168 GAGCACAGCCTGGTTGCTCAGGG + Intergenic
1184624383 22:45712182-45712204 GGGCACAGGCTGTCAGGTTTGGG + Intronic
1184882881 22:47322577-47322599 AACCACAGCCTGCCAGCTATAGG - Intergenic
952958545 3:38575692-38575714 GTGAACAGCCTGGCAGGTCTGGG + Intronic
952964160 3:38610720-38610742 GAACACAGCCTCTCAGCTATGGG - Intronic
953964690 3:47294980-47295002 GAGCAGAGCTGCTCAGCTCTTGG + Intronic
954293945 3:49663919-49663941 GAGAACAGCCTGGGTGCTCTGGG - Intronic
956746051 3:72311632-72311654 GAGAAGAGAATGTCAGCTCTTGG - Intergenic
958121093 3:89289481-89289503 TAGCACAGCCTGTCTACTCCAGG - Intronic
960929127 3:122826384-122826406 CAGCTCTGCCTGTCAGCGCTTGG + Intronic
960992343 3:123320137-123320159 GAGCAGAGCCTGTTAGCTGTAGG - Intronic
961410160 3:126714578-126714600 AGGCTCAGCCTGTCAGCTCCTGG - Intronic
961868788 3:129973728-129973750 GAGCTGAGCCTGGCTGCTCTCGG - Intergenic
962705924 3:138044450-138044472 GAGCGAATCCTGTCAACTCTGGG - Intergenic
963021014 3:140873174-140873196 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
964269875 3:154944463-154944485 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
964483362 3:157163256-157163278 AAGCCCAGACTGCCAGCTCTGGG - Intergenic
967604847 3:191433155-191433177 GGGCACAACCAATCAGCTCTAGG + Intergenic
968232635 3:197012625-197012647 GAGCCCCGGCTGTCAGCCCTTGG - Intronic
968468061 4:762995-763017 GAGCAGAGGCTGTCAGGTCATGG + Intronic
968689701 4:1984178-1984200 GAGCTGAGCCTGTCACCTCCAGG - Intronic
969264911 4:6057908-6057930 GGGCACAGACTGCCAGCTCCCGG - Intronic
972538729 4:40020913-40020935 AAGCTCAGACTGCCAGCTCTGGG + Intergenic
975689768 4:76951106-76951128 GAGCACAGCCTTGCATTTCTGGG - Intronic
977883830 4:102236074-102236096 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
978465645 4:109005842-109005864 TAGCACATGCTGTTAGCTCTGGG - Intronic
978885375 4:113761541-113761563 GGGCTCAGGCTGTCCGCTCTGGG - Intronic
979090433 4:116477124-116477146 GAGCACAGCCTGTCAGGCTGAGG - Intergenic
980066188 4:128191526-128191548 GAGCACTGCCTGTCAGATGGTGG + Intronic
982064437 4:151640713-151640735 GTGCAGAGCCTCCCAGCTCTGGG + Intronic
986616379 5:9621537-9621559 GAGCAGAGCTTGTCAGTTATAGG - Intergenic
990779974 5:59349444-59349466 GATCAAAGCCTGTCTGATCTGGG - Intronic
995215355 5:109588978-109589000 AAGCCCAGACTGCCAGCTCTGGG + Intergenic
998148202 5:139742396-139742418 GACCGCAGCCTGTCAGCTGCAGG - Intergenic
998700861 5:144698125-144698147 GATCACATCCTTTCAGCCCTTGG + Intergenic
998850216 5:146344712-146344734 TAGCAGTGCCTATCAGCTCTCGG + Intergenic
999250482 5:150179633-150179655 GACCACTGCCTGTCATCCCTAGG + Intronic
1000084960 5:157880767-157880789 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1001535827 5:172497234-172497256 CAGCACTGCCTGCCAGCACTGGG - Intergenic
1001962226 5:175886452-175886474 GAGCCCAGCCTGGGGGCTCTGGG - Intergenic
1002202339 5:177536846-177536868 GGGCACAGCCTCTCAGCACAGGG + Intronic
1002331284 5:178442747-178442769 GAGTACAGCAGGTCAGGTCTTGG - Intronic
1002689269 5:181038898-181038920 GAGCACAGACAGTCACCTCCAGG + Intergenic
1003382412 6:5637159-5637181 GAACGCTCCCTGTCAGCTCTGGG - Intronic
1003516738 6:6824520-6824542 CAGCACAGCCTGCCATCTCCAGG - Intergenic
1003644352 6:7902376-7902398 GAGCACAGCCAGCCATCTCTAGG + Intronic
1007647761 6:43396013-43396035 CACCACAGGCTGGCAGCTCTTGG + Intergenic
1011375297 6:86680530-86680552 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
1013669921 6:112389658-112389680 AACTACTGCCTGTCAGCTCTTGG - Intergenic
1013977145 6:116091854-116091876 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1014009235 6:116457918-116457940 AAGCCCAGACTGCCAGCTCTGGG - Intergenic
1014343153 6:120233589-120233611 TGGCACAGCCTCTCAGGTCTTGG - Intergenic
1019148563 6:169989065-169989087 GCGCACAGCCTGCCAGATCCAGG - Intergenic
1019613677 7:1949151-1949173 GACCGCAGAGTGTCAGCTCTAGG - Intronic
1019760795 7:2811143-2811165 GTGCACAGCCTGGGGGCTCTGGG - Intronic
1021014103 7:15511135-15511157 GAGCTCATCCTGGCAGCTCAGGG + Intronic
1022627385 7:32051799-32051821 GAGCAGAGCCACTGAGCTCTTGG - Intronic
1023151321 7:37203835-37203857 GAGGAAAGCCATTCAGCTCTGGG - Intronic
1023935578 7:44737592-44737614 GTGCAGACCCTGTCAGGTCTTGG + Intergenic
1024658402 7:51471577-51471599 GAGCAAAGCCTGTCAGCCCAGGG - Intergenic
1027790844 7:82637854-82637876 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1029631195 7:101751688-101751710 GAGGACAGCCTCTCTCCTCTAGG - Intergenic
1032648990 7:133857505-133857527 CAGCACAGCCTGGCAGCCCAGGG - Intronic
1035601433 8:899267-899289 CAGCACAGCCTGTGAGCCATTGG + Intergenic
1036684934 8:10903315-10903337 GAGGACAGCCTGTGAATTCTGGG + Intronic
1039599098 8:38819096-38819118 AAGCACAGCCTGACAGCTTCAGG - Intronic
1040526909 8:48233726-48233748 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1040971734 8:53142727-53142749 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
1042625095 8:70748726-70748748 GAGGCCAGGCTGTCAGTTCTGGG + Intronic
1042782396 8:72506211-72506233 GAGCCCATCCTGGCAGCTCAGGG - Intergenic
1042919330 8:73906811-73906833 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1043295318 8:78654522-78654544 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1044755989 8:95461725-95461747 GGGCCCAGCCTGCCTGCTCTTGG + Intergenic
1045233165 8:100325459-100325481 GACCACACCTTGTCACCTCTAGG + Intronic
1045402816 8:101835508-101835530 GAGCTCAGCCTATCAGCATTTGG - Intronic
1045552002 8:103181151-103181173 GAGCACAACCACTCACCTCTGGG - Intronic
1048992892 8:139771759-139771781 CAGCCCAGCCTGGCGGCTCTGGG - Intronic
1049877229 8:145032565-145032587 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1051934982 9:22435316-22435338 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1055229550 9:74045076-74045098 GAGCATATCCTGGCAGCTCAGGG - Intergenic
1055439961 9:76327835-76327857 GAGTACAGCCCTTGAGCTCTGGG - Intronic
1056050560 9:82763953-82763975 GAATACAGCCTGTCTGATCTTGG - Intergenic
1057272940 9:93660781-93660803 GGGCAAAGCCTGTCCACTCTGGG - Intronic
1057306597 9:93916082-93916104 GGGCACAGGCTGCCAGCTCCAGG + Intergenic
1057693927 9:97310496-97310518 GAGCTCTGACTGTCAGCTATGGG + Intronic
1059312043 9:113395270-113395292 GAGCACAGCCTTTCAGGTAAAGG - Intronic
1059614261 9:115931847-115931869 GAGCACAGCATGTCAGCCCAGGG - Intergenic
1186799865 X:13082221-13082243 GAGCACAGAGTTTCAGCTTTGGG + Intergenic
1187446302 X:19364190-19364212 GAGCCCAGCCTGTGGACTCTGGG - Intronic
1188202247 X:27305509-27305531 TAGCACAGCCTGTCAGGGGTTGG + Intergenic
1195369075 X:104155654-104155676 GTGCAAAGCCTGCAAGCTCTGGG - Intronic
1195552673 X:106186253-106186275 GAGGAAAGCCATTCAGCTCTGGG - Intronic
1195700295 X:107700339-107700361 GAGCACAGCCTGTGCTCTCCTGG - Intergenic
1196419694 X:115508896-115508918 GAGGAAAGCCATTCAGCTCTAGG - Intergenic
1196488704 X:116244263-116244285 GAGGACAGCCATTCAGCTCTGGG + Intergenic
1196750964 X:119116892-119116914 GGCCACAGCTTGTCATCTCTGGG + Intronic
1198534852 X:137575144-137575166 GAGAACATACTGTCCGCTCTTGG - Intronic
1199671896 X:150154678-150154700 GTACCCAGCCTGTCAGCACTAGG + Intergenic
1201407755 Y:13665507-13665529 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
1201530314 Y:14984304-14984326 GAGGAAAGCCATTCAGCTCTGGG + Intergenic
1201729834 Y:17191741-17191763 GAGGAAAGCCATTCAGCTCTGGG - Intergenic
1202090137 Y:21180292-21180314 GAGGAAAGCCATTCAGCTCTGGG - Intergenic