ID: 925154363

View in Genome Browser
Species Human (GRCh38)
Location 2:1638568-1638590
Sequence CAGCCAGGTGACCTTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925154363_925154369 15 Left 925154363 2:1638568-1638590 CCTCCAGCAAGGTCACCTGGCTG 0: 1
1: 0
2: 0
3: 31
4: 254
Right 925154369 2:1638606-1638628 TGACACAGATTGCCCCTGCCTGG 0: 1
1: 0
2: 2
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925154363 Original CRISPR CAGCCAGGTGACCTTGCTGG AGG (reversed) Intronic
900115130 1:1025068-1025090 CAGCCAGGAGTCCCTCCTGGGGG - Intronic
900484486 1:2914976-2914998 CAGCCATGGGTCCTTCCTGGTGG - Intergenic
900717859 1:4156735-4156757 CAGCCTGGTGACAGTGCTGGGGG - Intergenic
900818697 1:4869923-4869945 CGGCCACGTGACTTTGCTGTGGG - Intergenic
900920929 1:5669944-5669966 CAGCCAGATGACCTTGGGGCTGG - Intergenic
900984011 1:6062769-6062791 CAGGCAGGTGACTTTTTTGGGGG + Intronic
902985050 1:20149910-20149932 CTGCCAGGCGAGCTTGCTGGCGG - Exonic
903193885 1:21670890-21670912 CAGCTAGGGAAGCTTGCTGGAGG - Intergenic
904953414 1:34262739-34262761 CAGCCAGGTGACCTTGAGCCCGG + Intergenic
907868723 1:58423716-58423738 CTGCCAGGTGACCTTCTTCGTGG + Intronic
908020975 1:59898339-59898361 AAGCCAGGACAGCTTGCTGGAGG + Intronic
908419696 1:63947664-63947686 CAGCTAGAAGACCTTCCTGGGGG + Intronic
908872945 1:68635363-68635385 CAGCCCAGTAACCTTGCTGTTGG + Intergenic
915478997 1:156172466-156172488 CTGCCAGGCCTCCTTGCTGGAGG + Intronic
916786381 1:168090005-168090027 AGGCCAGCTGACCTTGCTGGAGG + Intronic
917007801 1:170434738-170434760 AAGCCAAGTGACATTGCTTGAGG + Intergenic
917306301 1:173628487-173628509 TAGCCAGGTGGACTTGCTGTGGG + Intronic
921839536 1:219813729-219813751 CAGCCATGTGACCTTGTGAGAGG + Intronic
922979845 1:229816452-229816474 CCTGCTGGTGACCTTGCTGGGGG + Intergenic
1063390409 10:5646480-5646502 CAGCCCCGTGACCTTGCTCAGGG + Intronic
1063958704 10:11288287-11288309 CAGGCAGGTGACCTTGCACAGGG + Intronic
1067030767 10:42877835-42877857 CACCCAGGTGCCCATGCTGGGGG - Intergenic
1067083871 10:43228101-43228123 CAGCGAGGTGGCGTGGCTGGGGG - Intronic
1067343642 10:45422917-45422939 CTGCCACGTGACCATGCTGTGGG - Intronic
1067444932 10:46335950-46335972 CAGTCATGTGACCTTGGGGGGGG + Intergenic
1069634479 10:69917102-69917124 CAGCTATGTGAACTTGCAGGAGG - Intronic
1073614621 10:104981053-104981075 CTTCCATTTGACCTTGCTGGAGG + Intronic
1075795036 10:125114237-125114259 CAGCCACGTGAACTTGGAGGGGG - Intronic
1077251971 11:1564720-1564742 CTGCCGGGAGTCCTTGCTGGGGG + Intronic
1078403425 11:11047248-11047270 CAGCCATCTGACCTTCCAGGAGG - Intergenic
1078545344 11:12242820-12242842 CAGCCAGGTGACCTTGAATCAGG + Intronic
1078920572 11:15826624-15826646 CAGGGAGGTGACCTGGCTGGAGG - Intergenic
1079951488 11:26810377-26810399 CAGAGAGGCGACCTGGCTGGTGG - Intergenic
1080870254 11:36230459-36230481 GAGCCAGGAGAGCTTGCTGGAGG - Exonic
1081812994 11:45923559-45923581 CAGCCAGGTGTCCGTGGAGGAGG + Intronic
1083279823 11:61620048-61620070 CAGCCAGGAGGGCTTCCTGGAGG - Intergenic
1083681535 11:64353997-64354019 CAGCCAGCTGCCCTTCCTGGGGG - Exonic
1083783684 11:64931742-64931764 CACCCAGGTGATGTTTCTGGGGG + Exonic
1084049893 11:66592817-66592839 CAGCCAGGTGGCCAAGCTGCTGG - Exonic
1088685531 11:112281614-112281636 AAGCCAGGTCGCCTTACTGGGGG - Intergenic
1089443799 11:118535564-118535586 CAGGAAGGTGCCCTTCCTGGAGG + Exonic
1089540765 11:119187954-119187976 ACAGCAGGTGACCTTGCTGGTGG + Exonic
1090334061 11:125951042-125951064 ACTCCAGGTGACGTTGCTGGGGG - Intergenic
1090964375 11:131585317-131585339 CTGCCAGCTGGCCTGGCTGGGGG + Intronic
1091447460 12:552184-552206 CAGGAAGGTGACCTTGCAGAGGG + Intronic
1091919977 12:4296267-4296289 AACCCAGATGACCTTGCCGGGGG + Intronic
1096411962 12:51383463-51383485 CAGTCAGGAGGCCTTCCTGGAGG - Exonic
1102190335 12:110982957-110982979 CAGCTGGGTGACCTTGCTCAGGG - Intergenic
1102710240 12:114919611-114919633 CAGCGAGTTGAGCTTCCTGGCGG - Intergenic
1102875759 12:116447399-116447421 CTGCCAGTTGTCCTGGCTGGTGG + Intergenic
1103544553 12:121690664-121690686 CATCCAGGTGACTTTTTTGGGGG - Intergenic
1103979022 12:124724046-124724068 CAGCAAGGTGACCTTGGGTGAGG - Intergenic
1104373565 12:128244874-128244896 CAGCCAGGTGCCAATGATGGGGG + Intergenic
1104859623 12:131917440-131917462 CACCCAGGAGCCCGTGCTGGGGG + Exonic
1104990933 12:132623462-132623484 CTGCTAGGTGGCCTTCCTGGGGG + Intergenic
1113165658 13:107438673-107438695 CAGCCAGGTGTGGTTGGTGGTGG + Intronic
1117339245 14:54779804-54779826 CAGCCAGGAGACCCTTCAGGTGG + Intronic
1118887458 14:69879126-69879148 TAGCCAGGTGAGCCTTCTGGTGG + Intronic
1120441097 14:84541080-84541102 CAGCCAGTTGACATTGCAGAAGG + Intergenic
1121692545 14:95888433-95888455 CAGCTAGGTGGCCTTGCTGCGGG + Intergenic
1122091530 14:99344042-99344064 CAGCAAGGTGACTTTATTGGGGG - Intergenic
1123818497 15:24002931-24002953 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1123847160 15:24314258-24314280 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1123866158 15:24521325-24521347 CAGCCAGGTCCCCTTGATGAAGG - Intergenic
1125674907 15:41496531-41496553 CATGCAGCTGACCTTGCGGGTGG - Intronic
1125714556 15:41812001-41812023 CAGCCAGGTGGCCGAGCTGCAGG + Exonic
1126321794 15:47432004-47432026 CAGCCATGTAACATTGCGGGTGG - Intronic
1127640472 15:60911414-60911436 CAGTCAGTTGACTTTACTGGCGG + Intronic
1128898388 15:71396544-71396566 CAGCCACATCATCTTGCTGGAGG + Intronic
1129718311 15:77864505-77864527 CCCCCAGGTGACTTTGCTGTTGG - Intergenic
1130085999 15:80779096-80779118 CAGCCAGGTGAGGGCGCTGGAGG - Intergenic
1130250656 15:82298488-82298510 CAGACCGGGGTCCTTGCTGGTGG - Intergenic
1132545651 16:531826-531848 CAGCCCGGTGACCTCACTGGTGG - Intronic
1132617166 16:847408-847430 CAGCCATGTGGACATGCTGGAGG - Intergenic
1132677569 16:1127000-1127022 GAGCCTGCTGAGCTTGCTGGTGG - Intergenic
1132841908 16:1982189-1982211 CAGCCAGGGCAGCTTCCTGGAGG - Exonic
1133141372 16:3747078-3747100 CAGGCAGGGGGGCTTGCTGGGGG - Intronic
1133559934 16:6941504-6941526 CAGTAAGGGGACCCTGCTGGTGG + Intronic
1133813485 16:9178884-9178906 CCTCCAGGTGCCCTTCCTGGAGG + Intergenic
1134309682 16:13064323-13064345 GAGACAGGTGACCTTGCTTAGGG + Intronic
1135120959 16:19766371-19766393 CATCCACGTGCCCTTCCTGGTGG + Intronic
1135147413 16:19974723-19974745 CTGCCAGGTCACCGGGCTGGTGG - Intergenic
1135743338 16:24995473-24995495 GAGGCAGGTGACATGGCTGGGGG + Intronic
1136401940 16:30024024-30024046 CATCCTGGTGGGCTTGCTGGTGG + Exonic
1137522711 16:49208626-49208648 AAGCCAGGTGACCTGGTTGGTGG + Intergenic
1137651621 16:50125331-50125353 CTGCCAAGTGAGCATGCTGGAGG + Intergenic
1139430662 16:66909444-66909466 CAGCCAGGTGGCTGGGCTGGGGG - Intronic
1139478709 16:67216387-67216409 CATGTTGGTGACCTTGCTGGAGG - Intronic
1140041829 16:71413241-71413263 CTCCCAGGTGACCTTGATGCTGG - Intergenic
1140201753 16:72900600-72900622 CAGCCAGGTGGGCTTGGTGATGG + Intronic
1140729463 16:77843209-77843231 CATCAAGGTGACCTTGCTATGGG + Intronic
1141500907 16:84443481-84443503 CAGCGAGGGGTCCGTGCTGGGGG - Intronic
1141566707 16:84907234-84907256 CTGGCACGTGTCCTTGCTGGCGG + Exonic
1141596491 16:85100123-85100145 CAGCCAGGTGAGCGTGTGGGTGG - Exonic
1141757011 16:85997931-85997953 CAGCCAGGGGTCCTTCCAGGAGG + Intergenic
1141845320 16:86604468-86604490 AAGCCATGAGTCCTTGCTGGAGG + Intergenic
1142138930 16:88464017-88464039 CAGCCAGGAGCCCTTGATCGAGG + Intronic
1142715759 17:1745993-1746015 CAGCCACGTGACCCTGGTGGAGG - Intronic
1142893278 17:2958825-2958847 CAGCCAGGTGTCCCTGAGGGTGG + Intronic
1143103220 17:4515205-4515227 CATCCCGGTGGCCTGGCTGGAGG + Intronic
1143289445 17:5817900-5817922 CAGCCAGGAGGGCTTCCTGGAGG + Intronic
1144068358 17:11644365-11644387 CAGCTAGGTGAGGGTGCTGGTGG + Intronic
1144320084 17:14107584-14107606 CAGCCAGGTGACCTTGGCTGTGG - Intronic
1148127871 17:45246115-45246137 AAGCCAGCTGTCCTTGCTGTGGG + Intronic
1148141930 17:45335113-45335135 CAGCCAGGTGCTCTTGCTGTGGG - Intergenic
1148271838 17:46267369-46267391 CTGGCTGGTGACCCTGCTGGTGG + Intergenic
1150764537 17:67993167-67993189 CCGGCTGGTGACCCTGCTGGTGG - Exonic
1151769269 17:76149250-76149272 CTGCCAGGAGACCTGGCTGGTGG - Intronic
1152066460 17:78115231-78115253 CAGCCATGTGACCCTGCTGCTGG - Intronic
1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG + Intergenic
1157595097 18:48859560-48859582 CAGCCAGGGGGCCTGGCAGGCGG + Exonic
1157628077 18:49068256-49068278 CAGCCTGGTGACCTTGGATGAGG + Intronic
1158553264 18:58455133-58455155 CAGTGAGGTGACCTTGGAGGAGG - Intergenic
1159101533 18:63964064-63964086 AAGCCATATGTCCTTGCTGGAGG - Intronic
1160073154 18:75645783-75645805 CAGCCAGGTGCAGGTGCTGGAGG + Intergenic
1160383421 18:78478146-78478168 CAGCCATGTGAGCTAGCAGGAGG - Intergenic
1160504790 18:79420965-79420987 CATCTAGGTGGCCCTGCTGGAGG - Intronic
1160521057 18:79508264-79508286 AAGCCTGGTCACCTGGCTGGAGG + Intronic
1161017674 19:1991302-1991324 CAGTCAGGTGACAGAGCTGGAGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161560039 19:4968249-4968271 CAGCGAGGTTACTTTGCTGGAGG + Intergenic
1161677649 19:5661458-5661480 CAGCCCTGGGACCTGGCTGGGGG + Intronic
1161684222 19:5695151-5695173 CAACCAGGAGGCCTTCCTGGAGG - Intronic
1162054783 19:8056070-8056092 CAGACAGGTGCCCTTGCCTGTGG + Intronic
1164715987 19:30390731-30390753 CAGCCCCGTGAGCTTACTGGAGG + Intronic
1165178235 19:33945858-33945880 CAGCCACATGACCCTTCTGGAGG + Intergenic
1165212375 19:34246300-34246322 CAGCCAAGTGCTCTTGGTGGTGG - Intergenic
1166979347 19:46623637-46623659 CGGCCTGGTGGCCCTGCTGGTGG - Exonic
1167716304 19:51144620-51144642 CTGTCAGGTGACCTTGCCTGGGG + Exonic
1167768426 19:51499480-51499502 CTGTCAGGTGACCTTGCCTGGGG - Exonic
1168273241 19:55261791-55261813 GAGCCAGGTGCCGTTGATGGAGG - Intergenic
1168291219 19:55358620-55358642 CGGCCAGCTGTCCTTACTGGAGG - Exonic
1168309881 19:55455087-55455109 CAGCCAGGTGGACCGGCTGGTGG - Exonic
1168649921 19:58086386-58086408 CAGGGAGGTGGCCTTGGTGGGGG - Intronic
925154363 2:1638568-1638590 CAGCCAGGTGACCTTGCTGGAGG - Intronic
926135228 2:10331470-10331492 CACTCAGGAAACCTTGCTGGTGG + Intronic
926196898 2:10769414-10769436 AAGCCAGGTGGCCAGGCTGGTGG + Intronic
926773271 2:16397146-16397168 CAGCCAAGTGACCATGGTGCTGG + Intergenic
928856027 2:35803490-35803512 CAGCCAGGTAGACTCGCTGGTGG + Intergenic
929018612 2:37527392-37527414 CTGCCAGGTGAACTGGTTGGGGG + Intergenic
932745196 2:74328276-74328298 CAGCCATGTGACCAAGGTGGGGG + Intronic
934568353 2:95352894-95352916 CAGCCTGGTCACCCTGCAGGAGG + Intronic
936147543 2:109990860-109990882 CAGCCAGGTTACCTTGGGAGTGG + Intergenic
936197149 2:110380581-110380603 CAGCCAGGTTACCTTGGGAGTGG - Intergenic
937268065 2:120629755-120629777 CAGCCAGGAGCCCCTCCTGGAGG - Intergenic
937771012 2:125721045-125721067 CAGCCCTTTGCCCTTGCTGGTGG + Intergenic
938206425 2:129428316-129428338 CAGACAGATGAGCTTCCTGGAGG - Intergenic
938599735 2:132824819-132824841 CACTCAGGAGACCTTGCTGATGG - Intronic
946040038 2:216775302-216775324 CAGACAGCTGGCCTGGCTGGGGG + Intergenic
947995833 2:234526362-234526384 CATCAAGGTGTCCTTGATGGAGG + Intergenic
948480061 2:238243573-238243595 GAGACATGTGACCTTCCTGGTGG + Intergenic
1168835399 20:874135-874157 CAGCCAGGTGAGCTTATGGGTGG + Intronic
1169265848 20:4167003-4167025 GGGCCAGGGGACATTGCTGGGGG + Intronic
1169589156 20:7121441-7121463 CTGCCGTGTGACCCTGCTGGGGG + Intergenic
1170142886 20:13142724-13142746 CAGCCATGTGAGCTTGGAGGAGG - Intronic
1170940476 20:20844400-20844422 CATCCAGCTGTCCTAGCTGGAGG - Intergenic
1171344116 20:24452716-24452738 GAGCCAGGAGAACTTTCTGGTGG - Intergenic
1171773750 20:29347235-29347257 CAGCCAGATGACCTTGGGGCTGG + Intergenic
1171815762 20:29784784-29784806 CAGCCAGATGACCTTGGGGCTGG + Intergenic
1171902604 20:30871253-30871275 CAGCCAGATGACCTTGGGGCTGG - Intergenic
1172444090 20:34984308-34984330 CAGCCAGGAGGCCTTCCTAGAGG + Intronic
1172993695 20:39054323-39054345 CAGCCAGGGGATCTTGGGGGAGG - Intergenic
1173525366 20:43728363-43728385 CAGCCATGTGACCTTGGGGAAGG + Intergenic
1174605230 20:51756610-51756632 CAGCCCGGTGACCTTATAGGAGG - Intronic
1175275212 20:57763820-57763842 CAGCCAGCTGACCTTTCTAAAGG - Intergenic
1175334638 20:58187282-58187304 GAGCCAGGTGACATTGGTGAGGG + Intergenic
1175778521 20:61667751-61667773 CAGCCCACTGACCTTGCTGCTGG + Intronic
1175934153 20:62507444-62507466 CACCCAGGAGGCCATGCTGGGGG - Intergenic
1176187003 20:63786027-63786049 CTGGCAGGTGCCCGTGCTGGAGG - Intronic
1177081501 21:16644144-16644166 CAGCCACGTGACCTTAGAGGAGG + Intergenic
1177577789 21:22981667-22981689 TAGCTTGGTGTCCTTGCTGGGGG - Intergenic
1179368639 21:40783012-40783034 CTGCCAGGGGAGGTTGCTGGTGG + Intronic
1179502585 21:41819526-41819548 CAGCCAGGCCACCCTGCTGCAGG - Intronic
1180319213 22:11305351-11305373 CAGCCAGATGACCTTGGGGCTGG + Intergenic
1181490954 22:23260549-23260571 AAGCCAGGTGGCCATGCTGTGGG + Intronic
1181639964 22:24191143-24191165 CAGCCATGGGAGCTTGCGGGTGG + Intergenic
1182299445 22:29329565-29329587 CAGCCAGGTGGCCCTGATTGAGG - Intronic
1182362316 22:29754037-29754059 CAGCCAGGTGTCCTTGCACAAGG + Intronic
1183409645 22:37647342-37647364 CAGCCAGGTGAGGATGTTGGAGG + Exonic
1184014929 22:41778802-41778824 CAGCCAGGGCACCTTGGTGAAGG - Exonic
1184367326 22:44060442-44060464 GAGCCAGAAGAACTTGCTGGTGG + Intronic
1185274471 22:49944389-49944411 GAGTGAGGTGACCCTGCTGGGGG - Intergenic
950143957 3:10634685-10634707 AAGACAGGTCACCCTGCTGGAGG - Intronic
952885865 3:38010598-38010620 CAGCCAGGAGCGCCTGCTGGAGG - Intronic
954314957 3:49795942-49795964 CAGGAAGGAGACCTGGCTGGAGG + Exonic
954446918 3:50551812-50551834 CAGGCAGGTCACCTGTCTGGTGG - Intergenic
954446921 3:50551816-50551838 CAGACAGGTGACCTGCCTGAGGG + Intergenic
955217222 3:56994319-56994341 CTGCCAGGTGCCATTTCTGGAGG + Intronic
955649203 3:61175388-61175410 CAGTCTGGTGACTTTGATGGGGG - Intronic
958075302 3:88668748-88668770 AAGCCAGAAGACCTTGATGGTGG + Intergenic
959080506 3:101796073-101796095 GAACCAGGTGAGGTTGCTGGAGG - Intronic
959567517 3:107847854-107847876 CGCCCAGGTGACCTTGCACGCGG + Intergenic
960583458 3:119300037-119300059 GAGGCAGGTGCCCCTGCTGGAGG + Intronic
961591378 3:127984273-127984295 CACTAAGGTGACCTTGCTGGAGG + Exonic
962462439 3:135626997-135627019 CAGCAAGGTCACCTGCCTGGAGG + Intergenic
964169318 3:153750228-153750250 TAGCCAGGTTAGCTTGCTAGTGG + Intergenic
964861271 3:161204407-161204429 TAGCCACGTGACATTGCTGGAGG + Intronic
967335902 3:188344443-188344465 CAGCCAGGTGACATTACAGCTGG - Intronic
968048273 3:195635815-195635837 GGGCCAGGTGACCTTTATGGCGG + Intergenic
968099131 3:195953805-195953827 GGGCCAGGTGACCTTTATGGCGG - Intergenic
968306337 3:197654106-197654128 GGGCCAGGTGACCTTTATGGCGG - Intergenic
968565790 4:1312041-1312063 CAGCCACGTCACCATGGTGGTGG + Exonic
968901616 4:3434859-3434881 CAGTCAGGGGTCCTGGCTGGGGG + Intronic
968982548 4:3858210-3858232 CAGCCAGGAGGGCTTCCTGGAGG - Intergenic
969456040 4:7300202-7300224 CTGCCAGGAGAGCTTCCTGGAGG + Intronic
970742275 4:19251988-19252010 CAGCCAGGTCACGGTGCTGGAGG + Intergenic
972267928 4:37481019-37481041 TAGCCAGGTTACTTTGCTGTAGG - Intronic
972286986 4:37658552-37658574 TAGCCACGTGACCTTGATGTTGG - Intronic
974743423 4:66037932-66037954 CAGCAAGGTGAACTTTTTGGTGG + Intergenic
976408032 4:84681418-84681440 CACCCAGATGACCTTTTTGGTGG + Intronic
978793971 4:112690547-112690569 CAACCAGGTTACCTTGGTAGGGG + Intergenic
982072161 4:151705091-151705113 CAGCCATGTGACCTTGAAGGAGG - Intronic
984549417 4:181142868-181142890 CAGGCAGGTGACCTCTGTGGAGG - Intergenic
984668468 4:182454144-182454166 CAGTAAAGTGACCTTGATGGAGG + Intronic
985504761 5:272310-272332 GGGCCAGGTGACCTTTATGGCGG + Intronic
985710364 5:1424389-1424411 CAGTGATGAGACCTTGCTGGGGG - Intronic
985743353 5:1633285-1633307 GGGCCAGGTGACCTTTATGGTGG - Intergenic
986129547 5:4914674-4914696 AAGGCAGGGGACCTAGCTGGAGG + Intergenic
992407587 5:76474709-76474731 CATCCAAGTGACCTTGATGCAGG - Intronic
992975343 5:82111326-82111348 CACCCAGGAGACCTGCCTGGAGG - Intronic
993029907 5:82694244-82694266 CAGCCCTGTCACCTTCCTGGGGG - Intergenic
993045164 5:82858320-82858342 CTCCCAGGTGACCTTGATGCAGG + Intergenic
995717822 5:115097454-115097476 CAGCCAGGAGACCTGACAGGCGG + Intergenic
997882356 5:137602110-137602132 CTGCCAAGAGACCTTTCTGGGGG + Intergenic
999568382 5:152891714-152891736 CTGCCGTGTGACCCTGCTGGGGG + Intergenic
1000254147 5:159521700-159521722 CTGCAATGTGACCTTGGTGGGGG - Intergenic
1001755577 5:174165947-174165969 CAGCCATATGACATGGCTGGTGG + Intronic
1002948023 6:1781247-1781269 CCTCCAGGTGTCCTTGCTGCTGG + Intronic
1003778067 6:9391432-9391454 CAGCCCCGTGACCTTGCTCCTGG - Intergenic
1006778278 6:36613806-36613828 CAGCCACATAACCTTGCTGGTGG - Intergenic
1007619353 6:43202713-43202735 CAGGCAGCTCACTTTGCTGGTGG + Exonic
1007735957 6:43982313-43982335 CACCCAGCTGACCTTGATGGGGG + Intergenic
1008598466 6:53065782-53065804 TGGCCAGGTTACCATGCTGGCGG - Intronic
1009660576 6:66606096-66606118 CAGCCATGTGACAGTGATGGAGG - Intergenic
1010060608 6:71618157-71618179 CAGCCAGGTGATCTTCATGAAGG - Intergenic
1011553276 6:88549022-88549044 CAGCCAGATCTCCTTGTTGGTGG - Intergenic
1011842916 6:91524613-91524635 CAAACAGGTGACCTTTCTGACGG + Intergenic
1012581989 6:100880994-100881016 CGGCCAGGGGAGCTGGCTGGAGG - Intronic
1013883559 6:114934057-114934079 CAGGTAGGGGCCCTTGCTGGTGG + Intergenic
1014009727 6:116461989-116462011 CGGCCTGGTGACCCTGCTGACGG + Exonic
1016632200 6:146246386-146246408 CAGCCAGGTGAGGTGGCTGATGG + Intronic
1017033462 6:150245151-150245173 GAGCCAGTAGACCTTGCTGCTGG - Intronic
1019341048 7:509125-509147 CACCCGGGTGAACTTGCTGAAGG - Intronic
1019389863 7:780004-780026 CAGCCAGGTGACCAAGGTGGAGG - Exonic
1019901403 7:4023379-4023401 CAGCCAAGTGAACTTTCTGAGGG + Intronic
1019940574 7:4286084-4286106 CAGCTTGGTGACCTTTCTGGGGG - Intergenic
1020194969 7:6030387-6030409 CAGACACGTGACCTTGCAAGAGG + Intronic
1020241540 7:6399007-6399029 CAGCCAGGTGGGCTTCCGGGAGG - Intronic
1020603834 7:10309899-10309921 CACCCAGGTGAAGTTGTTGGAGG + Intergenic
1020788384 7:12595388-12595410 AAGTCTGGTGACCTTGCTGTAGG + Intronic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1024308431 7:47947506-47947528 CAGCAAGGTGACCTGCCTGTGGG - Intronic
1024582035 7:50808385-50808407 CGCTCAGGTGCCCTTGCTGGGGG - Intergenic
1029169662 7:98621657-98621679 CAGGCAGGGGGCCTTGGTGGGGG + Intronic
1029196514 7:98809375-98809397 CAGCCAGGTGACCCTGCCAAGGG + Intergenic
1029699125 7:102234979-102235001 AGGCCGGGTGACCTTGGTGGAGG - Intronic
1035627235 8:1080103-1080125 CAGCCATGTGGCCGTGCTGCAGG + Intergenic
1040673581 8:49722045-49722067 CAGTCAGGTGAAAATGCTGGAGG + Intergenic
1042454088 8:68979421-68979443 CAGCCAGGTGACCTCTCTGATGG - Intergenic
1042950401 8:74195660-74195682 CATCCAGGTGATCTTCCTGGAGG + Intergenic
1047064423 8:121264431-121264453 CAGCCAGGGGAACTTCGTGGAGG + Intergenic
1047310094 8:123684784-123684806 CAGCCAGGTGACATTTAGGGGGG - Intronic
1049615744 8:143575184-143575206 CAGCCACCTGTCCCTGCTGGAGG + Exonic
1049807100 8:144546058-144546080 GACCCAGGTGACCTGGCTGAGGG + Intronic
1054842712 9:69760306-69760328 ATGCCCGGGGACCTTGCTGGGGG - Intergenic
1056218629 9:84429446-84429468 CAGCCAGGTGAGCTTAAAGGAGG - Intergenic
1057227276 9:93299059-93299081 CAGCCAAGTGACCTGGGCGGGGG - Exonic
1060018624 9:120109303-120109325 CTGGCAGGTGACTTTGCTGCAGG + Intergenic
1060829788 9:126706181-126706203 AAGCCTGCTGACCTTGCTCGAGG - Intergenic
1061225566 9:129279088-129279110 CAGCGAGGTGACCTGGGTGGGGG + Intergenic
1061572468 9:131486194-131486216 TAGCCAGGTGGCCTGGCTGGGGG + Intronic
1061800045 9:133108836-133108858 CAGCCAGGTGCCCAGGATGGAGG + Exonic
1062309380 9:135927629-135927651 AAGCCAGGAGGCCTTGCTTGGGG + Intergenic
1062677033 9:137752707-137752729 CAAACAGGTGTCCTTGCTGCCGG - Intronic
1203367440 Un_KI270442v1:271100-271122 CAGCCAGATGACCTTGGGGCTGG + Intergenic
1185788261 X:2908805-2908827 CAGCCTGGTACCCTTGCTGCAGG - Exonic
1187499516 X:19828019-19828041 GAGTCAGGTGACCCTCCTGGCGG - Intronic
1190356930 X:49614503-49614525 CTGCCAGGTGCCCTGGCTGATGG - Intergenic
1190530249 X:51367851-51367873 TAGCCTTGTGTCCTTGCTGGTGG - Intergenic
1192545310 X:72007954-72007976 CAGCTGGGTGCCTTTGCTGGGGG + Intergenic
1196462802 X:115947422-115947444 CAGGCAGGTGACCATGGTGGGGG - Intergenic
1198450974 X:136767128-136767150 GAGCCAGGTGACCTGCCTGGGGG - Intronic
1199581817 X:149368179-149368201 CAGCCAGGAGCCCTACCTGGAGG - Intergenic
1200061018 X:153483792-153483814 CTCCCAGGTGAGCTTCCTGGGGG - Intronic
1201071246 Y:10149129-10149151 CAGCCAGATGACCTTGGGGCTGG - Intergenic
1201286631 Y:12384324-12384346 CAGCTTGGTGCCCTTGCTGCAGG + Intergenic